ID: 1151819468

View in Genome Browser
Species Human (GRCh38)
Location 17:76489896-76489918
Sequence TCCAGGGCCTGGAGGCTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 1, 2: 3, 3: 49, 4: 377}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151819456_1151819468 28 Left 1151819456 17:76489845-76489867 CCAAGCTCACATAGCCAGGAAAG 0: 1
1: 1
2: 6
3: 99
4: 750
Right 1151819468 17:76489896-76489918 TCCAGGGCCTGGAGGCTCCTAGG 0: 1
1: 1
2: 3
3: 49
4: 377
1151819460_1151819468 14 Left 1151819460 17:76489859-76489881 CCAGGAAAGGGTGTAGCTAGGAC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1151819468 17:76489896-76489918 TCCAGGGCCTGGAGGCTCCTAGG 0: 1
1: 1
2: 3
3: 49
4: 377
1151819464_1151819468 -10 Left 1151819464 17:76489883-76489905 CCCGATGTCTGGCTCCAGGGCCT 0: 1
1: 1
2: 4
3: 40
4: 326
Right 1151819468 17:76489896-76489918 TCCAGGGCCTGGAGGCTCCTAGG 0: 1
1: 1
2: 3
3: 49
4: 377
1151819455_1151819468 29 Left 1151819455 17:76489844-76489866 CCCAAGCTCACATAGCCAGGAAA 0: 1
1: 2
2: 34
3: 278
4: 1349
Right 1151819468 17:76489896-76489918 TCCAGGGCCTGGAGGCTCCTAGG 0: 1
1: 1
2: 3
3: 49
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151819468 Original CRISPR TCCAGGGCCTGGAGGCTCCT AGG Intronic
900091847 1:924149-924171 TCCAGGGCCTCGGGGCTCCCCGG - Intergenic
900105432 1:978963-978985 TGCAGGCCCTGGAGCCTCCCCGG - Exonic
900159148 1:1215332-1215354 TCCAGGGCCAGCGGGCTCCACGG - Intergenic
900339596 1:2181685-2181707 GCCAGGGGCTGGAGGACCCTGGG + Intronic
900352171 1:2240317-2240339 TCCTGGGCCTGGAGGAACGTGGG + Intronic
900514561 1:3075074-3075096 TCCACGGTCTGGAGGTGCCTGGG + Intronic
900552996 1:3265802-3265824 GGCAGGGTCTGGGGGCTCCTAGG - Intronic
900559576 1:3297174-3297196 TCCAGGTCCCGGCGTCTCCTTGG + Intronic
900654989 1:3752415-3752437 TCCAGGTCCTGTGGGCTCCTGGG - Exonic
901127714 1:6941066-6941088 TCCAGGCCATGTGGGCTCCTCGG - Intronic
902398910 1:16146823-16146845 TCCAGGGGCTGCAGGATCCATGG + Intronic
902546629 1:17194356-17194378 TCTGGGGCCTCGGGGCTCCTGGG + Intergenic
903403993 1:23081028-23081050 TCCTGGGCTTGGAGGGGCCTGGG + Intronic
903417531 1:23194107-23194129 TTGAGCGCCTGGAGGGTCCTGGG + Exonic
903522280 1:23959779-23959801 AGCAGGGCCGGGAGGCTCCGCGG - Intronic
904280080 1:29412990-29413012 TGCTGGGCCTGGAGCCTCCAAGG - Intergenic
904423366 1:30408254-30408276 TCCAGGCCCAGGGGGCTGCTTGG - Intergenic
905117565 1:35655447-35655469 CCCTAGGCCAGGAGGCTCCTGGG - Intergenic
905527482 1:38649949-38649971 TTCAGGGCATGGAGGTGCCTGGG - Intergenic
909957981 1:81801981-81802003 GCCAGCGCCGGGCGGCTCCTGGG - Intronic
910820251 1:91338059-91338081 CCCAGCCCCTGGTGGCTCCTGGG + Intronic
911038735 1:93575659-93575681 CCCAGCACCTGGAGTCTCCTGGG - Intronic
912956111 1:114154925-114154947 TGCAGCCCCTGGAGGCTGCTGGG + Intergenic
915016993 1:152743656-152743678 TCCTGGGCCTGGTGTCTCCCTGG - Intronic
915238308 1:154501941-154501963 TCCACGGCCCCGACGCTCCTGGG - Exonic
915348769 1:155211912-155211934 TTCACGGCCAGGAGGCTCCAAGG + Intronic
915356884 1:155260627-155260649 GGCAGGGGCTGGAGGCTCATAGG + Exonic
915520392 1:156439161-156439183 TCCGAGGCCTGGAGGCGCCTGGG + Intergenic
917853140 1:179082197-179082219 CCCACGGCCTGGAGGCGCCGCGG - Exonic
918345339 1:183602781-183602803 GCCTGGGTCTGGAGGCACCTTGG + Intergenic
920961993 1:210671657-210671679 TCCAGCTTCTGGTGGCTCCTAGG - Intronic
923052980 1:230401780-230401802 GCCAGGGCTTGGAGGCGCCCTGG + Intronic
923772506 1:236949767-236949789 TCCAGGAACTTGAGGCTGCTGGG + Intergenic
924024525 1:239818446-239818468 TCCACTCCCTGGAAGCTCCTTGG + Intronic
1063133026 10:3194904-3194926 TGGAGGCCCTGGTGGCTCCTGGG + Intergenic
1063211622 10:3886122-3886144 CCCAAGGTCTGGGGGCTCCTGGG + Intergenic
1064199687 10:13274063-13274085 GACAGGTCCTGGAGGCTCCTGGG + Intergenic
1064358274 10:14639566-14639588 TCCAGGGTCTGGTGGATCTTGGG - Intronic
1064426861 10:15237077-15237099 AAGAGGGCCTTGAGGCTCCTGGG + Intronic
