ID: 1151816738

View in Genome Browser
Species Human (GRCh38)
Location 17:76474840-76474862
Sequence CAGTGTGGGCCCTGGGCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 390}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151816728_1151816738 13 Left 1151816728 17:76474804-76474826 CCTATCGTGGAGGTAGCACAGAG 0: 1
1: 0
2: 1
3: 3
4: 100
Right 1151816738 17:76474840-76474862 CAGTGTGGGCCCTGGGCATGGGG 0: 1
1: 0
2: 2
3: 45
4: 390
1151816727_1151816738 21 Left 1151816727 17:76474796-76474818 CCGCAGCACCTATCGTGGAGGTA 0: 1
1: 0
2: 0
3: 9
4: 65
Right 1151816738 17:76474840-76474862 CAGTGTGGGCCCTGGGCATGGGG 0: 1
1: 0
2: 2
3: 45
4: 390
1151816724_1151816738 29 Left 1151816724 17:76474788-76474810 CCTTTGTTCCGCAGCACCTATCG 0: 1
1: 0
2: 0
3: 4
4: 17
Right 1151816738 17:76474840-76474862 CAGTGTGGGCCCTGGGCATGGGG 0: 1
1: 0
2: 2
3: 45
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151816738 Original CRISPR CAGTGTGGGCCCTGGGCATG GGG Intronic
900177763 1:1298351-1298373 CAAGGTGTGCCCTGGGCCTGGGG - Exonic
900316835 1:2061206-2061228 CAGTGTAGCCCCTGGGCGCGGGG + Intronic
900318091 1:2069351-2069373 CAGGGAGGGTCCTGGGCAAGGGG + Intronic
900620819 1:3586867-3586889 CAGGGTGAGGCCTGGGCTTGGGG - Intronic
901844083 1:11971182-11971204 CAGTGTGGGGCAGGGGGATGGGG + Intronic
901869231 1:12127654-12127676 CACTGTGGTCCCTGTGCAAGGGG + Intronic
902870411 1:19310873-19310895 CAGTGAGGGCCCAGGGAACGTGG - Intronic
903392062 1:22971564-22971586 CAGAGTGGGCCGTGAGCATGAGG - Intergenic
903742970 1:25568980-25569002 CAGTGCTGCCCCTGGGCACGCGG - Intergenic
904030426 1:27530068-27530090 TGGGGTGGGGCCTGGGCATGGGG - Intergenic
904431500 1:30467409-30467431 CAGGCTGCTCCCTGGGCATGGGG + Intergenic
904558642 1:31382059-31382081 TGGTGTGGGGCCTGGGGATGGGG + Intergenic
905659248 1:39708810-39708832 CAGCCGAGGCCCTGGGCATGGGG - Intronic
905862915 1:41362468-41362490 GAGTGTGCGCCCAGGGCGTGGGG + Intronic
906149169 1:43577698-43577720 CAGCCTGGGCCCTGGGAAGGTGG + Intronic
906209250 1:44003042-44003064 CCGGGTGGGCCCTGGGCCTTGGG - Intronic
907159792 1:52361593-52361615 CGATGTGGGCCATGGGCAGGGGG + Exonic
907246694 1:53113589-53113611 AAGTGGTGGCCCTGGGGATGGGG - Intronic
907759143 1:57340858-57340880 CAGTGTGGGACTTGTGCAGGAGG - Intronic
912700861 1:111877403-111877425 CAGGGGGTGCCCTGGGGATGGGG + Intronic
915146115 1:153796576-153796598 CAGTGTGGGCACTGGGCAGAGGG + Intergenic
915324865 1:155076415-155076437 TAGATTAGGCCCTGGGCATGTGG + Intergenic
915527507 1:156485090-156485112 CAGTAGGGTCTCTGGGCATGGGG - Intronic
915936538 1:160093110-160093132 CAGCCTGGGCCCTGGCTATGAGG - Exonic
917456054 1:175186976-175186998 GATTGTGGGCCTTGGGCAGGAGG + Intronic
917958063 1:180120550-180120572 CAATGTGTGCCCTTGGCAAGTGG + Intergenic
918105518 1:181412654-181412676 CAGAGTGGGCCCTGGGGAAGGGG + Intergenic
918341356 1:183570379-183570401 CCCTGTGGGGCCTGGGCCTGAGG - Intronic
918385980 1:184007926-184007948 AAGCGTGGGCCCTGGTAATGGGG - Intronic
919453912 1:197801141-197801163 CAGAGTGGGCACTGGGAGTGGGG - Intergenic
920305837 1:205017568-205017590 CAGCATGGGCCCTGGCCACGTGG - Exonic
920365584 1:205446700-205446722 CACTGTGGGCCCAGGGCAGCTGG + Intronic
920862462 1:209721747-209721769 CAGTGTGGATCCTGTGGATGGGG - Intronic
920950612 1:210568725-210568747 CAGTGTAGGCCCTGTGCAAATGG + Intronic
921153607 1:212420945-212420967 CAGGGTGGTGCCTGGGGATGTGG - Intergenic
921255146 1:213332217-213332239 CATGATGGGCCCTGGGCAGGTGG - Intergenic
921955826 1:220982371-220982393 CAGAGTGGGCACTTGGCATCTGG + Intergenic
922724523 1:227916178-227916200 CAGGGTGGGCCCAGGGCCAGTGG + Intergenic
922905754 1:229172395-229172417 CTGTGTGTGGGCTGGGCATGTGG - Intergenic
923366457 1:233266464-233266486 CAGGGATGTCCCTGGGCATGTGG - Intronic
924266698 1:242289938-242289960 CAGAATGGGCTCTGGGTATGTGG + Intronic
924558129 1:245134640-245134662 AAGTGAGAGCCCTGGGCAGGAGG - Intergenic
1062939033 10:1408013-1408035 CAGTGTGAGCCCTTGGAAGGTGG - Intronic
