ID: 1151820345

View in Genome Browser
Species Human (GRCh38)
Location 17:76493586-76493608
Sequence CAGAGTTAGCAGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 2, 2: 2, 3: 63, 4: 520}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151820345 Original CRISPR CAGAGTTAGCAGAGGGGAGA GGG Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900168368 1:1254152-1254174 CAGACGCAGAAGAGGGGAGACGG + Intronic
900625204 1:3604810-3604832 CAGAGTGAGAATAGGGGAGGGGG + Intronic
900803970 1:4755415-4755437 CAGAGCCAGCAGGAGGGAGACGG - Intronic
900950025 1:5853334-5853356 AGGAGTCAGCAGAGGGGAGGTGG + Intergenic
901286101 1:8080088-8080110 AAGAGTAAGAAGAGGGGAGCCGG + Intergenic
901882824 1:12204108-12204130 CAGAAGGGGCAGAGGGGAGAGGG - Intronic
902689985 1:18105037-18105059 CACAGTTAGCAGAGGGCACAGGG - Intergenic
903015630 1:20359924-20359946 CAGAGTTACCAGTGGGGCGAGGG - Intergenic
903330042 1:22592659-22592681 CGGGGTGAGCAGAGGGGAGGAGG + Intronic
904212980 1:28897918-28897940 CAGAGTGAGCCCAGGGGAGCAGG + Intronic
904369858 1:30041676-30041698 CTGAGTTGGGAAAGGGGAGAAGG + Intergenic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905203510 1:36329636-36329658 CAGCGTTTGAACAGGGGAGACGG + Intergenic
905319851 1:37108119-37108141 AAGAGGTGGGAGAGGGGAGAGGG + Intergenic
906284416 1:44577335-44577357 GAGAGGTGGCAGTGGGGAGAGGG - Intronic
906284427 1:44577371-44577393 GAGAGGTGGCAGTGGGGAGAAGG - Intronic
906658312 1:47564770-47564792 CAGAGGAAGTAAAGGGGAGAAGG + Intergenic
906661530 1:47586305-47586327 CAGAGTTGGAAGAGGGGCAATGG - Intergenic
907330076 1:53664978-53665000 CAGAGTGAGCAATGGGGCGAGGG + Intronic
907379416 1:54073519-54073541 AAAAGTTAGCAGAGGCTAGAAGG - Intronic
907583679 1:55594996-55595018 CTGAGGCAGCAGAGGAGAGAGGG + Intergenic
908451627 1:64261741-64261763 CAGAGATTGCAGAGGGGAGTAGG - Intronic
909647568 1:77934621-77934643 CAGAGTCCGAAGAGGGAAGAAGG - Intronic
910558831 1:88567466-88567488 CGGAGGTTGCAGAGAGGAGATGG + Intergenic
910625658 1:89303597-89303619 CAGTGCTAGCAGGTGGGAGATGG + Intergenic
912823472 1:112885540-112885562 CAGCACTGGCAGAGGGGAGAAGG + Intergenic
913237953 1:116801057-116801079 CAGAGGGAGCAGAGGTGAAATGG + Intergenic
913682621 1:121200992-121201014 CAGAAGTAGAAGAGGGGAGTAGG - Intronic
913697015 1:121336455-121336477 AAGAGAAGGCAGAGGGGAGAAGG - Intronic
914034464 1:143988621-143988643 CAGAAGTAGAAGAGGGGAGTAGG - Intergenic
914140544 1:144943589-144943611 AAGAGAAGGCAGAGGGGAGAAGG + Intronic
914154988 1:145079349-145079371 CAGAAGTAGAAGAGGGGAGTAGG + Intronic
914431963 1:147626709-147626731 CAGCGTTAGCAGAGGTGATGGGG - Intergenic
914675875 1:149906884-149906906 CAGTCATAGCAGATGGGAGAGGG + Intronic
914923057 1:151860465-151860487 CAGAGTTCTCAGAGGAGAAAGGG - Intergenic
914988793 1:152480817-152480839 CAGAGCAAGCAGAGTGGAGGTGG - Intergenic
918003995 1:180524820-180524842 CAGAGTGAGCAAGTGGGAGAGGG + Intergenic
918125384 1:181579257-181579279 CCCAGTTAACAGAGGGGAGAAGG - Intronic
918423094 1:184383991-184384013 CAAATTTAGAAGAGGTGAGAGGG - Intergenic
919350841 1:196451930-196451952 CAAACCTAGGAGAGGGGAGAAGG - Intronic
919820791 1:201470595-201470617 CAAAGTTAGGAGATGAGAGAAGG + Intergenic
920469933 1:206219510-206219532 CAGAAGTAGAAGAGGGGAGTAGG - Intronic
920484346 1:206354792-206354814 AAGAGAAGGCAGAGGGGAGAAGG - Intronic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922979907 1:229816877-229816899 CAGAGTGGGAAGAGGAGAGAAGG - Intergenic
923015323 1:230121835-230121857 CACAGCTAGAAGAGGGGAGGAGG + Intronic
923133412 1:231096766-231096788 CAGAGGTGGCTGAGGGGACAGGG + Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923226698 1:231944421-231944443 CCGAGTTAGCACAAGGGACAAGG - Intronic
923483283 1:234404750-234404772 GAGAGTTAGCTGTGGGGAGATGG - Intronic
923679011 1:236104102-236104124 GAGAGGGAGCAGATGGGAGACGG - Intergenic
923760008 1:236833554-236833576 CAGAGATAGCAGAGTGGTTAAGG - Intronic
924067159 1:240235823-240235845 CAGAGGAAGAAGAGGGGAGATGG - Intronic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
1065167089 10:22990989-22991011 CAGAGGAAGCAGAGAGGAGGAGG - Intronic
1065282959 10:24158825-24158847 CAGAGTTAGCAGAGTGCTGCTGG + Intronic
1065446258 10:25804707-25804729 CAGAATTGGCAAAGAGGAGAGGG - Intergenic
1065722754 10:28642447-28642469 CAGAGAGGGGAGAGGGGAGAAGG - Intergenic
1066522342 10:36236050-36236072 CAGAGTTAGCACTGGAGAAACGG - Intergenic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1069948267 10:72002053-72002075 CAGAGCCAGAAGCGGGGAGAGGG - Intronic
1069959106 10:72069163-72069185 CAGAGCTGGCAGAGAGGAGGAGG - Intronic
1070355968 10:75640636-75640658 CAGAGGCTGCAGATGGGAGAGGG - Intronic
1070450850 10:76555510-76555532 CAGAGTTGGCAATGGAGAGAGGG - Intronic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071450754 10:85789993-85790015 CAGAGTCAGGAAAAGGGAGAGGG - Intronic
1071718232 10:88118211-88118233 CAAACTTAGCAGAGCAGAGAGGG + Intergenic
1072305903 10:94106982-94107004 CCAAGGAAGCAGAGGGGAGAGGG - Intronic
1073184752 10:101609130-101609152 CACAGCTAGAAGAGGGTAGAGGG + Intronic