1065513850 10:26505912-26505934 TGCAGGGACTGGAGGCCACTGGG - Intronic
1065923955 10:30418947-30418969 TCCAGTGCCTGGAGAAACCTGGG - Intergenic
1065974925 10:30833773-30833795 CCCAGGGCCTGGGGCCTTCTAGG + Intronic
1067508608 10:46876976-46876998 TGCAGTGCCTGAAGGGTCCTGGG + Intergenic
1067684659 10:48459149-48459171 CCCAGGCCCTGGATGCCCCTGGG - Intronic
1068717500 10:60204727-60204749 CCCAGAGGCTGAAGGCTCCTTGG - Intronic
1069663666 10:70140220-70140242 ACCAGGCCCTGGGGGCTCCAGGG - Intronic
1070776571 10:79113306-79113328 TCCTGGGCCTGCAGCCTCCATGG + Intronic
1071255361 10:83867502-83867524 TCCATGCCCTGGATGCTCCCAGG + Intergenic
1071465220 10:85933575-85933597 TTCAGGCCCTGGAGGCTGTTTGG + Intronic
1072578141 10:96718937-96718959 TCCAGGGGGAGGAGGCTCTTTGG - Intronic
1073320847 10:102615515-102615537 GCACGGGCCTGGTGGCTCCTTGG - Intronic
1073476366 10:103756512-103756534 CCCAGTGCCCAGAGGCTCCTGGG + Intronic
1074379849 10:112970413-112970435 TCCAGGGCCTGGGTGCTTTTTGG + Intronic
1075777063 10:124995969-124995991 TCCAGGGCCTGGAGGGCCTGTGG + Intronic
1076063273 10:127429675-127429697 TCCAGGGAATGGCAGCTCCTTGG - Intronic
1076507609 10:130988131-130988153 TCCAGGGCCGGGAGGGTGGTAGG - Intergenic
1076554423 10:131312177-131312199 TCCAGGGCGCGGAGGGTACTGGG + Intergenic
1076826522 10:132972289-132972311 TCCAGGACCTGGGGGATCCAGGG - Intergenic
1076828167 10:132980866-132980888 CCCAGCGAATGGAGGCTCCTCGG + Intergenic
1077014450 11:393541-393563 TCCAGGGTCTGCAGGCTTCGGGG + Intronic
1077028845 11:454283-454305 CCCAGGGCCAGGAGGGTGCTGGG + Intronic
1077184543 11:1230322-1230344 CTCAGGGCCTGGGGGCTCCTTGG - Intronic
1077212074 11:1375707-1375729 AGCAGGACCCGGAGGCTCCTCGG - Intergenic
1077432679 11:2523790-2523812 ACCTGGGCCTGGAGGCTGCAGGG + Intronic
1078142395 11:8701930-8701952 TGCAGGGCCTGGAGGTGCCAGGG - Intronic
1081490139 11:43561285-43561307 TCCTGGGCCAGGAGACCCCTGGG - Intronic
1082785132 11:57312651-57312673 TTCAGGGCCTGGAGGCTCGGGGG + Exonic
1083674208 11:64316456-64316478 TCCAGGGGCTGGAGTCTGCTTGG - Exonic
1084128751 11:67118409-67118431 CCCTGGGCCCGGGGGCTCCTCGG - Intergenic
1084608878 11:70188087-70188109 ACCAGGGCCCGGTGGGTCCTGGG + Exonic
1084797633 11:71519055-71519077 ACCCGGGCCTGCAGCCTCCTCGG + Intronic
1085011868 11:73146910-73146932 TGCAGGGCCAGGAGGGTCATAGG + Intergenic
1085121364 11:73969578-73969600 TGCAGGGCATGGAGGCTACAGGG - Intronic
1085320177 11:75569188-75569210 TCCAAGGCCTGCAGGCCCCTAGG - Intronic
1085787998 11:79471867-79471889 CCCTGTGCCTGGAGGCTCCCTGG + Intergenic
1088848576 11:113687780-113687802 TCCATGGCTGAGAGGCTCCTGGG - Exonic
1088920525 11:114257294-114257316 TCTAGGGGCTGGAGGCCCCCAGG - Intergenic
1089273281 11:117315918-117315940 GCCAGGGCCTGCAGGGCCCTGGG + Exonic
1089331589 11:117692707-117692729 AGCAGGGCCTGGATGCCCCTTGG - Intronic
1089689733 11:120179814-120179836 TCAAGTGCCTTGAAGCTCCTTGG - Intronic
1090256174 11:125286198-125286220 GCCAGGGCATGGAGGCTCACAGG + Intronic
1090669973 11:128939251-128939273 TCCAGGGCCTGTGGTCTCCTGGG - Intronic
1090870246 11:130738175-130738197 TTCAAGGCCTAGAGGCTTCTGGG - Intergenic
1093690339 12:22102387-22102409 TCCAGAGCCTGGAGACACCAAGG + Intronic
1096413024 12:51391028-51391050 TCCAGAGCCTGGGGGCTTTTGGG - Intronic
1096633514 12:52944642-52944664 TTCAGCGCCTGGAGGTTTCTGGG + Intronic
1096781883 12:53996486-53996508 CCCAGGGACTGGAGGCCACTGGG - Intronic
1099024282 12:77446116-77446138 TCCATGTCCTAGAGTCTCCTTGG + Intergenic
1100539979 12:95548669-95548691 CCCGGGGCCGGGAGGCACCTGGG - Intronic
1101864235 12:108508288-108508310 GCCAGGGTCTGGGGGCTGCTGGG - Intergenic
1101890819 12:108713568-108713590 GCCCGAGCCTGGAGGCTTCTTGG - Intronic
1102010944 12:109617997-109618019 TCCTGGGCCTGGAGGGGTCTGGG + Intergenic
1103940591 12:124499399-124499421 TCCAGGGCCTGGACCCCGCTGGG - Intronic
1103940595 12:124499409-124499431 TCCAGGCCCTGGAGGGTCTCAGG + Intronic
1104471435 12:129032960-129032982 TCCTGGGGCTGGTGGCTGCTGGG - Intergenic