1063221498 10:3972858-3972880 AAGCCAGGGCCCTGGGCATGGGG - Intergenic
1065296319 10:24278523-24278545 CAATGTGGGCACTAGGCAAGTGG + Intronic
1065490146 10:26274659-26274681 ACTTGTGAGCCCTGGGCATGTGG + Intronic
1065600830 10:27366873-27366895 CAGTGTGGGCCCTGGGAAATAGG + Intergenic
1066385461 10:34937722-34937744 CATTTTGGGCCCTGGCAATGTGG + Intergenic
1066718136 10:38308619-38308641 CAGAATGGGCTCTGGGTATGTGG - Intergenic
1067069089 10:43119497-43119519 GAGAGGGGGCCCTGGGCGTGCGG - Intronic
1067093758 10:43285242-43285264 CAGTTTGGGCCCAGGAGATGAGG - Intergenic
1067415571 10:46099141-46099163 AAGTGTGGCTCCTGGGCAGGAGG + Intergenic
1067435624 10:46274243-46274265 AAGTGTGGCTCCTGGGCAGGAGG + Intergenic
1069540719 10:69291962-69291984 CAGTTTTGGCTTTGGGCATGTGG + Intronic
1069867578 10:71513224-71513246 CAGTGTGGCCAGTGGGGATGTGG + Intronic
1069871598 10:71536371-71536393 CAGAGAAGGCCCTGGGCAAGAGG + Intronic
1070089427 10:73270266-73270288 CACTCTGGGCTCTGGGCACGTGG + Intronic
1070761187 10:79025336-79025358 CAGCGTGGGCTCTGTGCAGGCGG + Intergenic
1070781226 10:79138422-79138444 CATTTTGGGCCCTGGGCCTTGGG + Intronic
1074431811 10:113400896-113400918 CAGAGTGTGCCCTGGACTTGTGG + Intergenic
1074757218 10:116632974-116632996 CAGTGTGGGCACAGGGAACGTGG + Intronic
1074843432 10:117376043-117376065 GAGGGTGGGCCCTGGGAAGGAGG + Intergenic
1076763164 10:132615769-132615791 CAGAGTGGGCCCTGGGTCAGTGG + Intronic
1076791029 10:132776822-132776844 TAGTGGGGGCCATGGCCATGAGG + Intronic
1077035275 11:491446-491468 CCAAGTGGGCACTGGGCATGAGG - Intergenic
1077106380 11:844218-844240 CAGGGTGGGCCCTGGGGAGTGGG + Intronic
1077223492 11:1427517-1427539 CAGGGAAGGGCCTGGGCATGTGG - Intronic
1077233766 11:1470219-1470241 CAGTGGGGGCAGTGGGGATGGGG - Exonic
1077369315 11:2174115-2174137 CAGTGTGGGCCATGAGCCTCCGG - Intergenic
1077903345 11:6508836-6508858 CAGTGAAGGCCCTGGGAACGTGG - Intronic
1079239788 11:18714334-18714356 CAGTATGGGCCCTGAGCACGAGG - Exonic
1079359287 11:19757044-19757066 CAGTGTGTTCTCTGGGCATCAGG - Intronic
1083963020 11:66025038-66025060 CAGTGGGGGACCTGTGCAGGAGG + Intronic
1083994537 11:66265600-66265622 CAGGATGGGCCCTGGGTCTGGGG + Intronic
1084146595 11:67268235-67268257 CGGTGAGGGCCATGGGCATGGGG - Intronic
1084604057 11:70162301-70162323 CAGTGAGGACCCTGGGCAGAGGG + Intronic
1084647109 11:70464985-70465007 CAGTAAGTGCCCTGGGGATGTGG + Intergenic
1085393682 11:76195327-76195349 CAGGGTGGGCCCTAGGCCAGTGG + Intronic
1088244962 11:107809008-107809030 CAGCGTGGGGCCGGGGCCTGAGG - Intronic
1089555966 11:119316175-119316197 CATGGTTGGCACTGGGCATGAGG + Intronic
1089582016 11:119487215-119487237 CACTGTGGGTCCTGGGTCTGGGG + Intergenic
1089739693 11:120573871-120573893 CAGTGTGGGCCTCTGGGATGTGG - Intronic
1091545160 12:1496704-1496726 CAGGGTGGGACCTGGGCACTGGG - Intergenic
1092407982 12:8234106-8234128 CAGGGTGGGCTTGGGGCATGGGG - Intergenic
1092531521 12:9349267-9349289 CAGTGTAGTCCCTGGGCAGAGGG + Intergenic
1096392006 12:51237076-51237098 CACAGTGGGACCTGGGCATTGGG - Intergenic
1096513076 12:52142578-52142600 CAGTGTGGCCTCAGGGCCTGGGG + Intergenic
1097177327 12:57150949-57150971 TAGTGTGCTCCCTGGGGATGTGG + Intronic
1101476131 12:105050349-105050371 AAGTGTGGGTTCTGGGAATGTGG - Intronic
1101639991 12:106581003-106581025 CCTTCTGGGCACTGGGCATGGGG + Intronic
1101962131 12:109258413-109258435 GAGAGTGGGTCCTGGGCGTGGGG + Intronic
1102027669 12:109722744-109722766 CAGTGTGGGCCCAGCGCTTGGGG + Intronic
1102236812 12:111298774-111298796 CAGGGTGGGCCCAGGGTAGGGGG + Intronic
1102257632 12:111425352-111425374 CAGCGTGGGCCCTTGGGAGGTGG + Intronic
1102698410 12:114817854-114817876 CACTGAGGGCCCTGGGAAAGTGG + Intergenic
1103520882 12:121536569-121536591 CAGTGTGGTCCGTGGGGGTGGGG - Intronic
1103897105 12:124279990-124280012 CAGTGTGGGTCCCGGGCAGCCGG + Intronic
1104272146 12:127292261-127292283 GAGTCTGAGGCCTGGGCATGTGG - Intergenic
1104588827 12:130068366-130068388 CAGAGGGGGCCCTGTGCATGAGG - Intergenic
