ID: 1151820676

View in Genome Browser
Species Human (GRCh38)
Location 17:76495098-76495120
Sequence TCATGAACGTTTGCAGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151820676_1151820678 0 Left 1151820676 17:76495098-76495120 CCCTTTGCTGCAAACGTTCATGA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1151820678 17:76495121-76495143 AAGTCTGCCTCTCTGCATCCCGG 0: 1
1: 0
2: 2
3: 25
4: 208
1151820676_1151820682 17 Left 1151820676 17:76495098-76495120 CCCTTTGCTGCAAACGTTCATGA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1151820682 17:76495138-76495160 TCCCGGCAGCCGGGTTTTCACGG 0: 1
1: 0
2: 1
3: 4
4: 69
1151820676_1151820686 25 Left 1151820676 17:76495098-76495120 CCCTTTGCTGCAAACGTTCATGA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1151820686 17:76495146-76495168 GCCGGGTTTTCACGGGTCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 49
1151820676_1151820680 7 Left 1151820676 17:76495098-76495120 CCCTTTGCTGCAAACGTTCATGA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1151820680 17:76495128-76495150 CCTCTCTGCATCCCGGCAGCCGG 0: 1
1: 0
2: 2
3: 35
4: 254
1151820676_1151820681 8 Left 1151820676 17:76495098-76495120 CCCTTTGCTGCAAACGTTCATGA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1151820681 17:76495129-76495151 CTCTCTGCATCCCGGCAGCCGGG 0: 1
1: 0
2: 1
3: 24
4: 257
1151820676_1151820684 18 Left 1151820676 17:76495098-76495120 CCCTTTGCTGCAAACGTTCATGA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG 0: 1
1: 0
2: 0
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151820676 Original CRISPR TCATGAACGTTTGCAGCAAA GGG (reversed) Intronic
900355053 1:2257180-2257202 TCATTAATGTCTGCAGCAACAGG - Intronic
917704235 1:177615584-177615606 TGATAAACGTTTGCAGCGATGGG + Intergenic
919738349 1:200967788-200967810 TCCAGAAAGTTTGCAGCACAAGG - Intergenic
922184212 1:223259656-223259678 TTATGAGCGGTTGCAGGAAAGGG - Intronic
922356549 1:224782011-224782033 TCATTAATGATTGCAGCAAGAGG - Intergenic
1063139180 10:3241305-3241327 ATAAGAACTTTTGCAGCAAATGG - Intergenic
1066302538 10:34109415-34109437 TGAGGAAAGTTTGCAGGAAAGGG - Intergenic
1069135685 10:64761383-64761405 TAATGAATGATTGTAGCAAAGGG + Intergenic
1076162328 10:128254824-128254846 ACATCACCGTTTGCAGAAAAAGG - Intergenic
1080461979 11:32462741-32462763 TTATGAACGTTTTAAGCAGAGGG - Intergenic
1083526621 11:63372378-63372400 TAATGAATTTTTACAGCAAAGGG + Intronic
1087505891 11:99020783-99020805 CAATGAACCTTTGCAGCAAGAGG + Intergenic
1091975990 12:4825952-4825974 TCATCAATGTTTTCATCAAAAGG - Intronic
1093828767 12:23729059-23729081 TCATGAATGTTTCCAGCAAGAGG - Intronic
1099310499 12:81015377-81015399 CCATCCACGTTTGTAGCAAATGG + Intronic
1101233161 12:102762575-102762597 TCATGAAATTTTGAGGCAAATGG - Intergenic
1103066024 12:117898153-117898175 TCATGAACACTTACAGCGAATGG + Intronic