1104607864 12:130203099-130203121 TCCAGAGCCTGGGAGCTCTTGGG + Intergenic
1104744085 12:131200040-131200062 TCCTGGGGCTGGAGTCTCCAAGG - Intergenic
1105344218 13:19559500-19559522 TCCAGGGGCTGGAGCCTGCTTGG + Intergenic
1105535815 13:21262074-21262096 TCCAGGGGCTGGAGCCTGCTTGG - Intergenic
1105593435 13:21814696-21814718 TCCAGGGCTTGGAGTTTCCTAGG + Intergenic
1105811891 13:24002632-24002654 ACCAGTTCCTGGAGTCTCCTTGG + Intronic
1106023730 13:25938630-25938652 GCTTGGGCCTAGAGGCTCCTGGG - Intronic
1106434188 13:29709195-29709217 GCCAGGGGCTGGGGGTTCCTGGG - Intergenic
1106556696 13:30815720-30815742 TAAAGGGAATGGAGGCTCCTTGG - Intergenic
1106687854 13:32080667-32080689 TCAAGGGGTTGGAGGCTCCAAGG - Intronic
1112585016 13:100711422-100711444 TCCAGGTCCTACAGGCTCCTGGG + Intergenic
1112988006 13:105476246-105476268 TCCAGTGCCTGGATGTTCCCAGG - Intronic
1113067195 13:106384537-106384559 TCTAAGGCCTGGCCGCTCCTTGG + Intergenic
1113463004 13:110495035-110495057 TCCCGGGCCTCTAGGCTCCTGGG - Intronic
1113677385 13:112216013-112216035 TCCAGGGCCTGCAGGCCCTTCGG + Intergenic
1113766881 13:112887518-112887540 TGAAGGGCCTGGAGGAGCCTGGG - Intergenic
1113766885 13:112887528-112887550 TCCAGGCCCTTCAGCCTCCTGGG + Intergenic
1113961361 13:114128041-114128063 TGCAGGGCCTGGCTGCACCTGGG - Intronic
1114617525 14:24076182-24076204 TGCAGGGACTGGCTGCTCCTCGG - Exonic
1115472464 14:33782606-33782628 TCCAGAGCCTTGAGCCTCCCTGG - Intronic
1115518898 14:34213204-34213226 CGAAGGGCCTGGAGACTCCTTGG - Intronic
1116668961 14:47816991-47817013 CCCAGGGCCTGATGGCTCCACGG - Intergenic
1116786601 14:49295048-49295070 TCCAAGCCTTGGAGGCTCCCAGG - Intergenic
1117246863 14:53895342-53895364 TCCAGGGGCTGGAGGCTGCAGGG - Intergenic
1117305327 14:54468386-54468408 TTCTGGGCCTCGAGGCTCTTTGG - Intergenic
1117656759 14:57963434-57963456 CCCTGGGGCTGGAGGCTCATTGG + Intronic
1118445141 14:65843786-65843808 TCCAGGCCCACGATGCTCCTGGG + Intergenic
1118755947 14:68843763-68843785 TCCCGGGCCTGTGGGCTTCTGGG - Intergenic
1119932369 14:78560518-78560540 TCCAAGGCCTGGATGCTCACTGG + Intronic
1121449750 14:93999541-93999563 AACATGGCCTGGAGGCTCCCAGG - Intergenic
1121661872 14:95641113-95641135 TCCAGGGGCAAGAGGCTCATTGG + Intergenic
1121969982 14:98347092-98347114 TCCAGAGCCTGTAGGCAGCTTGG + Intergenic
1122097386 14:99381659-99381681 TCCTAGGGCTGGTGGCTCCTGGG - Intergenic
1122288614 14:100667612-100667634 TGCAGGGCCGGGAGTCTCCCTGG + Intergenic
1122586039 14:102807266-102807288 TCCTGGGCAGGCAGGCTCCTGGG - Intronic
1122802193 14:104237010-104237032 TCCAGGGTCAGCAGGGTCCTGGG + Intergenic
1122900406 14:104779980-104780002 CCCAGGACTTGGAGGCTCCAGGG + Intronic
1122971124 14:105152640-105152662 GCCAGGGCCGGGAGGCACCAGGG + Intronic
1124244205 15:28056069-28056091 CCCAGGGCCACGAGGCTCCAGGG - Intronic
1124891993 15:33742082-33742104 TCCAGGGTCTCTTGGCTCCTGGG - Intronic
1125920825 15:43524672-43524694 TCCTGGGCCTGGGGGCTCCTGGG - Exonic
1127998809 15:64171899-64171921 CCCAGGGCCTGAGGACTCCTGGG + Exonic
1128611095 15:69074252-69074274 TCCCGCGCCTGGAGACTCCCGGG - Intergenic
1129659199 15:77543516-77543538 TCCAGTGGCCGGAGGCCCCTGGG + Intergenic
1129723825 15:77891698-77891720 CCCAGGCCCAGCAGGCTCCTGGG - Intergenic
1130149018 15:81297256-81297278 TCCAGGGTGGGGAGCCTCCTGGG + Intronic
1131259495 15:90881174-90881196 TCCTGGGGCTGGAGGATCCTGGG + Intronic
1132314336 15:100879544-100879566 TCCGGGGCCCGGCGGCTCCTCGG + Exonic
1132616757 16:844867-844889 ACCAGGACGTGGAGGCTCCGGGG - Intergenic
1132680527 16:1139236-1139258 TCCAGGAGGTGGAGGCTGCTGGG + Intergenic
1132954573 16:2584866-2584888 GCAAGGGCCTCGAGGCTCCCAGG - Intronic
1133465902 16:6026746-6026768 CCCAGGGCCTTGAGACTCCAAGG - Intronic
1133907697 16:10037018-10037040 TCCACGGCATGGATCCTCCTGGG - Intronic
1133972776 16:10579541-10579563 GCCAGGGCCTGGGGGTACCTGGG - Intronic
1134188826 16:12105730-12105752 TGCTGGGCCTGAAGGCTTCTGGG - Intronic
