ID: 1151820684

View in Genome Browser
Species Human (GRCh38)
Location 17:76495139-76495161
Sequence CCCGGCAGCCGGGTTTTCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151820676_1151820684 18 Left 1151820676 17:76495098-76495120 CCCTTTGCTGCAAACGTTCATGA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG 0: 1
1: 0
2: 0
3: 6
4: 72
1151820677_1151820684 17 Left 1151820677 17:76495099-76495121 CCTTTGCTGCAAACGTTCATGAA 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG 0: 1
1: 0
2: 0
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151820684 Original CRISPR CCCGGCAGCCGGGTTTTCAC GGG Intronic
901095968 1:6679970-6679992 CACTGCAGCCTGATTTTCACTGG + Intronic
902769326 1:18636625-18636647 CCCCGCAGCCGGGCTCTCCCGGG - Intronic
903876483 1:26477787-26477809 CCCAGCAGCCTGTGTTTCACTGG + Intergenic
905386995 1:37611921-37611943 CCCGGCAGCAGTGTTGTCACAGG - Exonic
908896999 1:68911852-68911874 CCCGGCAGCCGGGGTTTTAAGGG - Intergenic
909384982 1:75044150-75044172 TCCGGCAGCCGACTTTTCAGTGG + Intergenic
916227507 1:162504033-162504055 CCTGGCAGCTGCCTTTTCACTGG + Intronic
924438561 1:244067604-244067626 CAGGGCAGCGGGGTTTTCAAAGG - Intergenic
1080436543 11:32249995-32250017 CCCGGCAGCCCAGTCATCACTGG - Intergenic
1085022901 11:73220124-73220146 CCCTGCAGCCGGGCCTTTACTGG - Intronic
1089303947 11:117515277-117515299 CCCTGTAGCCTGGTTTTCACAGG + Intronic
1094505994 12:31061545-31061567 CCAAGCTGCTGGGTTTTCACTGG - Intergenic
1095983596 12:47985937-47985959 CCCGGCAACCGCGGTTTCCCAGG - Exonic
1099564693 12:84228730-84228752 CCTGGCAGCAGGCTTTTCAGTGG - Intergenic
1122273212 14:100577669-100577691 ACAGGCAGCCGGGCTGTCACTGG - Intronic
1123466053 15:20516827-20516849 TCCTGGAGCAGGGTTTTCACAGG - Intergenic
1123652061 15:22484212-22484234 TCCTGGAGCAGGGTTTTCACAGG + Intergenic
1123742481 15:23293072-23293094 TCCTGGAGCAGGGTTTTCACAGG + Intergenic
1123760844 15:23431414-23431436 TCCTGGAGCAGGGTTTTCACAGG - Intergenic
1124276777 15:28332803-28332825 TCCTGGAGCAGGGTTTTCACAGG - Intergenic
1124305923 15:28578803-28578825 TCCTGGAGCAGGGTTTTCACAGG + Intergenic
1125381605 15:39092459-39092481 GCCTGAAGCCGGGTTCTCACTGG + Intergenic
1134719485 16:16372642-16372664 CCCGGCGGCTGTGTCTTCACAGG + Intergenic
1134947941 16:18339243-18339265 CCCGGCGGCTGTGTCTTCACAGG - Intergenic
1137768548 16:50996437-50996459 CCCAGGAGCTGGGTTTTCGCAGG - Intergenic
1139510749 16:67427222-67427244 CCCGGCAGCCGTGGCTTCGCAGG + Intergenic
1145907321 17:28523619-28523641 GCTGGGAGCCGGGGTTTCACTGG + Intronic
1149480824 17:57001810-57001832 CCCAGCAGCCTAGGTTTCACTGG + Intronic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1154998490 18:21664122-21664144 CCTGGCAGCAGGGGTTTCAATGG - Exonic
1155556953 18:27030595-27030617 CCCGGCAGCCGGCAGTGCACAGG - Intronic
1160428359 18:78793778-78793800 CCTGACAGCCAGGTTTTCAAAGG + Intergenic
1162066929 19:8131534-8131556 CCGGGCAGCCGGATGCTCACCGG + Exonic
1168409840 19:56132854-56132876 TCCGGCAGCAGGTTTTCCACCGG - Intronic
925164367 2:1706260-1706282 ACTGGCAGCCTGGTATTCACTGG + Intronic