1073444998 10:103575286-103575308 GAGAGACAGCAGCGGGGAGAAGG - Intronic
1074964086 10:118473445-118473467 GAGAGGGAGCAGAGGGGAGGAGG - Intergenic
1075348144 10:121699394-121699416 CAGATCTGGCAGAGGGCAGAGGG + Intergenic
1076128029 10:127991739-127991761 CAGAGTCATCAGAGTGGACAGGG - Intronic
1076369353 10:129941633-129941655 CAGAGGTGGCAGTGAGGAGATGG + Intronic
1076445205 10:130509579-130509601 CAGAGCTGGGAGAGGGCAGAGGG + Intergenic
1076570957 10:131432538-131432560 GAGAGTGCACAGAGGGGAGAGGG + Intergenic
1077158955 11:1103978-1104000 ATGAGCTGGCAGAGGGGAGATGG - Intergenic
1077464607 11:2727711-2727733 CAGAGTGAGCTGAATGGAGAAGG + Intronic
1078120791 11:8506893-8506915 CAGAGTAAGCAGGGGAGAAAGGG - Intronic
1078758350 11:14232541-14232563 CAGAGTTGCCAGAGTGGGGAGGG - Intronic
1080308018 11:30857839-30857861 CAGAACTATCAGAAGGGAGAAGG + Intronic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1081634830 11:44714158-44714180 CAGAATAAGCAGATGGGAGAAGG + Intergenic
1082050726 11:47768338-47768360 CAGAGGCAGGAGACGGGAGAGGG - Intergenic
1083043904 11:59714837-59714859 CAGAGGGAGGAGAAGGGAGATGG - Intronic
1083058005 11:59841791-59841813 GAGAGTTGGCAGAGGAGAAAAGG + Intronic
1083167562 11:60900506-60900528 CAGAGACAGCAGCGGGGTGAGGG + Intronic
1084472283 11:69370007-69370029 CAGAATAGGCAGAGAGGAGAAGG + Intergenic
1085065077 11:73487886-73487908 CAGGGTTAGGAGAGAGGTGAGGG - Intronic
1085065097 11:73488016-73488038 CAGTGTTGGCAGAGAGTAGACGG - Intronic
1086018851 11:82200875-82200897 TAGACTTAGCAGAGGGCATAAGG + Intergenic
1086347463 11:85911746-85911768 GAGAGTTAGCACAGAGGAGGAGG + Intronic
1087083331 11:94193167-94193189 CACAGCAAGCTGAGGGGAGATGG + Intergenic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1089201996 11:116730147-116730169 CAGAGGTAGCAGCGGGCAAAAGG + Intergenic
1089403650 11:118180217-118180239 CAGAGTTGCCAGAAGGCAGAAGG + Intergenic
1089881160 11:121775109-121775131 CAGAGTAAGCAAAGCGGAGCTGG + Intergenic
1090160406 11:124487387-124487409 CACAGTTAGAAAACGGGAGAAGG + Intergenic
1090963170 11:131574840-131574862 CAGAGGTAACAGTGGGGAGTGGG - Intronic
1090974599 11:131670853-131670875 CAGAGGGAGCAGAGGGGAAGGGG - Intronic
1091267262 11:134281359-134281381 CATAGCTAGAAGAGGTGAGAGGG - Exonic
1091364309 11:135004983-135005005 TAGTGACAGCAGAGGGGAGAAGG - Intergenic
1091593259 12:1857937-1857959 GAGAGGCAGCTGAGGGGAGAAGG + Intronic
1093215603 12:16358126-16358148 AAGAGATGGCAGTGGGGAGAGGG - Intronic
1093372407 12:18380309-18380331 CAGAGTCAACAGAGGTGAGGAGG - Intronic
1095783916 12:46089721-46089743 CAGGGCTAGCAGTGGGGAAATGG - Intergenic
1095785319 12:46102634-46102656 CAGAGCTAACAGTGGGGAAATGG - Intergenic
1095833549 12:46613063-46613085 CAGGGTTAGTAGAGGGAACATGG - Intergenic
1096023985 12:48345543-48345565 CTAAGTTAGTAGAGGAGAGAGGG + Intronic
1096215586 12:49796093-49796115 CAGAGTTAGCTGTGGGTAGGTGG + Exonic
1097761759 12:63474283-63474305 CAGAGATTCCAGAGGGGGGAGGG - Intergenic
1098856725 12:75661165-75661187 AAGTGATAGAAGAGGGGAGAAGG - Intergenic
1099718256 12:86326007-86326029 CATAGTTAGCAGAGTCAAGATGG - Intronic
1100144470 12:91660518-91660540 CAGAGGTAGATGAGGGGAGGGGG + Intergenic
1100190115 12:92181252-92181274 TAGAGTTTGCAGAGGGAACATGG + Intergenic
1100281194 12:93119977-93119999 CAGAGAGAACTGAGGGGAGATGG - Intergenic
1100752701 12:97716716-97716738 CAAAGGGAGCAGAGGAGAGAAGG - Intergenic
1101116512 12:101537235-101537257 CAGAGTTAACCGGGTGGAGAGGG + Intergenic
1102108030 12:110342557-110342579 CTGAGTTGGAAGAGGGGAGTGGG + Intronic
1102224470 12:111218051-111218073 CAGAGTTTGCAATGGGGACAGGG - Intronic
1102518430 12:113465103-113465125 CAGGGTTTGGAGAGGGAAGAGGG - Intronic
1102547569 12:113667661-113667683 CAGAGAGAAAAGAGGGGAGATGG - Intergenic
1102591199 12:113958103-113958125 CAGAGGTAGCAAATGGTAGATGG + Intronic
1102780746 12:115562424-115562446 CACAAATAGCAGAGGGAAGAGGG - Intergenic
1103846866 12:123907959-123907981 CACAGACAGCAGAGGAGAGAAGG - Intronic
1104579189 12:129997297-129997319 CAGAGGTAGCAGAGGAAGGAAGG + Intergenic
1105033083 12:132898383-132898405 GAGGGTCAGCAAAGGGGAGATGG - Intronic
1105638907 13:22242379-22242401 CAAAATTAGCTGAGGGGAAAAGG - Intergenic
1105826692 13:24129472-24129494 TGGAGTTAGAGGAGGGGAGAGGG + Intronic
1106129281 13:26926176-26926198 AAGAGTCAGCAAAGAGGAGAAGG + Intergenic
1106548083 13:30747612-30747634 CACAGGTTGCAGAGAGGAGAAGG + Intronic
1107445260 13:40465068-40465090 CAGGGCTAGCACAGGGCAGAGGG - Intergenic
1107668868 13:42722212-42722234 AAGAGTTAGCAGAGGGAACTCGG + Intergenic
1108607459 13:52053842-52053864 CAGCGCTAGCAGTGGGGAGATGG - Intronic
1108886599 13:55192859-55192881 TAAAGTGAGCAGAGTGGAGAGGG - Intergenic
1110306000 13:73987603-73987625 CAGACGTGGGAGAGGGGAGAGGG + Intronic
1110323751 13:74189517-74189539 CACAGTTAGCAGAGGGAACAAGG - Intergenic
1111092981 13:83471910-83471932 TAGAGTAAGCAGAGGGCAGAAGG - Intergenic
1113025569 13:105937551-105937573 CAGAGTTAGCAAAGAAGAGAGGG + Intergenic
1113481264 13:110623488-110623510 CACAGTCAGCAGAGGCCAGATGG - Intronic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1113940773 13:114017623-114017645 CAGAGGCCGCAGAGGGGAGAGGG - Intronic
