ID: 1151820677

View in Genome Browser
Species Human (GRCh38)
Location 17:76495099-76495121
Sequence TTCATGAACGTTTGCAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151820677_1151820684 17 Left 1151820677 17:76495099-76495121 CCTTTGCTGCAAACGTTCATGAA 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG 0: 1
1: 0
2: 0
3: 6
4: 72
1151820677_1151820681 7 Left 1151820677 17:76495099-76495121 CCTTTGCTGCAAACGTTCATGAA 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1151820681 17:76495129-76495151 CTCTCTGCATCCCGGCAGCCGGG 0: 1
1: 0
2: 1
3: 24
4: 257
1151820677_1151820678 -1 Left 1151820677 17:76495099-76495121 CCTTTGCTGCAAACGTTCATGAA 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1151820678 17:76495121-76495143 AAGTCTGCCTCTCTGCATCCCGG 0: 1
1: 0
2: 2
3: 25
4: 208
1151820677_1151820686 24 Left 1151820677 17:76495099-76495121 CCTTTGCTGCAAACGTTCATGAA 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1151820686 17:76495146-76495168 GCCGGGTTTTCACGGGTCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 49
1151820677_1151820682 16 Left 1151820677 17:76495099-76495121 CCTTTGCTGCAAACGTTCATGAA 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1151820682 17:76495138-76495160 TCCCGGCAGCCGGGTTTTCACGG 0: 1
1: 0
2: 1
3: 4
4: 69
1151820677_1151820680 6 Left 1151820677 17:76495099-76495121 CCTTTGCTGCAAACGTTCATGAA 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1151820680 17:76495128-76495150 CCTCTCTGCATCCCGGCAGCCGG 0: 1
1: 0
2: 2
3: 35
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151820677 Original CRISPR TTCATGAACGTTTGCAGCAA AGG (reversed) Intronic
901148608 1:7085543-7085565 TTCTGGAACGTTCTCAGCAATGG - Intronic
901945295 1:12697440-12697462 TTCATGAATGTGTGCACTAAAGG - Intergenic
907575741 1:55524187-55524209 TGCATGAACCTGTGCAGCAAGGG + Intergenic
909839577 1:80302377-80302399 TTCATGAACCTCTACAGTAAAGG + Intergenic
910254662 1:85235891-85235913 GTCATGAAAATTTCCAGCAAGGG + Intergenic
917704234 1:177615583-177615605 GTGATAAACGTTTGCAGCGATGG + Intergenic
918592480 1:186255529-186255551 TGCATGAACACTTGCAGTAAGGG + Intergenic
920576053 1:207061519-207061541 TTCATAAACCTGTGGAGCAAAGG - Intronic
920659350 1:207902246-207902268 TTCATGAAGGGAAGCAGCAATGG + Intronic
922135624 1:222822795-222822817 TTTAAGAAGGTGTGCAGCAAAGG - Intergenic
923714534 1:236413570-236413592 CTCATGGACGTTTTCAGAAATGG + Intronic
1063081309 10:2770348-2770370 TTCATGAACTGTTGGAGAAATGG - Intergenic
1065547011 10:26831928-26831950 TTCATCAGCGTTTGCAGAATTGG - Intronic
1069092920 10:64223686-64223708 TGCATGAATGTTGGCAGCAGTGG - Intergenic
1071424210 10:85532080-85532102 TTCATAAAAGTTTTCAGAAATGG + Intergenic
1072293311 10:93986753-93986775 TTCATGAACATTTACAAAAATGG - Intergenic
1072603801 10:96959778-96959800 TTCATGATCTGCTGCAGCAAAGG - Intronic
1074603532 10:114938325-114938347 TGCAGGAACGGTCGCAGCAATGG + Exonic
1075283319 10:121160346-121160368 TTCATTAACTTTTTCTGCAAAGG + Intergenic
1077381774 11:2246547-2246569 TTCATGAATGTTTATAGCATTGG + Intergenic
1078831579 11:14982406-14982428 TTCATGGTCTTTTGCAACAACGG + Intronic
1080858910 11:36136154-36136176 TTCATGAATGTGTGCTGCAGGGG + Intronic
1082652113 11:55806410-55806432 GTCCTGAATGTATGCAGCAAGGG + Intergenic
1089474797 11:118750487-118750509 TACATAAACTTTTGCAGGAATGG - Exonic