1104805252 12:131585887-131585909 CAGTGGAGGCGCTGGGCCTGGGG - Intergenic
1104927550 12:132321596-132321618 CACAGTGGGCCCTGGGGTTGGGG - Intronic
1105409692 13:20161266-20161288 CTGCGCGGGCCCTGGGGATGTGG + Intergenic
1107853371 13:44591817-44591839 CAGAGTAGGCCCTGGGAGTGGGG - Intergenic
1109348393 13:61145202-61145224 CAAAGTGGGCACTGGGAATGGGG - Intergenic
1109904181 13:68816738-68816760 CAGTGGGGGCCCTGAGCTTGTGG + Intergenic
1112040352 13:95541022-95541044 CAGTGTGGGCCCTGGGCCACTGG - Intronic
1112387992 13:98958052-98958074 CATTGTGAGCCCTGGACAGGGGG + Intronic
1113752421 13:112785459-112785481 CGCTGTGAGCCCTGGGCAGGTGG - Intronic
1114073139 14:19131613-19131635 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1114089127 14:19268370-19268392 CAGTGTGCCCAGTGGGCATGGGG + Intergenic
1114423032 14:22600515-22600537 CAGTGTGGGCCAAGGGGATTTGG + Intronic
1114612886 14:24053802-24053824 TGGTGAGGGCACTGGGCATGTGG + Exonic
1116491564 14:45509491-45509513 CAGTGTGGGGCATGGACATAGGG - Intergenic
1116892137 14:50279373-50279395 AACTGTGGGGGCTGGGCATGAGG + Intronic
1117453226 14:55872591-55872613 CAGGGTGGGCCCTGAGAAAGGGG - Intergenic
1118944236 14:70368887-70368909 CTGTGTGCAGCCTGGGCATGGGG + Exonic
1118947197 14:70399016-70399038 CAGGGTGGACCCCGGGGATGCGG + Intronic
1121667942 14:95686626-95686648 CAGAGTGAGTCCTGGGCACGAGG + Exonic
1122529956 14:102418601-102418623 CTTTGTGGGCCCTGCCCATGGGG + Intronic
1122817355 14:104320237-104320259 CAGAGTGGGGCCTGGGCATCAGG + Intergenic
1122887248 14:104715573-104715595 CAGTGCTGGCCCCGGGCATGCGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123047252 14:105524999-105525021 CAGTGTGGGACGTGGGCAGTGGG + Intergenic
1123480111 15:20623243-20623265 CATTGTCAGCCTTGGGCATGAGG + Intergenic
1123637896 15:22377121-22377143 CATTGTCAGCCTTGGGCATGAGG - Intergenic
1125715134 15:41815402-41815424 CAGTGTGAGCCCTGAGGCTGTGG + Exonic
1125765687 15:42134069-42134091 CAGTGTGGGACTTGGGGCTGGGG - Intergenic
1125876959 15:43157185-43157207 CAATGTGGGTCCTGGGCTAGTGG + Intronic
1126703478 15:51387034-51387056 CATTGAGGCACCTGGGCATGTGG + Intronic
1126796934 15:52267082-52267104 CAGTCTTGGCCCTGGGACTGAGG + Intronic
1127975994 15:63997734-63997756 CAGTGTGGGCCATGTGGGTGAGG - Intronic
1128893246 15:71349843-71349865 CAGTGTGGGCCCAGGGAAGGGGG + Intronic
1129599280 15:76988851-76988873 CAGTGAGGGGCCAGGGCCTGGGG - Intergenic
1130021031 15:80232012-80232034 CACAGTGGGACCTGGCCATGGGG + Intergenic
1130674556 15:85940302-85940324 CAGGGTGAGGCCTGGGCATCAGG + Intergenic
1132394179 15:101460030-101460052 CAGTGTGGGGCCTGGGATAGTGG - Intronic
1132685266 16:1159444-1159466 CAGGGTGGGCCGTGGGGAGGAGG + Intronic
1133080387 16:3314456-3314478 CAGTGTGGGTCTTGGGCAGCAGG - Intronic
1133499998 16:6356994-6357016 CAGTCTTGGCCCAGGGCACGGGG - Intronic
1133781762 16:8944466-8944488 CAGTTTGGGGACTGGGGATGAGG + Intronic
1135980060 16:27140432-27140454 CAGTGTGGCCCCTGGGCATCTGG - Intergenic
1136349842 16:29699600-29699622 GAGTGTGGGTCATGGCCATGGGG + Intergenic
1137576329 16:49602626-49602648 CAGCCTGTGCCCTGGGCCTGCGG - Intronic
1138088471 16:54155082-54155104 CAGTGAGGGCCCTGAGGATATGG + Intergenic
1138449166 16:57082826-57082848 CAGTGTGACCCCTTGACATGTGG + Exonic
1138517160 16:57542529-57542551 GAGTGTGGTGCCTGGGCCTGGGG + Intronic
1140224430 16:73066723-73066745 CGGCGTGGGCCCTGGGCGCGAGG - Intergenic
1142314404 16:89334537-89334559 CCATGTGGGCAGTGGGCATGCGG + Intronic
1142869039 17:2808759-2808781 CAGGATGGGCCCTGTGCCTGAGG + Intronic
1142939001 17:3365596-3365618 CAATGTGGGTCCTTGACATGTGG - Intergenic
1143106505 17:4533024-4533046 CCACGGGGGCCCTGGGCATGTGG + Exonic
1143187801 17:5020962-5020984 CAGAGTGGGAAATGGGCATGGGG + Intronic
1143455375 17:7064368-7064390 CCGTGTGAGCCCTGGGGTTGTGG + Intergenic
1144960363 17:19041199-19041221 CAGGTTGGGCTCTGGGCAGGTGG - Intronic
1144974796 17:19133325-19133347 CAGGTTGGGCTCTGGGCAGGTGG + Intronic
