ID: 1151822019

View in Genome Browser
Species Human (GRCh38)
Location 17:76501579-76501601
Sequence ACCCAGCTGGGTCCCCGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151822010_1151822019 -7 Left 1151822010 17:76501563-76501585 CCTGCCTCCGCCCTCCACCCAGC 0: 1
1: 0
2: 13
3: 150
4: 1906
Right 1151822019 17:76501579-76501601 ACCCAGCTGGGTCCCCGCCTGGG 0: 1
1: 0
2: 2
3: 14
4: 173
1151822009_1151822019 1 Left 1151822009 17:76501555-76501577 CCTGGGTTCCTGCCTCCGCCCTC 0: 1
1: 0
2: 7
3: 71
4: 609
Right 1151822019 17:76501579-76501601 ACCCAGCTGGGTCCCCGCCTGGG 0: 1
1: 0
2: 2
3: 14
4: 173
1151822005_1151822019 30 Left 1151822005 17:76501526-76501548 CCTGGACGCAGTCTTTGCTCAGT 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1151822019 17:76501579-76501601 ACCCAGCTGGGTCCCCGCCTGGG 0: 1
1: 0
2: 2
3: 14
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151822019 Original CRISPR ACCCAGCTGGGTCCCCGCCT GGG Intronic
900637926 1:3674910-3674932 ACCCAGAAGAGCCCCCGCCTGGG - Intronic
902447606 1:16476924-16476946 ACCCACCTTGGTCAGCGCCTCGG + Intergenic
902467505 1:16627139-16627161 ACCCACCTTGGTCAGCGCCTCGG + Intergenic
902507076 1:16945590-16945612 ACCCACCTTGGTCAGCGCCTCGG - Exonic
902757133 1:18556300-18556322 ACAGAGATGGGTCCCTGCCTTGG - Intergenic
905120677 1:35679475-35679497 ACGCAGCTGGGTCCCCACTTGGG + Intergenic
905404965 1:37726449-37726471 GCCCAGATGGGTCCCAGGCTGGG - Intronic
913519455 1:119631594-119631616 GCCCCGCTTGGGCCCCGCCTGGG + Intronic
916792531 1:168136772-168136794 GCCCAGCCGCCTCCCCGCCTCGG + Intronic
917516645 1:175714146-175714168 GCCCACCTGGGTGCCCTCCTTGG + Intronic
917966430 1:180182102-180182124 ACCGAGCTGGGACCCAGCCCTGG + Intronic
919088510 1:192950028-192950050 TCACAGCTGAGTCCCTGCCTAGG + Intergenic
920665406 1:207959509-207959531 CCGCAGCTGGGTCTGCGCCTGGG + Intergenic
921528390 1:216246979-216247001 ACACAGCTGGATCCCTCCCTGGG - Exonic
922326111 1:224529957-224529979 ACCAAGCTGGCTCCCCTCCATGG - Intronic
923137070 1:231128581-231128603 GCCCAGCTGCGACCCCGTCTGGG + Intergenic
1064048570 10:12041926-12041948 AGCCAGCTGGGTCCACGCTGGGG - Intronic
1064221169 10:13441496-13441518 CCCAAGCTGTGGCCCCGCCTTGG + Intronic
1066360279 10:34723671-34723693 CCACAGCTTGTTCCCCGCCTAGG + Intronic
1066653814 10:37681718-37681740 ACCCAGTAGGGTCCACGGCTGGG + Intergenic
1066984676 10:42454519-42454541 CCCCAGCTGGGGCCATGCCTGGG - Intergenic
1067052347 10:43029147-43029169 ACCCAGCAGGGCCTCCGCCCGGG + Intergenic
1067806187 10:49395184-49395206 TCCCAGCTCCCTCCCCGCCTGGG - Intronic
1075638146 10:124044423-124044445 ACCCTGCTGGGTCTTTGCCTGGG + Intronic
1076729463 10:132431187-132431209 GCCCAGCTGGGTCCAGTCCTGGG - Intergenic
