ID: 1151820684

View in Genome Browser
Species Human (GRCh38)
Location 17:76495139-76495161
Sequence CCCGGCAGCCGGGTTTTCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151820677_1151820684 17 Left 1151820677 17:76495099-76495121 CCTTTGCTGCAAACGTTCATGAA 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG 0: 1
1: 0
2: 0
3: 6
4: 72
1151820676_1151820684 18 Left 1151820676 17:76495098-76495120 CCCTTTGCTGCAAACGTTCATGA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG 0: 1
1: 0
2: 0
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151820684 Original CRISPR CCCGGCAGCCGGGTTTTCAC GGG Intronic