1145789225 17:27614760-27614782 CAGTGTGGGATCAGGGCGTGGGG + Intronic
1145978174 17:28996333-28996355 GGGTGTGGGCCCTGAGCCTGTGG + Intronic
1146185384 17:30720994-30721016 CAGTGTGGGCCCGGGGGTGGGGG + Intergenic
1146675813 17:34773206-34773228 CAGTGTGTGCCATGGGCCCGTGG + Intergenic
1147388563 17:40095837-40095859 CACTGTGGGCTCAGGGCTTGGGG + Exonic
1147723971 17:42554986-42555008 CTGTGTGGTCCCTGGGGATGGGG + Exonic
1147965398 17:44191988-44192010 GCGGGTGGCCCCTGGGCATGCGG + Exonic
1148158020 17:45434425-45434447 TATTGTGTGCGCTGGGCATGTGG - Intergenic
1150240011 17:63623117-63623139 CAGTGTGGGGCCCGGGCTGGAGG + Intronic
1150441579 17:65195864-65195886 CAGTGTGGGCCCTGGACCAGCGG + Intronic
1150605335 17:66685959-66685981 CAGTGTGGTCCCTGGACCGGCGG - Intronic
1151492809 17:74442895-74442917 CAGTGTGGGGGCGGGGCCTGAGG - Intronic
1151816738 17:76474840-76474862 CAGTGTGGGCCCTGGGCATGGGG + Intronic
1151881597 17:76898901-76898923 CAGCGTGGGCCCTGTGCTCGGGG - Intronic
1151890954 17:76950017-76950039 CAGGCGGGGCTCTGGGCATGGGG - Exonic
1152039192 17:77892218-77892240 CACTGTGGCCCCTGAGGATGGGG + Intergenic
1152226490 17:79095225-79095247 CACTGTGGGCACGGGGCTTGCGG + Intronic
1152305729 17:79519254-79519276 GAGTGTGAGCCCTGGGGGTGGGG - Intergenic
1152457294 17:80423681-80423703 CTGTGGTGGCCCTGGGCATGAGG + Intronic
1152742454 17:82024266-82024288 CAGTGTGGCCCCTGTGTAAGGGG - Exonic
1154396774 18:13997982-13998004 GGGTGTGGGAGCTGGGCATGCGG - Intergenic
1157475799 18:48022682-48022704 CAGCTCAGGCCCTGGGCATGGGG - Intergenic
1157480449 18:48050405-48050427 CAGTGTGGGCGCTCTGCCTGGGG - Intronic
1157545224 18:48541465-48541487 CAGATCGGGCCCTGGGCAGGAGG - Intronic
1158491204 18:57911091-57911113 CTGAGGGGGACCTGGGCATGTGG + Intergenic
1158702468 18:59760849-59760871 CTGAGTGGGGCCTGGGCATCTGG - Intergenic
1159300661 18:66562124-66562146 CAGGGTGGGGAGTGGGCATGGGG + Intronic
1160168350 18:76532272-76532294 CAGGTGGGGTCCTGGGCATGTGG + Intergenic
1160200530 18:76792173-76792195 CAGTGTGGGGCCTGAGCAGGCGG + Intergenic
1160513553 18:79466049-79466071 AAGTGTGGCCCCTGGGCACAGGG + Intronic
1160721115 19:597270-597292 CAGTGTGGGCCGTGGATAAGAGG + Intronic
1160856250 19:1219191-1219213 CAGGGTGGGCCCTGGTCCCGAGG + Intronic
1160910541 19:1471908-1471930 GGGTGTGGGCCCGGAGCATGGGG - Exonic
1161016750 19:1987129-1987151 CTGAGTGGGGCCTGGGGATGAGG + Intronic
1161239028 19:3211509-3211531 CTGTGTGGCCCTGGGGCATGGGG + Intergenic
1161723177 19:5914763-5914785 AGGCGTGTGCCCTGGGCATGGGG + Intronic
1162238057 19:9323863-9323885 CAGTGTGGGAACTGGCCAAGCGG - Exonic
1162302147 19:9850103-9850125 CAGTGTGGGGGCTGTGGATGTGG + Intergenic
1162601652 19:11674402-11674424 CAGAGAGGGCGCTGGGCCTGGGG - Intergenic
1162973388 19:14194702-14194724 CAGTGTGGGCCCGGGGGTGGGGG - Intronic
1163041633 19:14607138-14607160 CTCTGTGGGCCCTGACCATGGGG + Intronic
1163488857 19:17605595-17605617 GAGGGGGGGCCCTGGGCAAGGGG - Exonic
1163775286 19:19213715-19213737 CAGTGTGCACCCTTGGCACGGGG + Intronic
1164099414 19:22041536-22041558 CAGCCTGGGCCCTGCCCATGAGG - Intergenic
1165286191 19:34844353-34844375 CAGTGGGGGTGCTGGGCAGGGGG + Intergenic
1165307240 19:35010233-35010255 CGGGGTGGGGCCTGGCCATGGGG - Intronic
1165432839 19:35782244-35782266 CAGTGTAGGACCTGGGGAAGAGG + Intronic
1165901971 19:39173386-39173408 CAGTGGGGGCCCTGGGGCGGGGG - Intronic
1166194642 19:41197836-41197858 CTCTGCGGGACCTGGGCATGGGG + Exonic
1166344460 19:42156649-42156671 CAGACTGGGCCTGGGGCATGTGG + Intronic
1166752120 19:45169234-45169256 CAGTGTGGGACCTGGGCCAATGG + Intronic
1167574881 19:50313116-50313138 CGGTGTGGTCTCTGGGCTTGGGG + Intronic
1168020767 19:53607144-53607166 CAGTGGGGGCCCCGGGCTTGTGG - Intergenic
1168315935 19:55484807-55484829 GAGTGGGGTCCCTGGGGATGGGG + Intergenic
925631232 2:5895438-5895460 CTGTGTTGGCTCTGGGCCTGGGG + Intergenic
926290717 2:11527543-11527565 CAGAGTGGGACCTGGGCATCTGG + Intergenic
930387129 2:50711228-50711250 GGGTGTGGGTCCTGGGAATGTGG - Intronic
