ID: 1151816432

View in Genome Browser
Species Human (GRCh38)
Location 17:76473635-76473657
Sequence CCAGGTCGCTCACCTGCCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151816416_1151816432 27 Left 1151816416 17:76473585-76473607 CCACAGGAAGCCGCAGCTCGGGG 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1151816432 17:76473635-76473657 CCAGGTCGCTCACCTGCCCTTGG 0: 1
1: 1
2: 0
3: 23
4: 201
1151816422_1151816432 17 Left 1151816422 17:76473595-76473617 CCGCAGCTCGGGGGGGCAGTGGG 0: 1
1: 0
2: 1
3: 27
4: 252
Right 1151816432 17:76473635-76473657 CCAGGTCGCTCACCTGCCCTTGG 0: 1
1: 1
2: 0
3: 23
4: 201
1151816414_1151816432 28 Left 1151816414 17:76473584-76473606 CCCACAGGAAGCCGCAGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1151816432 17:76473635-76473657 CCAGGTCGCTCACCTGCCCTTGG 0: 1
1: 1
2: 0
3: 23
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151816432 Original CRISPR CCAGGTCGCTCACCTGCCCT TGG Exonic