ID: 1151817971

View in Genome Browser
Species Human (GRCh38)
Location 17:76480876-76480898
Sequence AAGCCCACGCTGCCACAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151817967_1151817971 2 Left 1151817967 17:76480851-76480873 CCCTTTATACTCCAGACTGTGCA 0: 1
1: 0
2: 2
3: 30
4: 283
Right 1151817971 17:76480876-76480898 AAGCCCACGCTGCCACAAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 87
1151817968_1151817971 1 Left 1151817968 17:76480852-76480874 CCTTTATACTCCAGACTGTGCAG 0: 1
1: 0
2: 5
3: 418
4: 7043
Right 1151817971 17:76480876-76480898 AAGCCCACGCTGCCACAAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 87
1151817970_1151817971 -9 Left 1151817970 17:76480862-76480884 CCAGACTGTGCAGGAAGCCCACG 0: 1
1: 0
2: 1
3: 12
4: 124
Right 1151817971 17:76480876-76480898 AAGCCCACGCTGCCACAAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151817971 Original CRISPR AAGCCCACGCTGCCACAAGC CGG Intronic
901220213 1:7579365-7579387 AAGCCCACGCTGCCATGCCCAGG - Intronic
901770076 1:11525473-11525495 AAGCCCACGCTGCTACCACTCGG - Intronic
902683502 1:18060291-18060313 AAGGCCAAGCTGCCCCAGGCAGG - Intergenic
905282599 1:36858843-36858865 AAGCCCACGCTGCATCTTGCTGG + Intronic
911420189 1:97631287-97631309 AAGCCCAGCCAGCCACAATCAGG + Intronic
913320884 1:117587635-117587657 GAGCACACACTGCCACGAGCTGG - Intergenic
922576316 1:226663209-226663231 AAGCACCCACTGCCACTAGCAGG - Intronic
1065260831 10:23921814-23921836 AAGTCCACACAGCCACAACCTGG - Intronic
1074849468 10:117427581-117427603 AATCCCACTCTGCCACATGGGGG - Intergenic
1076313840 10:129527057-129527079 AAGCCCACGGCCCCACAGGCTGG - Intronic
1078153097 11:8775635-8775657 AAGGACACGCTGCCGGAAGCAGG + Intronic
1078511613 11:11988523-11988545 AAGCCCTCGCTACCACAGGTGGG + Intronic
1084518448 11:69648798-69648820 AGGCCCACCCAGCCCCAAGCTGG - Intronic
1084567483 11:69939716-69939738 CAGCCCACGCCGCCCCAGGCTGG + Intergenic
1092052783 12:5484273-5484295 AAGCCCAGGGTGCCAGAAACTGG - Intronic
1094254902 12:28412508-28412530 AAGACCACGATCCCACCAGCAGG - Intronic
1118735978 14:68702300-68702322 CAGCCCAGGCTGCCTCAGGCAGG - Intronic
1119466643 14:74863540-74863562 CAGCCCACGCTGCCCAAAGAAGG - Exonic
1119921000 14:78445934-78445956 ACCCCCACTCTCCCACAAGCAGG - Intronic
1121407158 14:93726059-93726081 GAGCCCACCCTCCTACAAGCAGG - Intronic
1125826628 15:42682038-42682060 GAGTCCAGGCAGCCACAAGCAGG + Intronic
1130585899 15:85182073-85182095 AAGGCCACCATGCCAAAAGCGGG + Intergenic
1136293160 16:29287848-29287870 AAGCCCTCTGTGCCACCAGCAGG - Intergenic
1139373697 16:66483891-66483913 GAGCCCACACTGCCACCTGCCGG + Intronic
1141051362 16:80767733-80767755 ATGACTACTCTGCCACAAGCTGG - Intronic
1142037533 16:87870912-87870934 CAGCCCAGGCAGCCACAGGCGGG + Intergenic
1142099044 16:88261855-88261877 AAGCCCTCTGTGCCACCAGCAGG - Intergenic
1142172663 16:88630945-88630967 AGGCTCCCACTGCCACAAGCAGG - Intronic
1144888742 17:18481467-18481489 AATCACAGGCTGCCACAAACAGG + Intronic
1145143465 17:20462831-20462853 AATCACAGGCTGCCACAAACAGG - Intronic
1145206853 17:20989072-20989094 AACCCCACACTCCCACAGGCTGG - Intergenic
1146685854 17:34841178-34841200 AAGCCCTCTCTGCCACATACTGG + Intergenic
1147375061 17:40018352-40018374 AGCCCAAGGCTGCCACAAGCAGG - Intergenic
1151817971 17:76480876-76480898 AAGCCCACGCTGCCACAAGCCGG + Intronic
1152332396 17:79680749-79680771 AATCCCACCCTGCCCCAGGCAGG + Intergenic
1152516114 17:80825885-80825907 CAGCCCACCCTGCAACAACCAGG - Intronic
1152735062 17:81993133-81993155 AAGCCCAAGGTGCCACACCCAGG - Intronic
1153824509 18:8863392-8863414 ATGTCCACGCTGCCACACGTTGG + Intergenic