1095749893 12:45698011-45698033 TTCATGTGCGTTTTCTGCAAGGG - Intergenic
1097554047 12:61115466-61115488 TTCATGAACCTCTGAAGCAATGG - Intergenic
1099121551 12:78695771-78695793 CTCATGGAGGTTTACAGCAAGGG - Intergenic
1100318696 12:93469448-93469470 TGCAGGAGTGTTTGCAGCAATGG + Intronic
1102858845 12:116318184-116318206 TTCATGAACGTCTGCTGTGATGG + Intergenic
1107522792 13:41200289-41200311 TTCATGAATGTTTTCAACAGCGG + Intergenic
1109376320 13:61498369-61498391 TTCATGTACATTTGCTACAATGG - Intergenic
1110000878 13:70198073-70198095 TACATGAACTTTTACAGAAAAGG + Intergenic
1110314097 13:74085235-74085257 TTCATGAACATATGCAAAAACGG + Intronic
1111842167 13:93463318-93463340 TTCATGGACGTTTGCGAAAATGG + Intronic
1115310771 14:31975695-31975717 TTCATGAACCCTTTGAGCAATGG + Intergenic
1123744713 15:23310906-23310928 CTCTGGAACCTTTGCAGCAAGGG - Intergenic
1124270079 15:28272261-28272283 CTCTGGAACCTTTGCAGCAAGGG + Exonic
1129511766 15:76129130-76129152 TTCATTAAGGTTTGCAAAAATGG - Intronic
1130989431 15:88867213-88867235 TTCATGAAAATTTGAGGCAATGG + Intronic
1131921224 15:97330969-97330991 TTCATGTAGTTTTGCAGCTAAGG + Intergenic
1134517659 16:14900111-14900133 TTCCTGAAAGTTGGCATCAAGGG - Intronic
1134705327 16:16298762-16298784 TTCCTGAAAGTTGGCATCAAGGG - Intergenic
1134962214 16:18413352-18413374 TTCCTGAAAGTTGGCATCAAGGG + Intergenic
1134966511 16:18495951-18495973 TTCCTGAAAGTTGGCATCAAGGG + Intronic
1136075201 16:27812364-27812386 TTGGTGAACGTTTGCTGTAAAGG + Intronic
1136762830 16:32748774-32748796 CTCTGGAACGTTTGCAGCAAGGG - Intergenic
1136805270 16:33121612-33121634 CTCTGGAACGTTTGCAGCAAGGG + Intergenic
1143981947 17:10877690-10877712 TTCTTGAACTTTTGCAGATATGG - Intergenic
1151364675 17:73609532-73609554 TTCATGACATTTTGCTGCAAAGG + Intronic
1151416008 17:73965031-73965053 TCAAAGAACTTTTGCAGCAATGG - Intergenic
1151820677 17:76495099-76495121 TTCATGAACGTTTGCAGCAAAGG - Intronic
1156102183 18:33609725-33609747 TTCATGAGTGTTTGTAACAAAGG - Intronic
1156577815 18:38338928-38338950 TTCATTAACTTTTGCTTCAAAGG - Intergenic
1159755584 18:72360004-72360026 TTCAAAAATATTTGCAGCAAGGG - Intergenic
1160128028 18:76196768-76196790 TTCATAAATGTTTGTAGAAAAGG - Intergenic
1165768605 19:38365584-38365606 TTCATTCACGTTTTCAGAAAGGG + Intronic
930347221 2:50198863-50198885 TTAATGAACTTTTGGAGCACAGG + Intronic
930445698 2:51468990-51469012 TTTCTGAAAGGTTGCAGCAAAGG + Intergenic
930483215 2:51975961-51975983 TCTATGAAAGTTTTCAGCAAAGG - Intergenic
932167917 2:69525083-69525105 TTCAGGAAGCTTTGCAGGAATGG + Exonic
933100141 2:78245116-78245138 TTCATGAATTTTTTCAGGAAAGG + Intergenic
939712137 2:145535754-145535776 ATCATGAAGGTTTTAAGCAAGGG - Intergenic
942154793 2:173116966-173116988 TTCTTGAATGGTGGCAGCAATGG + Intronic
942914201 2:181283412-181283434 TTCATGCACTTTAGGAGCAAAGG + Intergenic
944462057 2:199959809-199959831 TTCATCTATGTTAGCAGCAAGGG - Exonic
945661929 2:212697135-212697157 TTGAAGAACGTTTGCAAAAATGG - Intergenic
946082970 2:217141514-217141536 TTTCTGAATGTTTACAGCAATGG + Intergenic
947433296 2:230049789-230049811 ATAATGCACGTTTGCAGCATAGG + Exonic
1168808492 20:687264-687286 TTCAGGCACGTCTGCAGCCATGG + Intergenic
1170570418 20:17629329-17629351 TCCATGATCGACTGCAGCAAGGG + Intronic
1173362759 20:42359501-42359523 TTCATGAATGTTAACAGCATTGG - Intronic