1134234679 16:12455926-12455948 TCCAGGAACTGAGGGCTCCTAGG + Intronic
1134365536 16:13574269-13574291 TCCACAGACTTGAGGCTCCTCGG + Intergenic
1134634658 16:15783263-15783285 TCCAGGGCCTGGAGGCCTCGGGG - Intronic
1136288728 16:29259123-29259145 TCCAGGTCCAGGAGGCTGCCCGG - Intergenic
1136468092 16:30459053-30459075 TCCAGGGACTGGAGGCAGCCAGG + Intergenic
1136547706 16:30965043-30965065 ACCAGGTTCTGGAGGCTCCGGGG - Exonic
1136639634 16:31552714-31552736 TCCAGAGCCTGGAGGGGGCTGGG - Intergenic
1136666834 16:31819679-31819701 GCCTGGGCCTGGCTGCTCCTGGG + Intergenic
1136783617 16:32922246-32922268 GCCAGGGCTTGCAGGCTGCTGGG + Intergenic
1138079126 16:54072093-54072115 CCCAGGGCCAGGAGGCTGCTGGG + Intronic
1138558834 16:57788157-57788179 CCCAGGGTCTGGAGGCTCCTAGG - Intronic
1138672807 16:58629420-58629442 TCCCGGGCCTGGAGGCTCAGGGG - Intronic
1139374960 16:66491173-66491195 CACAGGGCCAGGTGGCTCCTGGG + Intronic
1139608538 16:68038099-68038121 TCCAGGGCCAGCAGCCTCATTGG - Exonic
1140228472 16:73097737-73097759 TCCAGGGGCTGGAGGGGCCACGG - Intergenic
1140978638 16:80084825-80084847 TCCAAGGCCTCCAGGCTCCAGGG + Intergenic
1141086111 16:81096503-81096525 TCCAGGGCCTGGCGCGACCTCGG + Intergenic
1141361405 16:83398320-83398342 TCCAGCTCCTGGTGGCTCCAGGG + Intronic
1141438685 16:84015394-84015416 TCCAGGGCCTGGAGGCAGGAGGG + Intronic
1141644352 16:85359259-85359281 TCCTGGGCCTGGCGGCTCACGGG + Intronic
1141648044 16:85377906-85377928 CGCAGGGCCTGGCCGCTCCTTGG + Intergenic
1141944020 16:87297565-87297587 TCCAGGCCTTGGTGGCTTCTCGG - Intronic
1142309176 16:89302202-89302224 CCCTGGGCCGGGAGGCTGCTGGG - Intronic
1142539633 17:648066-648088 TCCTAGGCTTGGAGGCTCCCTGG - Intronic
1142995012 17:3755051-3755073 GGCGGGGCCTGGAGGCTCCCTGG - Intronic
1143090727 17:4447928-4447950 TCCAGGGAGTGGAGACTCTTTGG - Intronic
1143362382 17:6382586-6382608 AGCAGGGCCTGGTGGCTTCTGGG - Intergenic
1143627480 17:8118798-8118820 CCCTGGGCCTGCAGGATCCTGGG + Exonic
1143781220 17:9230660-9230682 TCCAGGCCCAGGAGGCTCTGGGG + Intronic
1144573601 17:16415798-16415820 GCCAGGGCGTGGCGGCTGCTGGG - Exonic
1145251316 17:21298330-21298352 GCCAGGGCCTGATGGCTCATGGG + Intronic
1145251759 17:21300662-21300684 AGCAGGGCCTGGAGGCAGCTGGG + Intronic
1145738081 17:27247551-27247573 CCCAGGGCCTGGTGCATCCTGGG + Intergenic
1145798938 17:27671410-27671432 CCCAGGTCCTGGACCCTCCTGGG - Intergenic
1146658175 17:34647627-34647649 TGCAGGGCCTGTAAGCTCCCTGG - Intergenic
1147211048 17:38872586-38872608 GCCAGTGCCTGGAGGATGCTGGG + Intronic
1147265336 17:39231289-39231311 TCCAGGGGCTGGAGGCAGCAGGG - Intergenic
1147449618 17:40496044-40496066 CCCAGGGACTGGGGGCTCCCAGG - Exonic
1147543352 17:41379516-41379538 TCCAGGGCCCTGGGGCACCTCGG + Intronic
1147907318 17:43831807-43831829 GCCAGGGCCTGGAGGCTGCCAGG + Intronic
1147925270 17:43941946-43941968 TCCAGGGCCTCATGGCTCCCAGG + Intronic
1147935541 17:44008608-44008630 TCCAGGGCCTGTAGTGTCCATGG - Exonic
1148667404 17:49384886-49384908 TATGGGGCCTGGAGGCTGCTGGG - Intronic
1148683350 17:49487005-49487027 AGCAGGGCCTGGAGGCTGGTGGG - Intergenic
1148740019 17:49887492-49887514 TCCAGGGCCAGCAGGGTCCAAGG + Intergenic
1149850434 17:60030599-60030621 GCCAGGGCCTGCAGGTGCCTGGG - Intergenic
1149859732 17:60115925-60115947 GCCAGGGCCTGCAGGTGCCTGGG + Intergenic
1150575824 17:66430235-66430257 CCCAGAGCCTAGAGGCTCCAGGG - Intronic
1150622899 17:66821818-66821840 CCCAGGGCATGGATGCTCTTGGG + Intergenic
1151401154 17:73856985-73857007 TCAAGGGCCCGGAGGTTCCTGGG - Intergenic
1151448100 17:74180521-74180543 TCCTGGGCCTGGGGGCTGATGGG - Intergenic
1151555047 17:74842580-74842602 TCCGGGGCCTGGGGGCCTCTGGG - Exonic
1151682081 17:75627585-75627607 GCCAGGGCCAGGAGGCACTTGGG - Intronic
1151819468 17:76489896-76489918 TCCAGGGCCTGGAGGCTCCTAGG + Intronic
1151999625 17:77637273-77637295 TCCAGGGCATGGGGTCTCCCTGG + Intergenic
1152122305 17:78426346-78426368 AGCATGGCCAGGAGGCTCCTGGG - Intronic