930418632 2:51121231-51121253 GAGTGGGGGCCGTGGGCATTTGG - Intergenic
932321754 2:70827518-70827540 GGGGCTGGGCCCTGGGCATGGGG - Intergenic
933596966 2:84291929-84291951 GAATGAGGGCCCTGGGCATTAGG - Intergenic
933991851 2:87639661-87639683 CAGTGGGGGTCTTGGGAATGAGG - Intergenic
934117663 2:88811988-88812010 GAGAGTGGGCCTTGGGCAGGAGG - Intergenic
935146029 2:100396101-100396123 CACTGTGGGCCAGGGGCATGTGG - Intronic
935280929 2:101517147-101517169 CAGTGTGGACCCTGGAGCTGGGG + Intergenic
935381244 2:102453032-102453054 CAGTGTGGGCACTTCGCATGAGG - Intergenic
935884187 2:107597716-107597738 CAGTGTGGGCCCTGGACACTTGG + Intergenic
936301993 2:111311157-111311179 CAGTGGGGGTCTTGGGAATGAGG + Intergenic
937447938 2:121974707-121974729 TAGTGTGGCCCCTTGGCATGGGG - Intergenic
937924033 2:127154070-127154092 CAGGGTGGCCCATGGGCCTGAGG - Intergenic
938293314 2:130161716-130161738 CAGTGAGGGCCCTGGGCTCTTGG - Intronic
938463238 2:131511247-131511269 CAGTGAGGGCCCTGGGCTCTTGG + Intergenic
939511589 2:143112874-143112896 AAATGTGGGAGCTGGGCATGAGG + Intronic
939633334 2:144551558-144551580 CAGTGGGGGCCATGGACATTCGG + Intergenic
940817785 2:158315540-158315562 TAGTGTGTGCCCTGGGAAGGGGG + Intronic
941447377 2:165618666-165618688 CTGTGTGGGCTCTGGACAAGAGG - Intronic
942525682 2:176850320-176850342 CAGTGTTTGCCCTGGACATAGGG - Intergenic
942527768 2:176873600-176873622 CAGTCTGGGACCTGGGCAGCAGG + Intergenic
945024831 2:205610269-205610291 AAGTGTGGTACCTGGGCTTGAGG - Intronic
945756503 2:213853917-213853939 CATTTTAGACCCTGGGCATGCGG - Intronic
946519187 2:220447090-220447112 CAGTGTTGGTCCTGGGGATGAGG - Intergenic
948479218 2:238239854-238239876 CCGTGTGGGCCGTGAGGATGAGG - Exonic
948524200 2:238560271-238560293 CAGAGTGGCCTCTGGGCCTGTGG + Intergenic
948863599 2:240764474-240764496 CTGTGGGGTCCCTGGGCAGGAGG - Intronic
1168908735 20:1427979-1428001 GAGTCTGGGACCTGAGCATGTGG - Intergenic
1169792205 20:9423383-9423405 CAGAGTGGGGCCTGGGAATTGGG - Intronic
1170315021 20:15032121-15032143 CAGAGTGGGCACTGGGAGTGAGG + Intronic
1171011515 20:21511876-21511898 CGGGGTGGGGCCTGGGCCTGGGG + Exonic
1171288965 20:23969113-23969135 CAGTGAGGGGTCAGGGCATGAGG + Intergenic
1171375654 20:24692543-24692565 CGAGGTGGGCCCTTGGCATGGGG + Intergenic
1171421048 20:25017875-25017897 CTGAGTGGGCCCTAGGCATTAGG - Intronic
1171448697 20:25221809-25221831 CAGACTGGGCACTCGGCATGAGG + Intronic
1172110235 20:32540298-32540320 CACTGTGGCCACTGGGCATTTGG + Intronic
1172622857 20:36331181-36331203 GAGTGTGGGCACTGGACAGGAGG - Intronic
1172950952 20:38723344-38723366 CAGTGTGGCCTCTGAGAATGAGG - Intergenic
1174110242 20:48193720-48193742 AGGTGGGGGCCCAGGGCATGGGG - Intergenic
1175241444 20:57552499-57552521 CAGTGGGGTCCCTGGGCTTTTGG - Intergenic
1175786155 20:61712812-61712834 CCGCATGGGCCCAGGGCATGGGG - Intronic
1175860789 20:62149045-62149067 CGGTCTGGGCCCTGGGCCAGTGG + Intronic
1175863769 20:62163769-62163791 GAGTGTGGACCCTGGGGGTGAGG + Intronic
1175928191 20:62481019-62481041 CTCTGGGGGCCCGGGGCATGCGG - Intergenic
1176233753 20:64044817-64044839 CAAGCTGGGTCCTGGGCATGGGG + Intronic
1179482609 21:41687970-41687992 CAGTCAGGGCCCAGGACATGGGG + Intergenic
1179818483 21:43922889-43922911 CAGCCTGGGGTCTGGGCATGGGG + Intronic
1179910393 21:44444363-44444385 CTGTCTGTGCCCTGGGGATGGGG + Intergenic
1179940593 21:44637039-44637061 CAGCGTGGGCCCTCAGCCTGGGG - Intronic
1180025451 21:45158605-45158627 ACCTGTGAGCCCTGGGCATGAGG - Intronic
1180073241 21:45449182-45449204 AAGGGTGGGCCCTGGGGCTGCGG + Intronic
1180170737 21:46056951-46056973 AAGTGTGGGACGTGGGCGTGGGG + Intergenic
1180176623 21:46093632-46093654 CACTGTGGGCCCTGAGGATGAGG - Intergenic
1180491580 22:15853966-15853988 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1180658594 22:17446015-17446037 CAGCATGGGCCCTGTGGATGTGG + Intronic
1180976965 22:19853916-19853938 CACTGTGGCTCCCGGGCATGGGG - Intronic
1180977492 22:19856301-19856323 CAGAGTGGGCAGTGGGCCTGTGG + Intergenic