1114208294 14:20593959-20593981 CAGAGTCAGTAGTGGGGAGAGGG - Intronic
1115653033 14:35416948-35416970 CAGAGTCAGGAGTGGGAAGAAGG + Intergenic
1116032662 14:39591361-39591383 TAGAGTTGGCAGAGGAGAGCAGG + Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116940348 14:50784945-50784967 GAGAGTAGGCAGAGGGGAGAAGG + Intronic
1117029699 14:51655360-51655382 GAGAGTTAGGAGAGGGGAATGGG + Intronic
1117366958 14:55038621-55038643 CAGACACAGCAGAGGGTAGAGGG - Intronic
1118284415 14:64458426-64458448 CAGACTTCCCTGAGGGGAGAGGG + Intronic
1118410384 14:65471176-65471198 CACAGTTGGTAGAGGGCAGAGGG - Intronic
1118692163 14:68350698-68350720 CTGATTTAGTGGAGGGGAGATGG + Intronic
1118960499 14:70525666-70525688 CTGGGATAGAAGAGGGGAGATGG - Intronic
1119052571 14:71384393-71384415 TTGAGTTGGCAGAAGGGAGAGGG + Intronic
1119382239 14:74236673-74236695 CTGAGTTAGCATAGAGGACAAGG - Intergenic
1119529576 14:75350337-75350359 CAGAGTTAGAAGATGGCAGGAGG + Intergenic
1119787269 14:77322876-77322898 TAGGGGTGGCAGAGGGGAGAGGG + Intronic
1120388359 14:83874009-83874031 CAGAAGGAGCAGACGGGAGAAGG + Intergenic
1120917290 14:89721250-89721272 CAGCTTAAGGAGAGGGGAGAGGG - Intergenic
1121421357 14:93817997-93818019 CAGAGTTACCAGCAGAGAGAGGG - Intergenic
1121575261 14:94979843-94979865 CAGAGCAAGCAGAGTGCAGATGG + Intergenic
1121744873 14:96280107-96280129 CACAGCCAGAAGAGGGGAGAGGG + Intergenic
1121827825 14:97025296-97025318 CAGGGTTTGAAGAGGGAAGATGG - Intergenic
1122029360 14:98901341-98901363 CAGACATAGAAGAGGGAAGAGGG + Intergenic
1122328205 14:100895323-100895345 CAGGGTTTGCTTAGGGGAGATGG + Intergenic
1122474578 14:101998161-101998183 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1122474597 14:101998255-101998277 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1122474615 14:101998349-101998371 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1122672411 14:103382871-103382893 CAGAGTTAGCTGTGGGAGGATGG - Intergenic
1122695251 14:103549273-103549295 CAGAGACAGCAGAAGGGAGAGGG + Intergenic
1123960473 15:25393926-25393948 TAGAGTTAGCTGATGGGAGAAGG - Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126183593 15:45809794-45809816 CAGATGTAGCAGAAGGTAGAAGG + Intergenic
1126330158 15:47523089-47523111 CACTGTTAGCAGATGGAAGATGG - Intronic
1127681963 15:61306183-61306205 CAAAGGTAGCTGAGGGGAGATGG + Intergenic
1128110530 15:65073197-65073219 CACAGACAGCGGAGGGGAGATGG + Intronic
1129000019 15:72325026-72325048 GAGAGAGAGGAGAGGGGAGATGG - Intronic
1129454096 15:75667347-75667369 CAGAACTTGCAGGGGGGAGAGGG - Intergenic
1129488572 15:75902127-75902149 AAGAGTTAGCTGAGGGGCGGGGG + Intergenic
1129561397 15:76574576-76574598 CAGAATTAGGAAGGGGGAGAAGG + Intronic
1130162213 15:81413439-81413461 CAGCATAAGCTGAGGGGAGATGG - Intergenic
1130964334 15:88685941-88685963 CAGAGGCAGCAGAGTGGAGATGG + Intergenic
1133119834 16:3599216-3599238 CTGAGATGGCAGAGGGCAGAGGG - Intronic
1133717027 16:8459595-8459617 CAGAGTTTCCAAGGGGGAGATGG - Intergenic
1134195188 16:12154370-12154392 CAGGGGTGTCAGAGGGGAGAGGG - Intronic
1134572482 16:15303208-15303230 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1134729902 16:16452832-16452854 CAGGGTAGGCAGATGGGAGAGGG + Intergenic
1134937530 16:18259064-18259086 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1135522596 16:23188962-23188984 CAGAGTGAGCTGGGTGGAGAAGG + Intronic
1135739278 16:24959619-24959641 CAGAGGTGGCAGAGGCAAGAAGG + Intronic
1136247979 16:28986006-28986028 CTGAGCTGGGAGAGGGGAGATGG + Intronic
1136316574 16:29458002-29458024 CAGAATTAGAAGAGGTGAGTGGG + Exonic
1136431150 16:30197344-30197366 CAGAATTAGAAGAGGTGAGTGGG + Exonic
1137935369 16:52630153-52630175 GAGAGTGAACAGAGGGGAGGAGG + Intergenic
1138233335 16:55357498-55357520 GAGAGTTGGCAGAAGGCAGAAGG + Intergenic
1138329753 16:56204217-56204239 AAGAGATAGCAGAGAGGATATGG + Intronic
1138413916 16:56860351-56860373 CAGAGGAAGGAGAGGGGAGAGGG - Intergenic
1138589692 16:57993137-57993159 CGGAGATACCAGAGGGGAGCAGG + Intergenic
1138768416 16:59632040-59632062 CAGAGGGAGAAGTGGGGAGAGGG + Intergenic
1138988823 16:62365199-62365221 TGGGGTTAGTAGAGGGGAGAAGG - Intergenic
1139365464 16:66429677-66429699 CAGAGGAAGAAGAGGAGAGAGGG - Intronic
1139467904 16:67164063-67164085 CAGAGTCCGCAGAGGGGTGGAGG - Exonic
1139680126 16:68554911-68554933 TAGAGTAGGCAGTGGGGAGAAGG + Intronic
1140670383 16:77271910-77271932 CGGACATTGCAGAGGGGAGATGG + Intronic
1140996441 16:80264291-80264313 CAGAGTTAGAAGAGGAGGAAAGG - Intergenic
1141074936 16:80996306-80996328 CAGAGACAGAAAAGGGGAGAGGG - Intronic
1141175771 16:81718078-81718100 CTGAGTCACCAGAGGGGAAAAGG + Intergenic
1141254294 16:82386421-82386443 CAGAGCCACCAGTGGGGAGAGGG - Intergenic
1141368705 16:83467670-83467692 CACAGACAGCAGAGGGCAGAAGG - Intronic
1141705504 16:85662321-85662343 GAGAGTGTGCAGAGGGGAGCAGG + Intronic
1141939774 16:87267252-87267274 CAGAGTTTGCAGAATGGACACGG - Intronic
1142198026 16:88747809-88747831 CAGGGTTACCGCAGGGGAGAGGG + Intronic
1142280963 16:89147315-89147337 CAGAGTGAGCAAGGGGGGGAGGG + Intronic