1152265194 17:79290075-79290097 TTCAGGCACTGGAAGCTCCTTGG + Intronic
1152495601 17:80669137-80669159 GCCAGGGGCTGGGGGCTTCTGGG + Intronic
1152590451 17:81208995-81209017 CACAGGGCCTGGGGGCTCCCAGG - Exonic
1152668053 17:81582941-81582963 GCCCTGGCCGGGAGGCTCCTTGG - Intronic
1152772509 17:82178992-82179014 ACCAGGGCCTGGGGCCTTCTCGG - Intronic
1152824818 17:82458332-82458354 CACGGGGCCTGGAGGCCCCTGGG - Intronic
1159770826 18:72543753-72543775 CCCAGGGGTTGGAGGCACCTGGG - Intronic
1159909485 18:74131800-74131822 TCAACGGCCTGGAGGCTGCAAGG + Intronic
1160182493 18:76647719-76647741 TCCAGAGCCTGGAGGCTGGAAGG + Intergenic
1160798737 19:957353-957375 ACCAGAGCCTGGGGGCTGCTGGG - Intronic
1160836681 19:1127809-1127831 TCCAGTGCGTGGAGGGGCCTTGG - Intronic
1160892594 19:1387202-1387224 TCCAGGCCCTGGCTGCTGCTCGG - Intronic
1161295281 19:3516595-3516617 TCCCGGGCCTGGGGCCTCCCGGG - Intronic
1161636952 19:5395086-5395108 TCCAGGGACCGGCGGCTCCTGGG - Intergenic
1161712990 19:5860295-5860317 GCCAGGGACTGGAGTCTCCCAGG + Intergenic
1161964596 19:7541133-7541155 TCCAGCGCCTGCTGGCTGCTGGG - Intronic
1162069894 19:8147352-8147374 TCCAGGACCTGCAGCCTCCAAGG + Exonic
1162096402 19:8312323-8312345 TCCATTTCCTTGAGGCTCCTGGG - Intronic
1163321511 19:16577447-16577469 TTCAGGTCATGGATGCTCCTGGG + Exonic
1164649754 19:29883134-29883156 TCCAGGCCCTCCTGGCTCCTGGG - Intergenic
1164760227 19:30722978-30723000 CCCAGGGCCTGGAGGGTGGTGGG + Intergenic
1165579615 19:36850799-36850821 CCCTGGGCCTAGAGGCTTCTGGG - Intronic
1166127623 19:40725218-40725240 TCCAGGGCCAGGGGCTTCCTGGG - Intronic
1166781465 19:45345633-45345655 TCCAGGGGCTGGAGGCGCTGCGG + Exonic
1167234221 19:48303902-48303924 TCAAGGGCCTGGCCGCCCCTGGG - Intronic
1167439446 19:49499963-49499985 ACCAGGGCCTGGAGGACCCAGGG - Intergenic
1167781411 19:51601417-51601439 TCAAGCGCCTGGAGGCGCCGCGG + Intergenic
1168080814 19:54008874-54008896 TCGAGGGCCTGCAGGCTGCCAGG - Intronic
1168264762 19:55216724-55216746 GCCAGGGCCGGGAGCCTCCTGGG + Intergenic
1168470469 19:56636616-56636638 TCCAGGTTCTGGAGGCTCAGAGG + Intergenic
925069118 2:951879-951901 TCCTGGGACTGGGAGCTCCTGGG - Intronic
926814009 2:16782420-16782442 CCAAGGGCCTAGAGGCTCCTGGG - Intergenic
927191980 2:20523318-20523340 TCCAGAGGCTGAAGGCACCTGGG - Intergenic
927790105 2:26002986-26003008 TTCATGGCCTGGAGACTCTTTGG + Intergenic
930107602 2:47652362-47652384 TCCAGGGCCTGAAAGCTCTGTGG - Intergenic
931690575 2:64831668-64831690 TCTGGGGCCAGGAGACTCCTGGG - Intergenic
932437817 2:71713126-71713148 TCCAGAGCCTCCAGGTTCCTGGG - Intergenic
936028542 2:109053121-109053143 TCCAGTACCTGGAGGATACTGGG - Intergenic
937239037 2:120448437-120448459 TCCAGTGCTTGGAGGCCTCTCGG + Intergenic
937244474 2:120483696-120483718 TCCAGAAGCTGGAGGCTCCTGGG + Intergenic
937252747 2:120534675-120534697 TGCTGGTCCTGGTGGCTCCTAGG - Intergenic
938029862 2:127982857-127982879 TCAATGGACTGGAGGCTGCTGGG + Intronic
938124622 2:128663047-128663069 CTGAGGGCCTGGAGGCTCCTTGG - Intergenic
938251133 2:129816743-129816765 TCCAGGGCCTGGAGGCTGCTGGG - Intergenic
938316420 2:130332378-130332400 CCCAGGGCCTGGTGGCTCACGGG - Intergenic
940408803 2:153336132-153336154 TGCAGGGGCGGGATGCTCCTGGG + Intergenic
946421695 2:219568636-219568658 TCTAGGGCCTGGAGGACCCCAGG - Intronic
947353833 2:229272164-229272186 TCGCAGGCCTGGAGGCTCCCCGG + Intergenic
948311171 2:236987906-236987928 TAAAGGGTCTGGAGGATCCTGGG + Intergenic
948454768 2:238099863-238099885 CCTCGGCCCTGGAGGCTCCTAGG - Intergenic
948645290 2:239400612-239400634 TCCAAGGCCTGCAGGCTGCGCGG + Exonic
948837956 2:240635455-240635477 TCCTGGGCATGAAGTCTCCTGGG - Intergenic
948838005 2:240635648-240635670 TCCTGGGCATGGACCCTCCTTGG - Intergenic
948838055 2:240635838-240635860 TCCAGGGCATGGACCCTTCTGGG - Intergenic
948854373 2:240723313-240723335 CCCAGGGCCTGGTGCCTACTGGG - Intronic
949019598 2:241734037-241734059 TCCCAGGCCGGGAGGCTCCTCGG + Intergenic