1181428220 22:22857608-22857630 CTATGTGGGCCCTGAGCCTGAGG - Intronic
1181859205 22:25805261-25805283 CATTGTGTGCCCTGGGCAAGTGG - Intronic
1182051763 22:27317730-27317752 CACTGTGGGCCCAGGTCTTGGGG - Intergenic
1182098103 22:27639373-27639395 CAGGATGGGGCCTGGGCATCTGG - Intergenic
1182149416 22:28017831-28017853 CTGTGTTAGCCCTGGGGATGGGG - Intronic
1182466588 22:30520592-30520614 CCATGTGGGCCCTGGGCATTGGG - Intergenic
1183188276 22:36304952-36304974 CAAGGTGGGCCCTGGCCACGTGG + Intronic
1183349951 22:37329527-37329549 CAGGGTGGGACCAGGGGATGGGG + Intergenic
1183414217 22:37673382-37673404 CAGAGTGGGCTTTGGGCATCTGG + Intergenic
1183539775 22:38423307-38423329 CAGTGTGGGCACTGGGGGAGGGG - Intergenic
1184456912 22:44616089-44616111 CAGGTTGGGCCCTGAGCATCAGG + Intergenic
1184858827 22:47161756-47161778 AAGTGTGTGCCGTGGGCTTGTGG + Intronic
1185073416 22:48669532-48669554 CAGGGTGCTCCCTGGTCATGTGG - Intronic
1185088520 22:48753416-48753438 CAGTGGGGGCCCTGGGCAGAGGG - Intronic
1185193161 22:49451677-49451699 CAGTGTGGGTCCTGCCCAGGAGG - Intronic
1185255676 22:49829315-49829337 CACTGGGTGCCATGGGCATGAGG - Intergenic
1185319476 22:50193875-50193897 CAGGCAGGCCCCTGGGCATGGGG + Intronic
1185331727 22:50255031-50255053 CCCTGTGGGCCCTGTGCAGGTGG - Intronic
950360359 3:12445420-12445442 CAGTTTCCGCCCTGGGCCTGTGG - Intergenic
950522412 3:13504994-13505016 CAGCGAGGGCCCTGGGCTTGGGG + Exonic
950540571 3:13609860-13609882 CACTGTGTGCCCTGGGCATCAGG + Intronic
950544242 3:13629363-13629385 CAGTGGAGGTGCTGGGCATGGGG - Intronic
951559546 3:23952141-23952163 AAGTGTGGGCCCTGGACTAGGGG - Intronic
951852873 3:27162542-27162564 TAATGTGGGCCCTGAGCATGTGG + Intronic
951972433 3:28462228-28462250 CTGTCAGTGCCCTGGGCATGTGG + Intronic
952076248 3:29701450-29701472 CAGAGTGGGCCCTGAGGCTGAGG - Intronic
952211435 3:31232410-31232432 CTGTGTGACACCTGGGCATGGGG - Intergenic
953914592 3:46910129-46910151 CAGTGAGGGGCTTGGGCTTGAGG + Intergenic
954553308 3:51499777-51499799 CAGAGTGGGCGCCGGGCTTGGGG - Intronic
954736989 3:52715016-52715038 CAGCCTGGGCCCCGGGCAGGAGG + Intronic
955114713 3:55986158-55986180 CAGTGTGTGCCCAGGGCTTTTGG - Intronic
955594539 3:60574450-60574472 CAGTGTGGTACCTGGTGATGGGG + Intronic
955976988 3:64489214-64489236 CAGAGTTTGCCCTGCGCATGAGG - Intergenic
961446778 3:126984696-126984718 CAGTGTGTGCTCTGGGGGTGGGG + Intergenic
961676105 3:128567754-128567776 CAGGGTGGACCCTTGGCAGGTGG - Intergenic
962207307 3:133445483-133445505 AAGTGTGGGCCCTGGACCAGTGG - Intronic
962435526 3:135363022-135363044 CAGTGTGGGCCCTACTCAAGAGG - Intergenic
962827093 3:139108032-139108054 CAGAGTGAGCCCTGGGCCTTGGG - Intronic
963854012 3:150235707-150235729 CAGTATTGTGCCTGGGCATGAGG - Intergenic
965229318 3:166029737-166029759 CAGACTGGGCACTGGGTATGGGG + Intergenic
965439279 3:168692562-168692584 TATTGTGGGCCCTGGGCACTTGG + Intergenic
967891938 3:194369802-194369824 CAGTGTTGGCCCTGGGAGGGGGG + Intergenic
968107655 3:196013958-196013980 CAGTGTGGCCCCAGGGCCTCGGG + Intergenic
968608724 4:1547307-1547329 CAGTGTGGGCCCTGAGCCTCGGG + Intergenic
968704397 4:2071272-2071294 CAGTGAGGCCACTGTGCATGAGG + Intergenic
968902128 4:3436755-3436777 CGGTGAGGGGCCTGCGCATGTGG + Intronic
968902746 4:3439069-3439091 GAGGATGGGCCCTGGGCCTGGGG + Intronic
968932129 4:3586728-3586750 CAGCGGGGGCCCTGGGCAGGCGG + Intronic
969032424 4:4225838-4225860 CAGTGCGGGCTGGGGGCATGTGG + Intronic
970450069 4:16157478-16157500 CAGTGTGGTCCCTGGGCCAGTGG - Intergenic
970910195 4:21266139-21266161 CAGTGTGGGCTCTGTACATGTGG - Intronic
973707316 4:53593221-53593243 CAGGGTGTCCCCTGGGCAAGGGG + Intronic
981603327 4:146516822-146516844 CAGCATGGGCCCTGAGGATGTGG - Intronic
985672810 5:1214865-1214887 GAGGGTGGGCCCTGGGTGTGAGG + Intronic
985997715 5:3605990-3606012 CACTGCGAGCCCTGGGCCTGGGG + Intergenic
986030305 5:3887225-3887247 CAATGTTGGCCATGGGCATATGG - Intergenic
986443126 5:7798500-7798522 CAGTGTGGGCCTTTTGCAAGTGG - Intronic