1105959604 13:25318637-25318659 TCATGAGCATTTGAAGAAAATGG + Intronic
1106702216 13:32242098-32242120 TTATGAACATTAGCAACAAAAGG - Intronic
1106937452 13:34738774-34738796 TCATAAACGCATGCAGCAGATGG - Intergenic
1110764861 13:79271403-79271425 CCATTAACGTTAACAGCAAATGG - Intergenic
1111289725 13:86149763-86149785 TGAGGAACATTTTCAGCAAAAGG + Intergenic
1111406435 13:87812737-87812759 TCATGATCGTTTTTAGCAAAAGG + Intergenic
1116459340 14:45153979-45154001 TTATGAATTATTGCAGCAAATGG + Exonic
1118003342 14:61543759-61543781 TAATGAAAGTTTTCTGCAAAAGG + Intronic
1120764652 14:88317600-88317622 TCATGGACGTAAGCATCAAAAGG + Intronic
1121089684 14:91172426-91172448 TTATGAATGTAGGCAGCAAATGG + Intronic
1131921225 15:97330970-97330992 TCATGTAGTTTTGCAGCTAAGGG + Intergenic
1140026928 16:71299110-71299132 TCAAGAAGTTTTGCTGCAAATGG - Intergenic
1140376882 16:74451855-74451877 TCATCAACCTTTGCAGAATATGG - Intergenic
1141778575 16:86141310-86141332 TCATGGACGGTGGCAGCAAATGG - Intergenic
1144348809 17:14374207-14374229 TCAAGAATGTGTGCTGCAAAAGG + Intergenic
1150090525 17:62320835-62320857 TGGTGAACGTTTGCATCTAATGG + Intergenic
1151364676 17:73609533-73609555 TCATGACATTTTGCTGCAAAGGG + Intronic
1151820676 17:76495098-76495120 TCATGAACGTTTGCAGCAAAGGG - Intronic
1156577814 18:38338927-38338949 TCATTAACTTTTGCTTCAAAGGG - Intergenic
1159725528 18:71952716-71952738 TCCTAAATGTATGCAGCAAATGG - Intergenic
1167948676 19:53009583-53009605 TCATGAAGGTTTGCACATAAGGG - Intergenic
1168082996 19:54024049-54024071 TCATGACTGTTTCCAGCCAACGG - Intergenic
933718471 2:85380330-85380352 TCAGCAACGTTTTAAGCAAAAGG + Intronic
936459965 2:112706350-112706372 TCAGGAGTCTTTGCAGCAAAGGG - Intergenic
942337286 2:174902628-174902650 ACAAGAAGGTTTGCAGGAAATGG + Intronic
948618804 2:239220046-239220068 TCATGGAGGCTTGCAGCAAAAGG - Intronic
1172214904 20:33228422-33228444 ACATGCACGTGTGGAGCAAAAGG + Intergenic
1178214567 21:30579606-30579628 AGATGAAGGTTTGCAGCATAGGG + Intergenic
1179028522 21:37700368-37700390 TCAGGAACGTCTGCAGCCTATGG + Intronic
952463074 3:33550044-33550066 CCATCAACATTTGCTGCAAAAGG - Intronic
956701528 3:71963348-71963370 TCAGCAACGCTTGCAGCACAGGG + Intergenic
956941450 3:74166694-74166716 TCATGACTTTTTACAGCAAAAGG + Intergenic
960905293 3:122595248-122595270 TCAAGAAATTTTGCTGCAAAGGG - Intronic
961748272 3:129079941-129079963 TCATGAGCGATTTCAGCAGAAGG + Intergenic
962631711 3:137283106-137283128 TCATGATCTTTTGGAACAAAAGG + Intergenic
969538821 4:7773198-7773220 TCCTCAACGGCTGCAGCAAAGGG - Intronic
970346596 4:15158858-15158880 TCATGCAGGTTGTCAGCAAACGG + Intergenic
970443265 4:16103036-16103058 ACTTGGACGTTTGCAGCACACGG + Intergenic
970734244 4:19147519-19147541 TCATTCAGGTTTGCAGCAGATGG + Intergenic
977669471 4:99679401-99679423 TCAGGAAGGTTTGCATAAAAAGG - Intergenic