1142313090 16:89325436-89325458 GAGAGAGAGGAGAGGGGAGAGGG - Intronic
1142354137 16:89594183-89594205 CACAGTTGGCAGAGGGGGGTGGG + Intronic
1142358821 16:89616680-89616702 CGGAGTGTGCTGAGGGGAGAAGG - Intronic
1142615947 17:1135181-1135203 CAGAGTGAGCAGAGGGGGAGAGG + Intronic
1142666785 17:1467902-1467924 CAGAGATTCCTGAGGGGAGAGGG + Exonic
1143065588 17:4244688-4244710 CTGAGGAAGCAAAGGGGAGATGG - Intronic
1143774105 17:9186485-9186507 CAGAGTTAGGAGAGAGGACCCGG - Intronic
1144746726 17:17620905-17620927 GAGAGAGAGGAGAGGGGAGAGGG + Intergenic
1144851794 17:18247533-18247555 CAGAGTCAGCAAAGAGGAGGTGG + Intronic
1145866875 17:28247418-28247440 AGGAGCTAGCAGAGGGGAGGTGG - Intergenic
1146135377 17:30316041-30316063 CAGAGGTTGCAGAGCTGAGATGG - Intergenic
1146874793 17:36400512-36400534 CAAAGTTTCCACAGGGGAGAGGG - Intronic
1147064594 17:37912367-37912389 CAAAGTTTCCACAGGGGAGAGGG + Intergenic
1147759578 17:42788649-42788671 CAAAGTCAGCAGAGGGGAGAAGG - Intronic
1148020198 17:44548274-44548296 CAGAGTGAGAAGATGGGAGGGGG + Intergenic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148769723 17:50059950-50059972 CTGAGTCACCAGTGGGGAGAGGG + Intronic
1150309282 17:64114546-64114568 CAGAGAAGGCAGAGGGGATATGG + Intronic
1150402758 17:64872411-64872433 CAGAGGGAGCAGAATGGAGATGG + Intronic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1151138135 17:71967159-71967181 CAGAGGGAGCAGAGGAGAGTGGG + Intergenic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152014262 17:77739450-77739472 CAAAGTCCGGAGAGGGGAGAGGG + Intergenic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1153711269 18:7802089-7802111 CAGAGAAGGGAGAGGGGAGAAGG - Intronic
1153910928 18:9706414-9706436 CAGAACTAGGGGAGGGGAGAAGG + Intergenic
1154157991 18:11959024-11959046 GAGAGAGAGGAGAGGGGAGAGGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156675664 18:39524712-39524734 CTGAGTAAGGGGAGGGGAGAAGG - Intergenic
1156786258 18:40918991-40919013 CAGAATTAAGATAGGGGAGATGG + Intergenic
1157172283 18:45418885-45418907 CAGTGTCAGAGGAGGGGAGAGGG + Intronic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157689475 18:49669223-49669245 CTGAATTAGCAGTGGTGAGAAGG + Intergenic
1157836815 18:50911500-50911522 GAGAGTTAACAGAGGGAAGTAGG + Intronic
1158219956 18:55140304-55140326 GAGAGAGAGGAGAGGGGAGAGGG + Intergenic
1158299469 18:56035288-56035310 CACACTGAGCAGAGGGGTGAAGG - Intergenic
1159189648 18:65025200-65025222 CATAGTTAGGAGAAGGGAGAAGG - Intergenic
1159868009 18:73728815-73728837 CAGCTTTGGCAGAGGGGAGAGGG + Intergenic
1160894172 19:1395034-1395056 CACACTTAGCAGTGGGGAGCAGG - Intronic
1160965277 19:1744634-1744656 GGGAGGAAGCAGAGGGGAGATGG - Intergenic
1161636223 19:5390905-5390927 CAGAGTGAGTAATGGGGAGATGG - Intergenic
1163415553 19:17184396-17184418 TCTAGTTAGCAGATGGGAGAGGG + Intronic
1163458708 19:17423879-17423901 CAGAGTTGGGAGAGGGAAGTAGG - Intronic
1163536469 19:17879632-17879654 CAGAGTTAGCAGAGGGTACGGGG + Intronic
1164562249 19:29300305-29300327 CAGTGTAAGCAGAGGGGTGGAGG - Intergenic
1165072495 19:33263669-33263691 AAGAGATTGGAGAGGGGAGAGGG + Intergenic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1165787270 19:38469235-38469257 CAGAGGGAGCCGAGGGGAGGAGG - Intronic
1166388575 19:42396348-42396370 TAGAGATACCAAAGGGGAGATGG - Intergenic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
1167190129 19:47981655-47981677 CAGAGTAAACTGAGGGCAGATGG - Intronic
1167698185 19:51026985-51027007 CAGAGAGAGAAGAGTGGAGATGG - Intronic
1167767506 19:51493440-51493462 TATAGTCAGCAGAGGGGAGAGGG - Intronic
1167780601 19:51596365-51596387 CAGAATGAGAAGAGGGGTGATGG + Intergenic
1167794055 19:51697657-51697679 CAGAGGGAGCAGCAGGGAGATGG + Intergenic
925076060 2:1016680-1016702 CATATTTAGCAGGTGGGAGATGG + Intronic
925157525 2:1658832-1658854 CAGAGGGAGCCGCGGGGAGATGG - Intronic
925280628 2:2682175-2682197 CAGAGGTAGGAGACGCGAGAGGG + Intergenic
925404714 2:3598637-3598659 CCGCGTGAGCACAGGGGAGAAGG + Intronic
925631560 2:5899062-5899084 CTAGGTTAGCAGATGGGAGAAGG - Intergenic
925725479 2:6866459-6866481 GAGAGTCAGCAAAAGGGAGAGGG - Intronic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
927255375 2:21036533-21036555 CCCAGTTAACAGAGAGGAGAGGG + Intronic
927599725 2:24430397-24430419 GAGAGAGAGGAGAGGGGAGAAGG - Intergenic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929826998 2:45316665-45316687 CAGAGTTATCTGAGGGGACTGGG - Intergenic
929915376 2:46131323-46131345 GAGAGTCAGCAGAGGTGATAAGG - Intronic
930422659 2:51174089-51174111 CAGAGTTTGAGGTGGGGAGAAGG - Intergenic
930552464 2:52852673-52852695 CAGAGTTCCCGGAGGGGAGGGGG - Intergenic
931476206 2:62590237-62590259 CAGAGGGAGCTGAGGGGTGAAGG + Intergenic
931735388 2:65189096-65189118 CAGAGGTGGCAGAGTAGAGAGGG + Intergenic
931869307 2:66441811-66441833 CAGAGGTAGCAAAGAAGAGAAGG - Intronic
932016588 2:68034314-68034336 CAGAGGTGGGAGTGGGGAGAGGG + Intergenic
932437893 2:71713637-71713659 TAGAGTAAGCAGAGAGGAGAAGG + Intergenic
932476722 2:72011139-72011161 CAGAGACAGCGGTGGGGAGATGG + Intergenic
933129021 2:78649770-78649792 CAGATTCAGAAGAGAGGAGAAGG - Intergenic