986950636 5:13080455-13080477 CAATGTGGACCCTGGGCTTCAGG - Intergenic
987844008 5:23258095-23258117 AACAGTGGCCCCTGGGCATGGGG - Intergenic
988481788 5:31638006-31638028 CAGAGTGGGCCCAAGGCATTTGG - Intergenic
990528023 5:56647330-56647352 CAGCCTGGGCCCTGTGCACGGGG - Intergenic
991975232 5:72178450-72178472 CAGTGTTGAACCTGGGCAGGGGG + Intronic
992709537 5:79436500-79436522 AAGTGTGTGCCTTTGGCATGTGG - Intronic
995723925 5:115165853-115165875 CAGAGTGGGCACTGGGAATGGGG - Intronic
995774323 5:115709502-115709524 AAGTGTGGCCCATGGGCAGGAGG + Intergenic
997211551 5:132079896-132079918 CAGTGTGGGACCTGGGGAGGAGG + Intergenic
997283035 5:132660464-132660486 CAGGCTGAGCCCTGGGCAAGGGG - Exonic
997428232 5:133819041-133819063 GTGTGTGGGCGGTGGGCATGTGG - Intergenic
997818361 5:137039611-137039633 TGGTGTGGGCCCTGCCCATGGGG - Intronic
998216414 5:140241338-140241360 CCGTGTGGGGCATGGGCATCAGG - Intronic
998376571 5:141694790-141694812 CAGTGGGGGGCATGGGGATGGGG + Intergenic
1000046084 5:157523116-157523138 CAGTGTGGGCTCCAGGCATGGGG + Intronic
1001572668 5:172740852-172740874 CAGGGTGGGCACTGGGGGTGGGG - Intergenic
1002052338 5:176578105-176578127 CAGGGTGGGCCGTAGGCAGGTGG + Intronic
1002054526 5:176591134-176591156 CAGTGGAGGCCCTGAGCCTGTGG - Intronic
1002094428 5:176822756-176822778 CAGGCTGGGACCTTGGCATGTGG + Intronic
1002135580 5:177105671-177105693 CAGTTAGGGCCCGGGGAATGTGG - Intergenic
1002160263 5:177310748-177310770 CACTGGGGGCCCTGGGATTGGGG - Intronic
1003684846 6:8292287-8292309 CCATGTGGACCCTGGCCATGGGG - Intergenic
1004031495 6:11874405-11874427 CAATGTGGGCCCTGAGGAAGGGG + Intergenic
1004927120 6:20426710-20426732 AAGTTTAAGCCCTGGGCATGAGG - Intronic
1006297857 6:33177989-33178011 CAGTGTGGGGCCAGAGCAGGGGG + Intronic
1006902443 6:37511888-37511910 CAGTGGGGGCCCTCGCCCTGTGG - Intergenic
1007121313 6:39384476-39384498 CACTGTTGGCCCTGGGACTGGGG - Intronic
1007429895 6:41770753-41770775 CAGGGTGGGTGGTGGGCATGGGG + Exonic
1009712997 6:67348393-67348415 CCATGTGGGGCCAGGGCATGTGG + Intergenic
1009846972 6:69146324-69146346 CAGAGTGAGCACTGGGAATGGGG + Intronic
1009926270 6:70124936-70124958 CAGTGTGGGTGCTGGGAAAGTGG - Intronic
1010085910 6:71917891-71917913 CACTTTGGGGCCTGGGCATCTGG + Intronic
1011553876 6:88554814-88554836 CCTCGTGGGCCCTGGGCCTGAGG - Intergenic
1013327981 6:109067312-109067334 CAGGGTGGGCACTGTGCAGGAGG - Intronic
1014018841 6:116565393-116565415 CAGTGTGGGCAGCGGGGATGGGG + Intergenic
1015391989 6:132693073-132693095 CAGCTTGGGCTATGGGCATGAGG - Exonic
1016548490 6:145250602-145250624 CAGTGTTGTCCCAGGGCAGGTGG + Intergenic
1016894329 6:149037584-149037606 CAGTGGGGCCCCTGTGCCTGCGG + Intronic
1018648085 6:165966451-165966473 AACTGTGGGCCCTGGACGTGAGG + Intronic
1018728844 6:166634036-166634058 GAGTGTGGGCTCAGGGCGTGGGG + Intronic
1019285831 7:222487-222509 CAGTGCCAGCCCTGGGCCTGGGG - Intronic
1019338973 7:499344-499366 CAATGTGGGACTTGGGCCTGCGG - Intronic
1019625289 7:2012790-2012812 GCATGTGGGCCCTGGGCCTGGGG + Intronic
1019779030 7:2929035-2929057 CAGTGTGGGCCTGGGGCGTGGGG + Intronic
1022179619 7:27906271-27906293 CAGTGTCTGCCTGGGGCATGTGG - Intronic
1022443891 7:30454476-30454498 CAGTGTAGGGTCTTGGCATGTGG + Intronic
1022533469 7:31081328-31081350 CAACGTGGGCCCAGGGCTTGGGG - Intronic
1022580946 7:31553472-31553494 CTGTGTGGGGTCTGGGCATGAGG + Intronic
1022603100 7:31780148-31780170 CTGGGTGGGACCTGGGCATGAGG + Intronic
1023863873 7:44229648-44229670 CTGTGGGGGTCCTGGGCCTGTGG + Intronic
1024084967 7:45885221-45885243 CAGGGTGGGCCCTGGGAGAGAGG - Intergenic
1024248413 7:47488268-47488290 CAGTGTCAGCACTGGGAATGAGG - Intronic
1024691111 7:51804533-51804555 CAGTGTTGGACCGGAGCATGAGG + Intergenic
1026375842 7:69749990-69750012 GAATGTAGGCCCTGGGGATGAGG + Intronic
1029459147 7:100685411-100685433 CAGGGTGGGCAGTGGGGATGGGG + Exonic
1030964893 7:115979507-115979529 CAGTTTGTTCCCTGAGCATGTGG + Intronic
1032201817 7:129827540-129827562 TAGAGTGAGCCCTGGGCAGGAGG + Intergenic