928609721 2:32980925-32980947 TCTGGCAGCAGGCTTTTCACTGG - Intronic
930026787 2:47033970-47033992 CACGAAAGCCGGGTTTTCTCCGG - Intronic
930687544 2:54325599-54325621 CCCTGCAGCAGGCTTTTCCCTGG - Intergenic
933339311 2:81002424-81002446 CCTGGCAGCAGAGTTTTCAGTGG - Intergenic
940856288 2:158730876-158730898 CCCAGGAGCCAGGTTGTCACTGG - Intergenic
947820036 2:233063133-233063155 CAGGGCAGCCGGGTTTTCTGCGG + Intronic
1174473177 20:50776541-50776563 GCAGGCAGCCGGGTGTTCCCTGG + Intergenic
1174487508 20:50870663-50870685 ACCGGCAGTCTGCTTTTCACGGG + Intronic
1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG + Exonic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1185259262 22:49852898-49852920 GCCTGCAGCCGGGTTTTCTATGG - Intergenic
950240401 3:11364842-11364864 CCCTGCAGCTGGGATTTCAATGG + Intronic
958840156 3:99193539-99193561 CCCGGCAGCAGACTTTTCAGTGG + Intergenic
963154358 3:142079684-142079706 CCCGGCAGCAGACTTTTCAGTGG + Intronic
964662577 3:159136628-159136650 CCTGACAGCGGGGTTCTCACTGG + Intronic
968299197 3:197600339-197600361 CCCGGCAGCCTGTTTTGTACAGG + Intergenic
987050590 5:14144175-14144197 CCCGGCAGCCGCGGCTTCGCGGG + Intronic
988255116 5:28809963-28809985 CCGGGCAGGCCCGTTTTCACCGG - Intergenic
988796322 5:34656390-34656412 CCCGGCGGCCGCGTTTTCCTGGG + Intronic
990332103 5:54738420-54738442 CCCAGCAGCCTGGTTTTAAGAGG - Intergenic
992098220 5:73381756-73381778 CCCGGCCGCAGGGATTTCGCGGG + Intergenic
997281820 5:132653793-132653815 TCCTGCAGCAGGGTTTTCTCCGG + Intergenic
998498661 5:142613307-142613329 CCTGGCAGCCCGGTTCTCAGAGG - Intronic
999325661 5:150641809-150641831 CTAGGCAGCTGGGTTTTCAGGGG + Intronic
999714862 5:154352498-154352520 CCCAGCTGCAGGGTTTTCATGGG - Intronic
1000334168 5:160229549-160229571 CCCAGCAGCATGGCTTTCACCGG + Exonic
1005642606 6:27810760-27810782 CTCCGCAGCCCGGTTTTGACCGG + Exonic
1014542229 6:122691033-122691055 TCTGGCAGCAGGGTTTTCAGTGG - Intronic
1015625877 6:135181012-135181034 CCCGGGAGCGGGGTTTGCTCAGG + Intergenic
1017720664 6:157241044-157241066 CCAGGCAGCCAGGTTTCCAAGGG + Intergenic
1019190494 6:170247995-170248017 ACCGGCATCTTGGTTTTCACCGG - Intergenic
1029253347 7:99252342-99252364 CCCGCCAGCCCTGTTTTCCCAGG - Intergenic
1040306039 8:46212329-46212351 CCCTGCGGCCCTGTTTTCACTGG - Intergenic
1040306765 8:46216014-46216036 CCCTGCTGCCCTGTTTTCACTGG - Intergenic
1040333241 8:46403065-46403087 CCCAGGAGCCCCGTTTTCACTGG - Intergenic
1046770495 8:118112158-118112180 CCCGGCCGCCGCGTTTCCGCAGG - Intergenic
1049207173 8:141369017-141369039 CCTGGCAGGCAGGGTTTCACCGG + Intergenic
1057079671 9:92163488-92163510 CCCGGCATGCAGGTTTTCAGAGG - Intergenic
1057197022 9:93120984-93121006 CCCGGGAGCCAGGTTTCCACTGG + Intergenic
1186459837 X:9739543-9739565 CCCGGAAGCAGGGTTTTCATGGG + Exonic
1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG + Intergenic
1192083542 X:68071427-68071449 CCCAGCAGCTGGGTTGGCACAGG + Intronic
1193149900 X:78114063-78114085 CCCAGCAGCTGGGTTGGCACAGG - Exonic
1200059480 X:153477896-153477918 CCTGGCAACTGGGTCTTCACTGG - Intronic