933172055 2:79135580-79135602 CAAATTTAGCAGAGGAGAGATGG + Intergenic
933260107 2:80122995-80123017 CAGAGACAGCAGAAGTGAGACGG - Intronic
933466316 2:82657291-82657313 CAGAGCTAGCAGTGGGGAAATGG + Intergenic
933986080 2:87593403-87593425 CAGAATTTGCAGAGGTCAGAGGG + Intergenic
935918533 2:107985431-107985453 CAGTGTAAGAAAAGGGGAGATGG + Intergenic
936307757 2:111357400-111357422 CAGAATTTGCAGAGGTCAGAGGG - Intergenic
937039217 2:118807998-118808020 CAGAGTGGGCAGGAGGGAGAGGG + Intergenic
937043847 2:118840528-118840550 CAGAGTTAGAAGCAGTGAGATGG - Intergenic
937183279 2:120014767-120014789 CAGAGCAAACAGAGGGGAGTAGG + Intronic
937629591 2:124085544-124085566 CAAAGGTAGCAGAAGGAAGAGGG - Intronic
937678096 2:124613941-124613963 CAGGGCTATCAGATGGGAGACGG + Intronic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
939251336 2:139684858-139684880 CTGAGTTAGAAGAGGGGAGGGGG - Intergenic
940225891 2:151400777-151400799 CAGAGGTTGCAGAGCTGAGATGG - Intergenic
941789916 2:169540736-169540758 CAGAGTTGGCAGCGGAGAGTAGG + Intronic
943072770 2:183161165-183161187 CAGAGTTAGCAGAGTGCTGCTGG + Exonic
944108408 2:196104244-196104266 GTGAGTAAGAAGAGGGGAGAAGG + Intergenic
944496662 2:200314007-200314029 CAGAATGAGCAGAGGGCTGAGGG - Intronic
944553903 2:200869364-200869386 CAGAGCTAGCAGTGGGGAAATGG - Intergenic
944938011 2:204589889-204589911 CCCAGTGAGCAGATGGGAGATGG + Intronic
945005020 2:205395857-205395879 CAGAGTTAGTGGAGGAGAAACGG - Intronic
945916435 2:215709342-215709364 CAGAGTAAGCAGTAGAGAGAAGG - Intergenic
946010513 2:216560188-216560210 CAGAGGGAGGAGAGGGGAGGGGG - Intronic
946191152 2:218008699-218008721 CAGAGGTAGCACCTGGGAGAAGG + Intergenic
946341400 2:219071581-219071603 CAGAGTTAGAATTGGGGAGTAGG - Intergenic
946615294 2:221502434-221502456 CAGAAACAGCAGTGGGGAGAAGG + Intronic
946662867 2:222019743-222019765 AAGAATTATCAGAGCGGAGAAGG + Intergenic
946907406 2:224430047-224430069 CTCAGTTGGTAGAGGGGAGATGG + Intergenic
947034685 2:225838608-225838630 CAAAGCTAGCAAAGGGGAGGTGG - Intergenic
947106056 2:226668894-226668916 CAGAGATAGCAGTGTGCAGAAGG + Intergenic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
1168884883 20:1242167-1242189 CATAATTTTCAGAGGGGAGAAGG + Intronic
1170370935 20:15647416-15647438 TAGAGTTAGCAAAGGGCTGAAGG + Intronic
1170381509 20:15764900-15764922 TAGAGTGAGCAGAGAGCAGAAGG - Intronic
1170655414 20:18282548-18282570 CAGATATAGCTGAGGGGAGATGG + Intergenic
1171066208 20:22017972-22017994 CAGAGGGAGGAGAGGGGATATGG + Intergenic
1171173515 20:23035159-23035181 CAGAGTCGGCAGCGGGGAGGGGG + Intergenic
1172152287 20:32798902-32798924 CTGAGTTAGCAGAGCTGAGAGGG + Intronic
1172718698 20:36983115-36983137 AAGAGAGAGCAGAGGAGAGAAGG - Intergenic
1173414603 20:42844679-42844701 GTGAGTCAGGAGAGGGGAGAGGG - Intronic
1173553672 20:43950483-43950505 CAGAGCAAGCAGTGGGGAGGGGG - Intronic
1173838737 20:46142453-46142475 CAGAGTGAGCAAGGGAGAGAGGG - Intergenic
1174271042 20:49368769-49368791 CAGAGTGGGCAGGAGGGAGAAGG - Exonic
1175539060 20:59736845-59736867 CAGGGAAGGCAGAGGGGAGAGGG + Intronic
1175728774 20:61337857-61337879 CAGAATTACCAGAGGAAAGAAGG - Intronic
1177168175 21:17626428-17626450 CAGAATTAGAAGGGGGTAGATGG + Intergenic
1177498624 21:21920853-21920875 CAGAGTGTGCAGAGAAGAGAGGG + Intergenic
1179537540 21:42062114-42062136 CAGCCTTAGCAGGGCGGAGAGGG - Intergenic
1179572681 21:42287147-42287169 CAGAGGCAGGAGAGGGCAGAGGG + Intronic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1179952244 21:44715021-44715043 CAGAGTTAGCAGACCTGGGATGG - Intergenic
1179987026 21:44927723-44927745 CAGGGCTGGCAGAGGGGAGGAGG + Intronic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1181284024 22:21739344-21739366 CAGAGTTAGCAGAGGGGAGGAGG - Intergenic
1181472993 22:23152283-23152305 CACAGTCCCCAGAGGGGAGACGG - Intronic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1181544302 22:23592343-23592365 CAGAGTAATCAGAGAGGAGGTGG + Intergenic
1181696296 22:24594485-24594507 CAGAGATGGCAGTGGGGAGAGGG + Intronic
1182155904 22:28072769-28072791 CAGAGGTAGCAGGGGGAAGCCGG + Intronic
1182711622 22:32326828-32326850 CAGAGTCAGCGGAGGGGATGTGG + Intergenic
1182779026 22:32852663-32852685 CAGAGTTAGCAGACGGGAGAAGG - Intronic
1183327605 22:37202937-37202959 CAGCATTATCAGAGGGGAGCTGG - Intergenic
1183457560 22:37930888-37930910 CAGAGTCCCCAGCGGGGAGAGGG + Intronic
1183495846 22:38143303-38143325 CAGGGTGAGCAGAGGTGAGCAGG + Intronic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1184291792 22:43501341-43501363 GAAAGATAGAAGAGGGGAGAAGG - Intronic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184795311 22:46728753-46728775 CAGAGTCAGCAGCTGGGAGCTGG + Intronic
1184946363 22:47807139-47807161 CAGAGGCAGCAGTGGGGACACGG - Intergenic
1184949909 22:47833922-47833944 CTGAGATTGCAGAGAGGAGACGG + Intergenic
1185004868 22:48269990-48270012 GAGAGATGGGAGAGGGGAGAGGG + Intergenic
1185385736 22:50530663-50530685 CAGAGTCAGGAGAGTGGGGAGGG - Intronic
949302894 3:2605343-2605365 CAGTGTTAGGAGGTGGGAGAAGG + Intronic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