1032256880 7:130304615-130304637 GAGGCTGGGTCCTGGGCATGAGG - Intronic
1032425720 7:131820754-131820776 CAGAGTGTGCCCTGAGCATTGGG + Intergenic
1034406277 7:150904538-150904560 CTCTGTGGGCCAAGGGCATGAGG + Intergenic
1034473612 7:151269953-151269975 AAGTGTGGGCCATGGCCTTGGGG + Intronic
1034871192 7:154685435-154685457 CAGGGTGGGGCCTGGGCGTCAGG + Intronic
1035023655 7:155813211-155813233 CAGTGTGTGCGCTGGGTGTGTGG + Intergenic
1035350330 7:158241020-158241042 CACAGGGGGCCCTGGGCCTGAGG - Intronic
1035795788 8:2355517-2355539 CTGTGTGGGACCTGGGAGTGAGG + Intergenic
1035795869 8:2355833-2355855 CTGTGTGGGGCCTGGGAGTGAGG + Intergenic
1035795882 8:2355872-2355894 CTGTGTGGGGCCTGGGATTGGGG + Intergenic
1036381172 8:8237422-8237444 CAGGGTGGGCTCGGGGCATTGGG + Intergenic
1036848392 8:12185206-12185228 CAGGGTGGGCTCGGGGCGTGGGG - Intronic
1036869752 8:12427487-12427509 CAGGGTGGGCTCGGGGCGTGGGG - Intronic
1037949171 8:23007577-23007599 CAATGTGGGCAATGTGCATGAGG - Exonic
1039843437 8:41309318-41309340 CAGTGGCGGCCCTCGGCCTGCGG + Exonic
1042323602 8:67504663-67504685 CAGCTGGAGCCCTGGGCATGAGG - Intronic
1042440564 8:68821201-68821223 GAGTGTGGGGCCTGAGCATTTGG - Intergenic
1044021741 8:87113202-87113224 CAGTGTGAGCCATGGGCAGTAGG + Intronic
1045287621 8:100805455-100805477 CAGTGTGCGGCCAGTGCATGGGG + Intergenic
1045288226 8:100810155-100810177 TAGTCTGGGCTCTGGGCAGGAGG - Intergenic
1047182551 8:122603398-122603420 CAGTCTGGTCCCTGGGCAAAAGG + Intergenic
1047387938 8:124426716-124426738 GAGTGAGGGGGCTGGGCATGTGG - Intergenic
1048000788 8:130377888-130377910 AAGTGTGGGCAGTGGGCAGGGGG - Intronic
1048129500 8:131678722-131678744 CAGTGTTGGACTTGGGTATGTGG - Intergenic
1048330219 8:133466012-133466034 CAGAGTGGTGCCTGGGAATGTGG - Exonic
1048971160 8:139645621-139645643 GAGTGTGGGGCATGGGCAGGAGG - Intronic
1049180780 8:141220954-141220976 CTGAGTGGGCACTGGCCATGGGG - Intronic
1049202010 8:141344960-141344982 CAGGGTGGGTTCTGGGCCTGTGG - Intergenic
1049389630 8:142361067-142361089 CTGTGTGGGGCCTGGCCCTGTGG - Intronic
1049426573 8:142540550-142540572 CAGCGAGGGGCCTGGGCCTGGGG + Intronic
1049432395 8:142571399-142571421 CTGTCTGGGCCCCAGGCATGGGG + Intergenic
1049673721 8:143880598-143880620 CAGCGTGGGCACTGGTCTTGGGG - Intergenic
1054458006 9:65445200-65445222 CAGCGGGGGCCCTGGGCAGGCGG - Intergenic
1056311034 9:85341147-85341169 CAGTGTGAGCCCTGGGGTGGAGG + Intergenic
1057040549 9:91844653-91844675 CAGTATGGGGGCTGGACATGGGG - Intronic
1057292374 9:93814822-93814844 CAGTGTGGGCCCTGCAGAGGGGG + Intergenic
1060405074 9:123368955-123368977 GAATGTGGGCCCTGGGCAGGGGG + Intronic
1060748941 9:126156158-126156180 AACTGTGGGCCCCGGGCATATGG + Intergenic
1061013862 9:127970962-127970984 CAGGCTGGGCCCTGGAGATGTGG - Intronic
1061457389 9:130708837-130708859 GAGTCTGGGCATTGGGCATGGGG + Intergenic
1061491490 9:130947335-130947357 CAGTCTGGGCTCTTGGGATGGGG + Intergenic
1061499522 9:130993926-130993948 AACTGTGGCCCCTGGGCATGGGG - Intergenic
1061757341 9:132824308-132824330 CAGTCTGGGGCCTTGGCAGGAGG - Intronic
1061856603 9:133445051-133445073 ATGTGAGTGCCCTGGGCATGAGG + Exonic
1062329120 9:136029096-136029118 CAGCCTGGGCCCTGGGCTTCAGG - Intronic
1062369411 9:136229950-136229972 CAGTCTGGGCCCAGGCCAGGTGG + Intronic
1062504335 9:136865694-136865716 CAGGGTGGGCACTGGGAACGGGG - Intronic
1062686240 9:137814902-137814924 CAGTGTGGGCGCTGGGCTTGAGG + Intronic
1186638619 X:11431631-11431653 TAGTGTGGGCACTGGGTTTGGGG - Intronic
1187458504 X:19464451-19464473 AAGTGTAGGCTCTGGGCAGGTGG + Intronic
1187527385 X:20066375-20066397 CAGTGTAGGCAGTGGGAATGAGG + Intronic
1191016277 X:55813475-55813497 CAGAGTGGGCGCTGGGAGTGGGG - Intergenic
1192536018 X:71928521-71928543 CAGAGTGTGCCCTGGGCAAGGGG + Intergenic
1193250781 X:79288722-79288744 TAGAGTTGGCCATGGGCATGGGG - Intergenic
1199451190 X:147980909-147980931 CAGTGTGCACTCTGGGAATGAGG + Intergenic
1200771016 Y:7125544-7125566 AAGTGTGGGGGCTGGGCTTGAGG - Intergenic