1169112553 20:3043413-3043435 TCCTGGGCCTGAAGGCTCCTGGG + Intergenic
1169336499 20:4761164-4761186 GCCAGGGCCAGGAGGCGCCGCGG - Intergenic
1169496848 20:6123363-6123385 TCCTGGGCCTGGACGCACCCCGG - Exonic
1170706889 20:18751907-18751929 TCTAGGGCTGTGAGGCTCCTAGG - Intronic
1170888462 20:20359875-20359897 TCCAGGGCCTGGAGGATGGGAGG + Intronic
1171392373 20:24809804-24809826 ACCAGGGCCTGAAGGCAGCTTGG - Intergenic
1172009165 20:31836433-31836455 TCCAGGGCCTGGATCCAGCTGGG + Intergenic
1172479004 20:35260100-35260122 TCCATGGGCAGGAGGCTGCTAGG - Intronic
1172482670 20:35280184-35280206 GCCAAGGCCTGGATGCTTCTGGG - Intronic
1174137088 20:48387128-48387150 TCCAGGGCATGGTGGCTGGTGGG - Intergenic
1174407009 20:50309144-50309166 TCCAGAGCCTGAAGGTTCCCTGG - Intergenic
1174420694 20:50397245-50397267 ACCAGGTCCTGGTGGCCCCTTGG + Intergenic
1174509493 20:51040392-51040414 TCCAGCTCCTGGGGGCTCCTGGG + Intergenic
1174674586 20:52341168-52341190 TCCAGGGCCTGCAGGCTGCAGGG + Intergenic
1175599419 20:60260665-60260687 TCCAGTGCCGGCAGGCTCCTGGG + Intergenic
1175887352 20:62299871-62299893 TCCACGTGCTGCAGGCTCCTCGG - Intergenic
1176049631 20:63111084-63111106 TCCTGAGTCTGGAGGCTCCCAGG + Intergenic
1176150380 20:63587883-63587905 TCCAGGTCCTGCTGGCTCCTCGG - Exonic
1176287390 21:5025367-5025389 TCCAGAGGCTGGTGGCTCTTAGG - Intronic
1176457937 21:6929217-6929239 TCCAGGGCCTCCTGGCTCCAGGG + Intergenic
1176836109 21:13794301-13794323 TCCAGGGCCTCCTGGCTCCAGGG + Intergenic
1178473421 21:32915963-32915985 TCCTGGGTCTGGAGGCTGCTGGG - Intergenic
1178482403 21:32990888-32990910 TCCAGGGCTTGGAGCCTGCAGGG + Intergenic
1179643679 21:42762568-42762590 TCCAGGGCCTGTCCCCTCCTTGG - Intronic
1179869791 21:44238108-44238130 TCCAGAGGCTGGTGGCTCTTAGG + Intronic
1181448035 22:22993636-22993658 TCCAGGGGCTGGAGGAACCTGGG + Intergenic
1182096932 22:27632326-27632348 TCCTGGGCCTGGGGACTCCAAGG - Intergenic
1182725505 22:32442075-32442097 CCCAGGGACTGGGGACTCCTGGG + Intronic
1183060882 22:35335715-35335737 TCTAGGGCCTGCAGTCTCATGGG + Intronic
1183362505 22:37389990-37390012 CCCAGGGCCCGTGGGCTCCTTGG - Intronic
1183479850 22:38057510-38057532 CCCAGGGCCTGGAGACCCGTGGG + Intronic
1184004427 22:41697926-41697948 CCCAGGGCCAGGAGGCACCTGGG + Exonic
1184413589 22:44339477-44339499 GCCCTCGCCTGGAGGCTCCTGGG - Intergenic
1184428817 22:44429050-44429072 TCCAGCTGCTGGTGGCTCCTTGG - Intergenic
1184648476 22:45908730-45908752 TCAAGGCTCTGGAGCCTCCTGGG - Intergenic
1185098991 22:48827585-48827607 TCCATGGCCTGCAGGCTCGCAGG - Intronic
1185161847 22:49234692-49234714 TCCAAGGCCTGGAGCATCCTAGG - Intergenic
1185165504 22:49260010-49260032 GGCTGGGCCTGGAGGCTTCTCGG - Intergenic
1185280670 22:49968605-49968627 CTCAGGGCCTGGAGGCTCTGTGG - Intergenic
949980815 3:9500773-9500795 CCCAGGGCAGGGAGGCTCCCCGG + Exonic
950266502 3:11577094-11577116 TCCATGGCCCTGGGGCTCCTGGG + Intronic
950893830 3:16430184-16430206 CCCACGAGCTGGAGGCTCCTGGG - Intronic
951094045 3:18607913-18607935 TGCTTGGCCTGGAGCCTCCTGGG - Intergenic
952978379 3:38715334-38715356 ACTAGGGCCTGGAGACTACTTGG - Intronic
953206844 3:40838551-40838573 TCCTGGGCCTTGAGGCTCTTTGG + Intergenic
954154954 3:48680282-48680304 TCCAGGCCTTGGAGGCTCCCTGG - Intronic
954193869 3:48984450-48984472 TCCAAGGCCACGAGACTCCTTGG + Exonic
954454122 3:50587846-50587868 TCCAGGGTCTGGAGGTGGCTGGG + Intergenic
954638742 3:52085556-52085578 GCCAGGGCAAGGAGGCTCCTAGG - Intronic
954662494 3:52233539-52233561 TCGGGGGCCTGGACCCTCCTGGG + Intronic
954707828 3:52490433-52490455 GCCAGGGCCTGGTGACTGCTTGG + Intronic
954713111 3:52514604-52514626 TCCAGGGCCGGGGGGCTCCCTGG - Intronic
961420178 3:126796911-126796933 TACAGGGCCAGGAGGCCCTTAGG + Intronic
961627848 3:128275976-128275998 CACAGGGTCTCGAGGCTCCTGGG + Intronic
962317485 3:134367786-134367808 ACCTGGGCCTGCAGGATCCTGGG + Exonic
962395234 3:135009576-135009598 TCCAGGGCCTGGGGGCCCTCAGG - Intronic