950412441 3:12847912-12847934 CAGAGCCAGCAGTGGGGACAGGG - Intronic
951072085 3:18341308-18341330 GAGAGCTAGGAGAAGGGAGAGGG - Intronic
952570170 3:34706049-34706071 CATATTTAGGAGTGGGGAGAAGG + Intergenic
954324851 3:49857958-49857980 CAGAGGAAGCAAAGGCGAGAGGG + Intergenic
954384831 3:50238522-50238544 CAGAGTAAGCAAAGGCCAGAAGG - Intronic
954681554 3:52348818-52348840 GTGAATGAGCAGAGGGGAGATGG - Intronic
955578170 3:60388884-60388906 TAAAGTTAGCACAGTGGAGAAGG + Intronic
955968609 3:64414079-64414101 CAGTGTTCAAAGAGGGGAGAAGG - Intronic
956388231 3:68743773-68743795 CAGAGTTAGTAAAGGGGTGGAGG + Intronic
956519204 3:70085027-70085049 CAGTGATGGCAGAGGGGAGAGGG + Intergenic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
957361199 3:79161160-79161182 CAGATTTAGCAAATGGCAGAAGG + Intronic
957893647 3:86390767-86390789 CAGAGCTAGCAGTGGGGAAGTGG - Intergenic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
959946737 3:112133237-112133259 CAGAGACAGCAGAAAGGAGAAGG + Exonic
960136668 3:114112516-114112538 TGGAGTTAGCAGACGGGAGATGG + Intergenic
960449619 3:117790458-117790480 CAGAATTAGCAGGGAGGAGGAGG - Intergenic
961150171 3:124631266-124631288 CAGAGTTGTCAGAGGAGAGATGG - Intronic
961185443 3:124910962-124910984 CAGAGTTAGGAGAGGAGAATGGG - Intronic
961490851 3:127255933-127255955 AAGAGTTAGTGGTGGGGAGAGGG - Intergenic
961622721 3:128237598-128237620 CAGAGCTGGGAGAGGGGAGCAGG - Intronic
962203077 3:133415850-133415872 GAGGGTGAGTAGAGGGGAGAGGG - Intronic
962203241 3:133416557-133416579 AGGGGTTAGTAGAGGGGAGATGG - Intronic
962203510 3:133417585-133417607 AGGAGTGAGTAGAGGGGAGATGG - Intronic
962414993 3:135173734-135173756 CAGAGTCAGAAGAGTGGAGCTGG - Intronic
962886384 3:139631818-139631840 CAGAGTTAGCATGGTGGTGAGGG - Intronic
963002881 3:140699685-140699707 CAGAGTTATCAGAGGGCATGAGG - Intronic
963085662 3:141434002-141434024 GAGAGTGAGCAGAGGGGAACTGG - Intronic
963090395 3:141478309-141478331 CAAATTTAGCAGTGGGGAGGAGG - Intergenic
964148687 3:153497763-153497785 CAGCGAGAGCTGAGGGGAGAGGG - Intronic
964308035 3:155361765-155361787 CAGAGTTTGGACAGGGCAGAAGG - Intergenic
965360014 3:167727244-167727266 CAGAATTAGCTGATGGGAAATGG + Intronic
965369818 3:167847998-167848020 GAGGGTTAGGAGAGGGGAGATGG - Intergenic
965410606 3:168326059-168326081 CAGAGGAAGCAGAGTGGAGTTGG + Intergenic
967293797 3:187946654-187946676 TAGAGATAGGAGAGGGGAGAAGG + Intergenic
968054608 3:195681788-195681810 CAAAGTTACCAGAGGGAAAAAGG - Intergenic
968101283 3:195967370-195967392 CAAAGTTACCAGAGGGAAAAAGG + Intergenic
968605184 4:1532064-1532086 GAGAGTCAGCAGAGTGGAGCAGG - Intergenic
968899821 4:3425917-3425939 TGGAGTTGGCACAGGGGAGAGGG + Intronic
968899869 4:3426047-3426069 TGGAGTTGGCACAGGGGAGAGGG + Intronic
969217054 4:5731113-5731135 CAGAGTTGGCAGCTGGGAGGAGG + Intronic
969348012 4:6581277-6581299 AAGAGATAGCAGATGGGAAAGGG - Intronic
969702557 4:8775813-8775835 CAGAGCTGGCAGGGAGGAGAGGG - Intergenic
970954323 4:21792972-21792994 CAGAGTCAACAGATGAGAGAAGG + Intronic
973942000 4:55920502-55920524 CTGAGATAGCAAAGGGGAAAAGG + Intergenic
975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG + Intronic
975931022 4:79522735-79522757 CAGAGCCTGGAGAGGGGAGAAGG + Intergenic
976379650 4:84384704-84384726 AAGAGCTAGCAGAGGGGAGGTGG - Intergenic
980112269 4:128646294-128646316 GAGAGTCAGCAAAGGGGATAGGG + Intergenic
980397723 4:132236486-132236508 GAGACTTAGAAGAGAGGAGAGGG + Intergenic
980777448 4:137454758-137454780 CAGAGCTAGCAGTGAGGAAATGG + Intergenic
981889716 4:149720245-149720267 CAGAGTTAGCAGAAGAAAAATGG + Intergenic
982159956 4:152558527-152558549 CAGAGATAGCTGAAGGGAGAAGG - Intergenic
982925886 4:161336433-161336455 CAAAGTAACCAGAGGTGAGAAGG + Intergenic
983428882 4:167622174-167622196 AAAAGTTAGCCGAGGGGTGAGGG - Intergenic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
984053831 4:174900881-174900903 CAGAGTTTCCAGAGAGGATATGG + Intronic
986164764 5:5264050-5264072 CTCAGTTGGTAGAGGGGAGATGG - Intronic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986695815 5:10353750-10353772 GAGAGGAAGGAGAGGGGAGAGGG - Exonic
987259688 5:16190556-16190578 AAGAGGTGGCAGTGGGGAGAAGG + Intergenic
988253028 5:28785094-28785116 CAGAGTCAGTAGAGGATAGAAGG + Intergenic
988383778 5:30535252-30535274 CACAGTTAGCAGGGGTGTGAGGG + Intergenic
988656802 5:33220675-33220697 CAGAGAAAGCAGAGTTGAGATGG + Intergenic
989130291 5:38100435-38100457 CAGAGTTTGCTGATGGGAAAGGG + Intergenic
989260203 5:39411010-39411032 CAGAGTAAGCAGATGGGATAAGG + Intronic
990058591 5:51618060-51618082 AAGAGATAACAAAGGGGAGATGG - Intergenic
990796289 5:59544688-59544710 CACAGTGAGTAGTGGGGAGAAGG + Intronic
992295287 5:75321470-75321492 CAGAGCTAGCAGTGGGAAAATGG + Intergenic
992497195 5:77305506-77305528 CACAGTTGGCAGGGGAGAGAGGG + Intronic
993774128 5:91970024-91970046 AAAAGTTAGCAGAGGGGACACGG + Intergenic
995852828 5:116563902-116563924 CAGAGATATCTGAGGGGAGGTGG + Intronic
997191832 5:131945185-131945207 CAGAGAAAGCAGAGCGGAGCAGG - Intronic
997234803 5:132266579-132266601 CAGAGTGAGCCCAGGGCAGAGGG + Intronic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