1157527825 18:48398431-48398453 AAGGACATGGTGCCACAAGCTGG + Intronic
1161085683 19:2333910-2333932 CAGGTCACGCTGCCACCAGCAGG - Intronic
925151579 2:1618820-1618842 AAGCCCAGGCTGCCAGCAGCAGG - Intergenic
925329351 2:3046674-3046696 AACCCCACGCTCCTCCAAGCAGG + Intergenic
926615641 2:14994462-14994484 TAGCCCACCCTGGCACATGCAGG - Intergenic
937100162 2:119262516-119262538 AAGCACATGCTGCCACAGCCTGG + Intronic
940174827 2:150866658-150866680 AAGCCCAGGCTGCCATAAGGAGG - Intergenic
941535801 2:166721524-166721546 AAGCCTATGCAGCAACAAGCAGG + Intergenic
946941959 2:224778599-224778621 TACCCCAAGCTGCCACAAGAGGG - Intronic
948976713 2:241467994-241468016 AAGCCCCCGCTGGCGCACGCTGG + Intronic
1169051154 20:2578973-2578995 GAGCCCAGGCTGCCAGAGGCAGG - Intronic
1176083494 20:63285375-63285397 CAGCCCACGCTGCCCCAGGTGGG - Intronic
1176197596 20:63844576-63844598 TAGCCCCCACTGCCACAGGCTGG + Intergenic
1178832765 21:36070280-36070302 GAGCCCGCGCTTCCACCAGCTGG + Exonic
1179526087 21:41976775-41976797 AAGCCCAGGCTGCTGGAAGCAGG - Intergenic
1179576358 21:42310728-42310750 CAGGCCACCCTGCCACCAGCTGG - Intergenic
1181532649 22:23525709-23525731 ATGCCAAGGCTGCCAGAAGCTGG - Intergenic
1183184999 22:36286653-36286675 AGCCCCACGCTGCCACCTGCTGG + Intronic
1184236099 22:43183806-43183828 ACGCCCTGTCTGCCACAAGCCGG + Intronic
1184903242 22:47460959-47460981 AAGGCCATGCAGCCACAAGGAGG - Intergenic
949909720 3:8892255-8892277 AAGACCACGCTTCAAGAAGCTGG + Intronic
950068802 3:10135740-10135762 AAGACCACGCAGCCACCAGAAGG - Intergenic
954061611 3:48072355-48072377 AGGCACACGCTGCCACACCCAGG - Intronic
965305787 3:167061261-167061283 TGGCCCACGGTTCCACAAGCTGG - Intergenic
965616894 3:170603167-170603189 AAGCCAAAGGGGCCACAAGCAGG - Intronic
966568351 3:181409090-181409112 GAGCCCACTCTGCTTCAAGCGGG + Intergenic
968509256 4:988129-988151 AAGCCCACCGTGCCCCATGCAGG - Exonic
968628904 4:1640239-1640261 AAAACCAGGCGGCCACAAGCTGG + Exonic
969701999 4:8772880-8772902 AAGCCCGAGCTGCAACCAGCTGG - Intergenic
971006027 4:22375023-22375045 AAGGCGATGGTGCCACAAGCTGG + Intronic
971297492 4:25410548-25410570 AAGCCCAGGATCACACAAGCTGG + Intronic
981748722 4:148073777-148073799 AGGGCCACCCTACCACAAGCGGG + Intergenic
985519783 5:368320-368342 AACCCCACGCGGCCACAGCCAGG - Intronic
1003270895 6:4606957-4606979 AAGCCCTCGCTGCCAGAAACAGG + Intergenic
1013480579 6:110549589-110549611 AAGTCCACGCTGCCACCACGGGG + Intergenic
1018838911 6:167505328-167505350 CAGCCCACACTCCCACCAGCAGG + Intergenic
1027187959 7:75982929-75982951 AAGCTGACGGTGCCACAGGCTGG - Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1032407585 7:131667875-131667897 AAGCGCACTCTGCCACAGGAGGG - Intergenic
1042460996 8:69068367-69068389 AAGCCCAGGCTGGTTCAAGCAGG + Intergenic
1047303857 8:123637523-123637545 CAGCCCACTCTGCCCCAGGCTGG - Intergenic
1049444570 8:142624108-142624130 CAGCCCAAGCTGCCAAAGGCCGG - Intergenic
1049450951 8:142661220-142661242 AAGGCCAGGCTGGCACAGGCAGG + Intronic
1058978736 9:110149399-110149421 TAGCCCACGCTGAGAAAAGCAGG - Intronic
1061247817 9:129410113-129410135 ACGCCAAGGCTGCCAGAAGCTGG + Intergenic
1061932774 9:133841842-133841864 AGACCCACGCTGGCACATGCAGG - Intronic
1061997345 9:134193260-134193282 AAGAACACGATGCCACTAGCAGG + Intergenic
1062389386 9:136327916-136327938 ACGCCCACGCGGGCACACGCCGG - Intronic
1190094466 X:47467521-47467543 AACCCCACTCTTCCCCAAGCTGG + Exonic
1190912666 X:54787154-54787176 AAGCCCCTGCTGCCACCTGCTGG + Intronic
1190918297 X:54826235-54826257 AAGCCCCTGCTGCCACCTGCTGG - Intergenic
1197728233 X:129790642-129790664 AAGACCACGGTGGCACAACCTGG - Intronic
1199600713 X:149539904-149539926 AAGCCCCCGCTCCCCTAAGCTGG + Intergenic