952357689 3:32599953-32599975 TTCAAGAACTATTCCAGCAAAGG + Intergenic
952552650 3:34496650-34496672 TTCATTAAGGTTGGCAGCAAGGG + Intergenic
961916056 3:130376308-130376330 TTGATGAACGTTTTCACGAATGG - Exonic
962622457 3:137193373-137193395 TTCAGGATCGTGTGCATCAAAGG - Intergenic
964210597 3:154222797-154222819 TTCAGGATAGTTTGCAGAAAGGG + Intronic
966433092 3:179853365-179853387 TTCATCAACGTTAGCAGGAAGGG - Intronic
971480830 4:27113621-27113643 TGCTTGGACCTTTGCAGCAATGG + Intergenic
974310171 4:60196370-60196392 TTAATAAACGTTTGCCACAATGG + Intergenic
976839677 4:89417344-89417366 TTCCTGAAGTTTTGCATCAATGG - Intergenic
988702691 5:33691121-33691143 TTTTTGAACACTTGCAGCAATGG - Intronic
990647709 5:57863265-57863287 ATCATAAACATATGCAGCAACGG + Intergenic
994607144 5:101982533-101982555 TTCATAAAAGTTTCCAGCTATGG - Intergenic
1003741998 6:8951276-8951298 TGCATGAGAGTTTGCAGAAAAGG - Intergenic
1005793106 6:29327733-29327755 TACATAAACTTTTGCAGGAATGG - Intergenic
1006315894 6:33291442-33291464 TTTATACACATTTGCAGCAAGGG + Intronic
1006621984 6:35371771-35371793 TTCATGTACGTCTGCAGCATAGG - Intronic
1014560736 6:122887136-122887158 TTCATGAAAGTTAGCAGGCAGGG + Intergenic
1014758081 6:125324172-125324194 CTCATGAACATTTGCCACAACGG - Intergenic
1016685106 6:146871911-146871933 TTTATGGACTTTGGCAGCAATGG + Intergenic
1020693166 7:11383574-11383596 TTCATGAGTGTTTAGAGCAATGG - Intronic
1023062057 7:36337252-36337274 TTCATAAATTTTTGCAGCAAAGG + Intronic
1024085012 7:45885391-45885413 TTCATGAATGTTCCCAGAAATGG + Intergenic
1024478928 7:49844039-49844061 TTCATGAAGGTTGGCAGCACAGG + Intronic
1026824686 7:73574079-73574101 TGCATGGACTTTAGCAGCAATGG - Exonic
1028932426 7:96428035-96428057 TTCAAGAATGTTTGTAGAAAAGG - Intergenic
1029876193 7:103755069-103755091 TTCAAGAAGGTTAGCTGCAAAGG + Intronic
1031573454 7:123386968-123386990 TTCTTTAAGGTTTGCAGCAATGG + Intergenic
1034774041 7:153807585-153807607 TTCCTGAAAGTTTACAACAAAGG + Intergenic
1035079136 7:156201818-156201840 TTCAGGAACGTTTACACCACAGG - Intergenic
1037783276 8:21885976-21885998 TTCATGAACGTGCTCAACAAGGG + Intergenic
1043665972 8:82814483-82814505 ATCATAAATGTTTGCCGCAATGG - Intergenic
1043827519 8:84947618-84947640 TGCATGAACGTCTGCAACAATGG + Intergenic
1046556049 8:115774815-115774837 ATCATGAACTTTAGGAGCAAAGG + Intronic
1050904911 9:10992134-10992156 TTCATGCATGAATGCAGCAAGGG - Intergenic
1051074018 9:13208506-13208528 TTCAGAAACCTTTGCAGTAAGGG - Intronic
1052022451 9:23540886-23540908 TTCTTGACAGTGTGCAGCAAAGG - Intergenic
1055286843 9:74737962-74737984 TTCATGAACTGTTGTAACAAGGG + Intronic
1056313837 9:85369496-85369518 TTCATGAATATTTTCAGAAATGG - Intergenic
1059799577 9:117736724-117736746 TTCATGAACTTCTGGGGCAAGGG + Intergenic
1062157212 9:135058911-135058933 ATGATAAATGTTTGCAGCAATGG + Intergenic
1186129680 X:6453334-6453356 TTCAGGAACTCCTGCAGCAATGG - Intergenic
1186835713 X:13435792-13435814 TTCATGAACGTTTTAAGGATTGG - Intergenic
1193118967 X:77803442-77803464 TTATTGCACGTTTGCAGAAAAGG - Intergenic
1193780612 X:85697362-85697384 TTCAGGAGCTTTTGCAGGAAAGG + Intergenic
1193996698 X:88374563-88374585 TCCATGAACGTTTGCCGAACTGG - Intergenic
1198460285 X:136856718-136856740 TTCAAGACATTTTGCAGCAAAGG + Intronic
1201953639 Y:19595475-19595497 GTCATGAACCTTTGCAGATAAGG + Intergenic