999065090 5:148676860-148676882 CCGAGTCAGCAGATGAGAGAGGG - Intronic
999228781 5:150049178-150049200 CAGAGTGAGCTGAGAGGAGGGGG + Intronic
999902187 5:156096361-156096383 CAGAGCTAGCAGTGGGGAAATGG + Intronic
1000830798 5:166098771-166098793 TAAAGATAGCAGAGGGGAAAAGG - Intergenic
1000873509 5:166606203-166606225 CAGGGGTAGCAGAGGCGAAAAGG - Intergenic
1001046292 5:168374553-168374575 ATGAGTGAGGAGAGGGGAGAAGG + Intronic
1001415160 5:171540511-171540533 CAGAGGCAGCACAGGGGAGTCGG - Intergenic
1001771683 5:174301719-174301741 GAGAGTTAGCCGAGGGGTGCAGG - Intergenic
1001973706 5:175979206-175979228 CTCAGTCAGTAGAGGGGAGATGG + Intronic
1002039175 5:176499057-176499079 AAAAGTTGGCAGAGGAGAGACGG + Exonic
1002243726 5:177864573-177864595 CTCAGTCAGTAGAGGGGAGATGG - Intergenic
1002985768 6:2189582-2189604 CAGAGTGAGCAGAGCACAGAGGG - Intronic
1003244171 6:4370183-4370205 CAGAGCAGGCAGAGGGGAGATGG + Intergenic
1003578833 6:7321085-7321107 CAGGGTCAGAATAGGGGAGAGGG + Intronic
1005102483 6:22187445-22187467 CAGACTTAGGAGATGGGTGAGGG - Intergenic
1005928789 6:30465548-30465570 AAGACTTGGCAGATGGGAGAGGG + Intergenic
1006046133 6:31300335-31300357 CCTTGTTAGCAGATGGGAGAGGG - Intronic
1006406034 6:33845573-33845595 CAGAGGAAGCAGATGTGAGAAGG - Intergenic
1006651417 6:35554874-35554896 CAGAGTCAGCAGCAGGGAGAAGG + Intergenic
1006729066 6:36222082-36222104 CAGAGAGGGGAGAGGGGAGAAGG + Intronic
1007556688 6:42772326-42772348 CTGAGTTAGGCGACGGGAGAAGG + Intronic
1007657747 6:43462151-43462173 CAGAGTGAGCAGAGAGGAGGAGG - Intergenic
1010631372 6:78202440-78202462 CAGAGCTAGCAGTGGGGAAATGG + Intergenic
1010743185 6:79531234-79531256 CAGTTTTAGCAGAGTTGAGAGGG - Intronic
1011202926 6:84857316-84857338 CAGACTTAGAAGATGGGGGAGGG - Intergenic
1012920975 6:105220911-105220933 CAGAGTGTGCAGTGGGGAAAGGG - Intergenic
1012977930 6:105800034-105800056 CAGAGTCAGGAGAGTGGAGTTGG - Intergenic
1013307442 6:108862644-108862666 CAGAGATAGGGGAAGGGAGAGGG + Intronic
1013432765 6:110069788-110069810 CAGAGTGAGCCAAGAGGAGAGGG - Intergenic
1014069282 6:117162279-117162301 CAGAGTGGGCAGCGTGGAGACGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1016912354 6:149211670-149211692 CAGAGATAGCAGACGCCAGAAGG - Intergenic
1017193515 6:151677798-151677820 CAGAGTTTGCAAAGGGAGGAGGG + Intronic
1017522218 6:155212758-155212780 AAGAGTGAGCAGAGTGGTGAGGG + Intronic
1017759353 6:157556228-157556250 CAGAGCCAGCAGAGAGGACAGGG + Intronic
1018323768 6:162641703-162641725 TAGAGTTAACAGAGGGCGGATGG - Intronic
1018378182 6:163232908-163232930 CAGAGTTGGGAGAGGGCTGAGGG - Intronic
1018441559 6:163818541-163818563 AAGATTTTACAGAGGGGAGAAGG - Intergenic
1019064672 6:169287216-169287238 GAGGGACAGCAGAGGGGAGAGGG + Intergenic
1019184042 6:170210550-170210572 CATTGCCAGCAGAGGGGAGACGG + Intergenic
1019291766 7:254042-254064 CAGCGTTGGCAGTGGGGTGAGGG + Intronic
1021489672 7:21205432-21205454 CAGATTGAGCAGAGGCCAGAGGG + Intergenic
1021645955 7:22789667-22789689 CAGACTTGGTAGAGGGGAAATGG - Intergenic
1022037617 7:26549361-26549383 AAGAGTTAAGAGAGGGGAAAGGG + Intergenic
1022049092 7:26647742-26647764 CAGAGGCAGGTGAGGGGAGATGG - Intergenic
1022838226 7:34136978-34137000 CAGAGAAAGCAGAGAGCAGAGGG + Intronic
1023451667 7:40292621-40292643 CAGACTTAGCAGAAGGCAAAAGG - Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1026226806 7:68449256-68449278 CAGAGAAAGAAGAGGAGAGAGGG - Intergenic
1026293416 7:69029240-69029262 CAGAGTCAGCTGAAGAGAGATGG - Intergenic
1026364352 7:69632601-69632623 CAGAGAGGGAAGAGGGGAGAGGG - Intronic
1026740150 7:72974114-72974136 CTGAATCAGCAGAGGAGAGAAGG + Intergenic
1026797458 7:73375626-73375648 CTGAATCAGCAGAGAGGAGAAGG + Intergenic
1026833846 7:73625281-73625303 AGGAGTTAGGTGAGGGGAGATGG - Intergenic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1027103583 7:75390956-75390978 CTGAATCAGCAGAGGAGAGAAGG - Intergenic
1027338112 7:77175961-77175983 CAGTGTTATCAGAAGGGAAAGGG + Intronic
1027360756 7:77406885-77406907 CCGCCTTAGCAGCGGGGAGAGGG - Intronic
1027617249 7:80438493-80438515 CAAAGGTAGCAGGTGGGAGAAGG + Intronic
1027800570 7:82744789-82744811 CAGAATTTGCAAAAGGGAGAAGG + Intergenic
1028182909 7:87747370-87747392 CGGAGGTAGCAGGGGGGTGAGGG + Intronic
1028730502 7:94142565-94142587 CAGAATTAGCAGGCGGGAAAAGG + Intergenic
1028905753 7:96152327-96152349 CCTAGGGAGCAGAGGGGAGAGGG + Intronic
1029591845 7:101512166-101512188 CTGAGTCAGCACAGGGGAGGAGG + Intronic
1029777615 7:102694832-102694854 CAGTGTTATCAGAAGGGAAAGGG - Intergenic
1030787881 7:113684792-113684814 CTCAGTCAGTAGAGGGGAGATGG - Intergenic
1031859519 7:126961986-126962008 GAAGGTTAGGAGAGGGGAGAAGG - Intronic
1032354744 7:131200073-131200095 CAGAGGTTGCAGAGCTGAGATGG - Intronic
1033200443 7:139363658-139363680 AGTTGTTAGCAGAGGGGAGAGGG + Intronic
1033237880 7:139652772-139652794 CAGAGTTGAGAGAAGGGAGAGGG + Intronic
1033242308 7:139690282-139690304 CAGAGTCAGGGGAGGGCAGAGGG + Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1033781864 7:144680361-144680383 CAGCCTGAGCAGAGGAGAGAAGG + Intronic