967297499 3:187979536-187979558 TCCAGAGCATGAAGGCTCCAAGG - Intergenic
968454473 4:689916-689938 AACAGGGCCTGGAGCCTCTTGGG - Intergenic
968519461 4:1029085-1029107 TCCTGGGCCTGGAGCCCCCATGG - Intergenic
968600002 4:1504273-1504295 GCTGGGACCTGGAGGCTCCTGGG + Intergenic
968910081 4:3473088-3473110 CCCAGGCCCTGGAGCCCCCTGGG - Intronic
968953717 4:3707708-3707730 TCCAGGTCCTGCAGCCTCCGGGG - Intergenic
969054076 4:4390774-4390796 TCCAGGGCTGGGAGGCTTCTTGG + Intronic
969114981 4:4865812-4865834 TCCAGGACCTCCTGGCTCCTTGG + Intergenic
969183801 4:5460981-5461003 GGCAGGAGCTGGAGGCTCCTGGG + Intronic
969431101 4:7154744-7154766 TCCAGGGCTTGGGGGGTCTTTGG + Intergenic
969540797 4:7787776-7787798 CCCAGGGCCTCGGGGCTCCGAGG + Intronic
971392298 4:26197579-26197601 TCCTGGGCCTGCAGCCTCCCAGG + Intronic
971753490 4:30679624-30679646 GCCATGGACTGGGGGCTCCTAGG + Intergenic
972322261 4:37982934-37982956 GCTAAGGCCTGGAGGCCCCTTGG + Intronic
975949074 4:79746297-79746319 TCCAGAGCTAGGAGGCTGCTGGG - Intergenic
981748574 4:148073025-148073047 TCCAGGTCCTGCAGGCACCAGGG - Intergenic
985591394 5:767185-767207 TCCAGGGTGTGGAGGACCCTGGG + Intergenic
985632138 5:1019261-1019283 TCCAAGGCCTGGAGGCTGCAGGG - Intronic
985646731 5:1088507-1088529 AACAGGACCTGGAGGCTCCCGGG + Intronic
985671493 5:1209129-1209151 TCCAGTGTCTGGACCCTCCTGGG - Intronic
985899987 5:2780689-2780711 TGCAGGGCCTGGAGCCCCTTTGG - Intergenic
985971446 5:3381457-3381479 TCCTGGGCATGGAGGCTGCAGGG + Intergenic
985975801 5:3418304-3418326 TCCAGCTCCTGGTGGTTCCTTGG - Intergenic
986155115 5:5166495-5166517 GCCAGGGGGTGCAGGCTCCTGGG + Intronic
986735134 5:10662702-10662724 CCCATGGCCTGGAGGCCCATGGG + Intergenic
992186836 5:74252292-74252314 TCCAGGGCCTGCAGGTGCCCTGG - Intergenic
993386499 5:87268385-87268407 GCCCGGGCCTGGTGGCCCCTGGG + Exonic
995682264 5:114733018-114733040 TCCAGGGCCAGGAAGCTTATGGG - Intergenic
1000026547 5:157363707-157363729 TCAAAGGCCTGGGGGCTACTGGG + Intronic
1003015274 6:2462807-2462829 CGCAGGGCCTGGGGCCTCCTTGG + Intergenic
1004183925 6:13405939-13405961 TCCAGGGCCAGGAGGAGCCTGGG + Intronic
1004881927 6:20017265-20017287 TCCTGGGCCTGAAGGAGCCTGGG - Intergenic
1006122851 6:31817604-31817626 TCCCGGGCCTGGGGGCTTCGGGG + Exonic
1006124712 6:31829798-31829820 TCCCGGGCCTGGCGGCTTCGGGG + Exonic
1006162763 6:32047807-32047829 TCCAGGGCCTGGAGCCCAGTAGG - Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1007242795 6:40439205-40439227 TCTAGGGGCGGGCGGCTCCTCGG - Intronic
1007266076 6:40596957-40596979 TCCAGGGTCTGGACTCTCTTGGG + Intergenic
1007433485 6:41790384-41790406 TCCAGGGTTTGGGGGCTCTTTGG + Exonic
1007704369 6:43781823-43781845 TCCAGGGCCTGGGGGCTGACCGG + Intronic
1007722806 6:43895368-43895390 TCCAAGACCAGGAGGCGCCTGGG + Intergenic
1007965166 6:45997901-45997923 TCCTGGGCCTGCTGGGTCCTGGG - Intronic
1008370439 6:50724628-50724650 TCCAGGGACCCGCGGCTCCTTGG + Intronic
1010295706 6:74194009-74194031 TCCAGAGCCTGGAGACTGCATGG + Intergenic
1014246832 6:119078562-119078584 GCCAGCTCTTGGAGGCTCCTCGG + Exonic
1018033976 6:159866427-159866449 TCCAGGCTCTGGAAGCTTCTGGG - Intergenic
1018387732 6:163320150-163320172 TCCAGGGCCCGGAAGGACCTTGG + Intergenic
1019335529 7:480876-480898 TTCAGGGCCTGGAGGGGACTGGG - Intergenic
1019625292 7:2012799-2012821 CCCTGGGCCTGGGGCCTCCTGGG + Intronic
1020439953 7:8206658-8206680 TCCAGGGCCTGGAAGCAAGTTGG - Intronic
1020445369 7:8262109-8262131 ACCGCGGCCGGGAGGCTCCTGGG - Exonic
1021055562 7:16042504-16042526 CCCAGGGATTGGAGACTCCTGGG + Intergenic
1021605738 7:22407356-22407378 TCCAAGGCATTGAGACTCCTTGG + Intergenic
1023729471 7:43176836-43176858 TCTAGGGACTGGGGGCCCCTAGG + Intronic
1027173372 7:75888301-75888323 ACCAGGGGCTGCAGGCTCCAAGG + Exonic
1027270498 7:76516012-76516034 TCCAGGTGATGGAGGCTCCTGGG - Intronic
1028636359 7:92993911-92993933 ACCAGGACCTGGAAGCTCCAAGG - Intergenic
1028894721 7:96028345-96028367 TTCAGGGCCTGGCGGCTCACAGG - Intronic