979320153 4:119313982-119314004 AGATGAAAGTTTGAAGCAAATGG - Intergenic
979434465 4:120672402-120672424 TCATGAACACTTGGAGCCAATGG + Intergenic
979695799 4:123611750-123611772 TCATGATTCTTTGCAGTAAATGG - Intergenic
980758804 4:137200845-137200867 ACAAGAACGCTTGCAGCAGAGGG - Intergenic
981661689 4:147174996-147175018 TCATGGACATTTTCAGCACAGGG - Intergenic
989219146 5:38935350-38935372 TAATCAATGTTTCCAGCAAAAGG - Exonic
989604816 5:43233761-43233783 TCATACCCGTTTGCAGCTAATGG - Intronic
990647710 5:57863266-57863288 TCATAAACATATGCAGCAACGGG + Intergenic
995847422 5:116509055-116509077 ACATGTCCGGTTGCAGCAAACGG + Intronic
1012761934 6:103313816-103313838 TCATGCATGTATGCAGCAGAAGG - Intergenic
1014340152 6:120194892-120194914 TGATGGACATTTGCAGGAAATGG - Intergenic
1015637057 6:135287503-135287525 TGATGAACGCTAACAGCAAAAGG + Intronic
1017667283 6:156732587-156732609 TCATTAACTTTTGCAGTAAGAGG - Intergenic
1019034747 6:169045056-169045078 TCAAACACGTTTGCAGCCAAAGG + Intergenic
1021154978 7:17198747-17198769 GCATGAAGGATTGAAGCAAAAGG + Intergenic
1025555627 7:62304396-62304418 TCATGATCGAATGGAGCAAATGG + Intergenic
1027700472 7:81464317-81464339 TCATGAGCTTTTCCAGGAAAAGG + Intergenic
1030830656 7:114216219-114216241 TCATGAACATGTGCGGCGAAAGG + Intronic
1032999615 7:137489475-137489497 TCATGCATCTTTGCAGGAAATGG + Intronic
1038265383 8:26035624-26035646 GCTTAAACATTTGCAGCAAATGG + Intronic
1039617100 8:38964576-38964598 TCATCAACCTTTTCAGCATAGGG - Intronic
1043376450 8:79655041-79655063 TATTGAACGTCTGCAGGAAAAGG + Exonic
1044162843 8:88942313-88942335 TCATGAATGTCTGTATCAAATGG - Intergenic
1046556050 8:115774816-115774838 TCATGAACTTTAGGAGCAAAGGG + Intronic
1058759636 9:108118531-108118553 ATATGAAGGTTTGCAGCAGATGG + Intergenic
1058948966 9:109885495-109885517 TCAAGAATGATTGCAGTAAATGG + Intronic
1189412198 X:40782553-40782575 TCTTCAACCTTTGCAGCAAAAGG - Intergenic
1196222920 X:113133045-113133067 TCATGAACGTTTTCTGAATAAGG + Intergenic
1198330404 X:135617524-135617546 TCATGAGAGTTCTCAGCAAAGGG - Intergenic
1198336523 X:135671475-135671497 TCATGAGAGTTCTCAGCAAAGGG + Intergenic
1198340686 X:135710776-135710798 TCATGAGAGTTCTCAGCAAAGGG - Intergenic
1198347276 X:135770947-135770969 TCATGAGAGTTCTCAGCAAAGGG + Intergenic
1198349182 X:135788208-135788230 TCATGAGAGTTCTCAGCAAAGGG + Intergenic
1198351087 X:135805481-135805503 TCATGAGAGTTCTCAGCAAAGGG + Intergenic
1198352994 X:135822746-135822768 TCATGAGAGTTCTCAGCAAAGGG + Intergenic
1198354903 X:135840001-135840023 TCATGAGAGTTCTCAGCAAAGGG + Intergenic
1198356813 X:135857284-135857306 TCATGAGAGTTCTCAGCAAAGGG + Intergenic
1198358726 X:135874563-135874585 TCATGAGAGTTCTCAGCAAAGGG + Intergenic
1198363125 X:135915312-135915334 TCATGAGAGTTCTCAGCAAAGGG - Intergenic