1034422278 7:150996170-150996192 CAGGGGTGGGAGAGGGGAGAGGG - Intronic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1035693391 8:1574351-1574373 CACAGTTACCAGAGCGGCGAGGG - Intronic
1036403723 8:8434311-8434333 CAGAGGGTGCAGAGGAGAGAAGG + Intergenic
1036779652 8:11637003-11637025 GAGAGTTATCTGAGGGGGGAGGG + Intergenic
1036916597 8:12810210-12810232 AAAAGTTAGCAGAAGTGAGAAGG + Intergenic
1038092284 8:24267909-24267931 CATATTTAGCAGATGTGAGAAGG - Intergenic
1038253443 8:25927645-25927667 GAGTGTTAGAAGAGGGGACAGGG + Intronic
1038369452 8:26973331-26973353 CCGAGTTTGCAGTGGGGAAAAGG - Intergenic
1038450167 8:27634379-27634401 CAGAGGAAGCAAAGAGGAGAGGG + Intronic
1039615569 8:38952372-38952394 TAGACATAGCAGAGGTGAGAGGG + Intronic
1041340982 8:56845107-56845129 GGGAGTGAGCAGATGGGAGAGGG + Intergenic
1041346804 8:56907445-56907467 CAGAGTTGGCAGGAGGGAGAGGG - Intergenic
1041858865 8:62488323-62488345 CAGAATTAGCAGAGGAAAGAAGG - Intronic
1042909425 8:73810088-73810110 GGGAGCTGGCAGAGGGGAGAAGG + Intronic
1044828722 8:96224236-96224258 TAGAGATAGCAGAGTGGGGAGGG + Intergenic
1044927322 8:97220753-97220775 AAGAGACAGCAGAGGGGAGGTGG - Intergenic
1045905127 8:107336078-107336100 AAGAGTTGGCAGAGAGGTGAAGG + Intronic
1046115661 8:109780260-109780282 CAGAGGAAGAAGAGGTGAGAAGG - Intergenic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1048392374 8:133979979-133980001 CGGAGGTTGCAGAGTGGAGATGG - Intergenic
1048530082 8:135240001-135240023 CAGAGGTAGAAGAGGAGATATGG - Intergenic
1048531580 8:135254850-135254872 CAGAAGCAGCAGAGAGGAGAAGG + Intergenic
1048693575 8:136996394-136996416 CACAGTTATCAGAGGCTAGAAGG + Intergenic
1048963642 8:139599704-139599726 CAGAGTTGCCACAGGGGAAAGGG + Intergenic
1049015574 8:139917729-139917751 CAGAGATGGCAAATGGGAGACGG + Intronic
1049095207 8:140544601-140544623 CAGAGGGAGTAGAGGGTAGAAGG - Intronic
1049708883 8:144054934-144054956 CAGAGTGGGCACAGGGGAGCAGG + Intronic
1049730310 8:144174025-144174047 CTCAGTTGGCAGAGGGGAGGTGG - Intronic
1049741252 8:144242094-144242116 CCGAGGTAGCAGAGGGCCGAGGG - Intronic
1050010521 9:1181490-1181512 CAGAGTGGGTAGAGCGGAGATGG - Intergenic
1050334605 9:4578438-4578460 GAGAGTTTGCAGAGAAGAGAAGG + Intronic
1050418459 9:5438006-5438028 CAGTGTTACCAGAGGTGGGAGGG + Intergenic
1052257379 9:26474292-26474314 GGGAGATAGGAGAGGGGAGATGG - Intergenic
1053046058 9:34918191-34918213 CACAGTTGGCAGAGGGGTGATGG - Intergenic
1053122040 9:35554968-35554990 CAGAGATGGGAGAGGGGAGAGGG - Intronic
1053167667 9:35855993-35856015 CAGAGTCAGCAGAGTACAGAAGG + Intergenic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1055090584 9:72361986-72362008 CAAAATTAGAAGATGGGAGAAGG + Intronic
1055269382 9:74540241-74540263 CAGAGTGAGCAGAGGGGGCAGGG - Intronic
1056380834 9:86055777-86055799 CAGGGATAGGAGAGGGGGGAGGG + Intronic
1056493229 9:87128823-87128845 TTGAGGTAGCAGAGAGGAGAAGG - Intergenic
1056638343 9:88349414-88349436 CCCAGTTTGCAGAGAGGAGATGG + Intergenic
1058959341 9:109978158-109978180 CTGAGGTGGCAGAGGGGAGATGG + Intronic
1059176218 9:112172274-112172296 CAGAGCTAGTAGAGGAGAGAGGG - Intronic
1059300354 9:113307642-113307664 AAGAGGTGGCAGAGGGCAGAAGG + Intergenic
1060154608 9:121310644-121310666 CAGCATTAGCCCAGGGGAGAAGG - Intronic
1060591221 9:124818126-124818148 CAGAGCTCACAGAGGGGAGATGG - Intergenic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1061860976 9:133468674-133468696 CAGAGCCAGAAGAGGGGACAGGG - Exonic
1061927633 9:133813749-133813771 CAAAGTTGGCAGAGGGCAGATGG + Intronic
1062451106 9:136616188-136616210 CCGAGTGGGCAGAGGGGAGACGG - Intergenic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1185966824 X:4614916-4614938 CAGAGAGAGGAGGGGGGAGAGGG + Intergenic
1186485115 X:9928237-9928259 CACAGTTCCCAGAGGGGAGAGGG - Intronic
1187002061 X:15192101-15192123 CTGAGTTAGCAGAGAAAAGAAGG + Intergenic
1187989702 X:24856207-24856229 CAGAGTTAGGAGTGGGAAGGAGG - Intronic
1188659316 X:32738738-32738760 AAGAGTTAGCAGAGCAGATAAGG + Intronic
1188976864 X:36686158-36686180 CAGACAGAGCAGAGTGGAGATGG - Intergenic
1190291758 X:48997645-48997667 GAGAGATAGAAAAGGGGAGAGGG + Intronic
1192204012 X:69084246-69084268 CAGAGTTGGCCGAGGGTAGGAGG + Intergenic
1192210169 X:69122977-69122999 AGGAGCTGGCAGAGGGGAGACGG - Intergenic
1192474413 X:71427551-71427573 AAAAGTAAGCAGAGGGCAGATGG + Intronic
1192638458 X:72842902-72842924 CTGAGGTAGCAGAGAGGGGAAGG - Intronic
1192643256 X:72877906-72877928 CTGAGGTAGCAGAGAGGGGAAGG + Intronic
1195744236 X:108098594-108098616 AAGAGGTAGCACAGGAGAGATGG - Intronic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1198659406 X:138951207-138951229 CAGAGTAAGCTGATGGGAGGCGG - Intronic
1198886220 X:141341498-141341520 CAGAGATAGCAGAAGGGAAATGG - Intergenic
1199617055 X:149664771-149664793 AAGAGCTAGCAGAGTAGAGAAGG - Intergenic
1199625586 X:149738477-149738499 AAGAGCTAGCAGAGTAGAGAAGG + Intergenic
1199845830 X:151692653-151692675 CAAGGCTTGCAGAGGGGAGAAGG + Intergenic
1202128359 Y:21588327-21588349 CAGAGATATCAGAGAGCAGAAGG + Intergenic
1202150931 Y:21843130-21843152 CAGAGATATCAGAGAGCAGAAGG - Intergenic