1029592786 7:101518358-101518380 ACCACAGCCTGGAGGCTCCAAGG + Intronic
1032193651 7:129778186-129778208 CCCAGGGGCTAGAGGCTGCTGGG + Intergenic
1032775532 7:135109281-135109303 TCTAGGGCCTGGAGGCAGCACGG + Intronic
1034589756 7:152129144-152129166 TCCAGGGCCTGGTGGGGCCCAGG + Intergenic
1035677669 8:1466823-1466845 TCCCTGGCCTGGTAGCTCCTAGG - Intergenic
1037604164 8:20423309-20423331 TCCATCTTCTGGAGGCTCCTAGG + Intergenic
1039593588 8:38770764-38770786 TCCAGCGCCAGGAGTCTCTTCGG + Intronic
1039869925 8:41537378-41537400 TTCAGGTCCTGGACCCTCCTGGG - Intronic
1040453549 8:47573458-47573480 TGCAGGGCCTGAGGGCTGCTGGG - Intronic
1040484310 8:47855637-47855659 TCCTAGGCATGGAGGCTCCAGGG - Intronic
1041882444 8:62767174-62767196 TCCAGAGCCTGGAGGATAGTGGG - Intronic
1044182978 8:89218526-89218548 CACATGGCCTGGAGGGTCCTAGG + Intergenic
1044377060 8:91487665-91487687 TCCAGGGGCAGGAGACTTCTAGG + Intergenic
1045648302 8:104320616-104320638 TCCCTGGGCTGGTGGCTCCTTGG + Intergenic
1046002028 8:108432816-108432838 ACGGGGTCCTGGAGGCTCCTCGG - Intronic
1048372894 8:133795153-133795175 ACCACTGCCTGGATGCTCCTTGG + Intergenic
1048555549 8:135472398-135472420 TCTAGGGCCTGGAGTCTAGTAGG - Intronic
1049192423 8:141295729-141295751 TCCAGAGGCTGGAAGCACCTGGG + Intronic
1049309622 8:141926697-141926719 CCCAGGGGCTGGAGGCTGGTGGG + Intergenic
1049403725 8:142442504-142442526 GCCAGGGCCAGGAGGAACCTGGG + Intergenic
1049428676 8:142549337-142549359 TGCAGGGCCTGGAGAGGCCTCGG + Intergenic
1049428706 8:142549413-142549435 TGCAGGGCCTGGAGAGGCCTGGG + Intergenic
1049428716 8:142549449-142549471 TGCAGGGCCTGGAGGGCCCCTGG + Intergenic
1049744043 8:144255632-144255654 TCCTGGGCCTGCAGGTTCCGGGG - Exonic
1051261921 9:15272911-15272933 CCCAGGGCCTGCTGCCTCCTGGG + Intronic
1051262733 9:15280643-15280665 CCAAGGGCCAGGAGGCTGCTTGG - Intronic
1051603054 9:18893246-18893268 TCCAGGCCCTCGAGGCTTATTGG + Intronic
1052392122 9:27892646-27892668 GCAAGGGCATGGAGGATCCTGGG - Intergenic
1056476745 9:86960017-86960039 TCCAGGACCTAGAAGGTCCTAGG - Intergenic
1056577117 9:87864143-87864165 TCCAGGGCCGGGAAGAGCCTGGG + Intergenic
1057307573 9:93921074-93921096 TCCATGGCCTGGAGGCACATGGG + Intergenic
1057913064 9:99035108-99035130 TCCAGGGCCTGGGGGCCCAGGGG - Exonic
1058670523 9:107357269-107357291 TCCAGTGACTTGAGGCTGCTTGG - Intergenic
1058793254 9:108472037-108472059 TCCAGAGCCAGGAGGCTACATGG - Intergenic
1058895352 9:109396190-109396212 TCCAGGCCCTGTGGGCTGCTTGG + Intronic
1059468364 9:114484059-114484081 TCCAGAGCCTGGGGGCTCTGAGG + Intronic
1059779238 9:117508647-117508669 TCCAGGGGTTCAAGGCTCCTGGG + Intergenic
1060151758 9:121293282-121293304 CCCAGGGCCTGAAGGGTTCTTGG + Intronic
1060212398 9:121718518-121718540 ACCAGGGCCTGGTGGCTCAGGGG - Intronic
1061242607 9:129383285-129383307 TGCAGGGCCTGGGCGCTCCCGGG + Intergenic
1061242664 9:129383481-129383503 TCCAGGGCGTGAAGGATCGTGGG + Intergenic
1061262340 9:129487252-129487274 TTGTGGGCCTGGAGGCTCCTAGG + Intergenic
1061285539 9:129620408-129620430 TCCGGGGACTGGAGGATCCCGGG - Exonic
1061296923 9:129681866-129681888 TCCAGGTTCTGGAGGCTTCTGGG + Intronic
1061515944 9:131090546-131090568 TCCAGGGCCTCGGGGATCCCAGG + Intronic
1061597867 9:131643977-131643999 TCAAGGGCCTGGAAGCTCCCAGG + Intronic
1061856667 9:133445338-133445360 TCCAGGGGCTGGAGGCTGACTGG + Intronic
1062017400 9:134297716-134297738 TCCAGGGCCTTCAGCCTCCCAGG + Intergenic
1062173165 9:135146547-135146569 TCCAGCTCCTGGTGGTTCCTTGG + Intergenic
1062361377 9:136189982-136190004 TCTAGGGCCCTGAGACTCCTAGG - Intergenic
1062381893 9:136290721-136290743 CCCAGGTCCCGGGGGCTCCTGGG - Exonic
1062459637 9:136657507-136657529 ACCAGGGCATGGAGGGTCTTCGG - Intergenic
1189794468 X:44634026-44634048 CCCAAGGCCTGGTGGCTTCTTGG + Intergenic
1195917772 X:109952585-109952607 ACCTGGGTCTGGATGCTCCTGGG - Intergenic
1196782864 X:119399213-119399235 GCGAGGGCCTGGAGGGTCCGGGG - Exonic