1076761404 10:132607733-132607755 ACAGAGCGGGGTCCCCGCGTGGG + Intronic
1082803839 11:57433926-57433948 ACCCAGATGGCTCCCTGCCTTGG - Intergenic
1083635670 11:64119645-64119667 ACTCAGCTGGGCCCACCCCTGGG + Intronic
1086122636 11:83317112-83317134 ACCCGGCTGCGACCCCGTCTGGG - Intergenic
1086446883 11:86879264-86879286 ACCCAGCTGCGACCCCGTCTGGG + Intronic
1091221420 11:133931851-133931873 GCCCAGCTGGGACCCAGCCTGGG - Intronic
1091718510 12:2795831-2795853 ACCTCGCTGGGTCCCGGCGTCGG - Intronic
1101581565 12:106046732-106046754 ACCCACCTGGGACTCTGCCTGGG - Intergenic
1102255022 12:111410162-111410184 TCCCAGCTGGGGCCCCCCATTGG - Intronic
1103940590 12:124499398-124499420 ACCCAGCGGGGTCCAGGCCCTGG + Intronic
1104464469 12:128979306-128979328 GCCCAGGTGGGTCCTCGGCTTGG + Intronic
1105717838 13:23084908-23084930 ACTCACCTGGCTTCCCGCCTGGG - Intergenic
1105804827 13:23946766-23946788 CCCCAGGTGGGTCCCATCCTGGG - Intergenic
1106995438 13:35475540-35475562 ACCCGGTTGGGTCCCGGCCAGGG + Exonic
1114354725 14:21894748-21894770 GCCAAGCTGGGTCACCGACTGGG - Intergenic
1114374794 14:22132746-22132768 ATCAAGCTGGGTCACCGACTGGG - Intergenic
1114668220 14:24393967-24393989 ACACTGCTGGGTCCCCTCCCAGG + Intergenic
1114991558 14:28295800-28295822 ACCAAGCAGGGGCCCCGGCTGGG - Intergenic
1121829053 14:97033979-97034001 ACCCAGCTGGGGCTGGGCCTAGG - Intergenic
1122234593 14:100324546-100324568 CCCCAGCTAGGTGCCAGCCTGGG + Intronic
1122657772 14:103273664-103273686 GCGCAGCTGGGTCCCCGCCAGGG - Intergenic
1122917416 14:104865456-104865478 CCCCGGCTTGGTCCCCGGCTTGG - Exonic
1122942051 14:104985862-104985884 ACCCACCTTGGTCGCCGCCTCGG - Exonic
1124345681 15:28919972-28919994 ACCCAGCAGAGGCCCCTCCTCGG + Intronic
1124500723 15:30225010-30225032 GCCGAGCTGGGTCAGCGCCTGGG + Intergenic
1124742846 15:32313657-32313679 GCCGAGCTGGGTCGGCGCCTGGG - Intergenic
1125970668 15:43908754-43908776 ACCCAGCTGAGGCCCAGACTGGG - Intronic
1126580416 15:50237655-50237677 ACCCAGCTGCCTCCCTTCCTGGG + Intergenic
1128088006 15:64899006-64899028 GCCCAACTGGGCCCCTGCCTGGG + Intronic
1128548028 15:68580308-68580330 GCCCAGCTGGGTCCCAGAATTGG + Intronic
1129313739 15:74728913-74728935 ACCCAGCCGCGACCCCGTCTGGG + Intergenic
1132590910 16:726109-726131 CCCCAGGTGGGTCCCAGGCTGGG + Intronic
1132651226 16:1022225-1022247 AGCCAGGTGGGGCCCCTCCTGGG + Intergenic
1134035929 16:11031453-11031475 ACTCACCTGTGTTCCCGCCTGGG + Intronic
1136995894 16:35187908-35187930 ACCCAGCTGGGCTTCCCCCTGGG + Intergenic
1137237751 16:46629298-46629320 ACCCCGATGGGACCCCTCCTAGG - Intergenic
1139473799 16:67192427-67192449 ACCCAGCTGGGCCGCCCCCGGGG - Intronic
1141169973 16:81684972-81684994 GGCCAGCAGAGTCCCCGCCTCGG - Intronic
1141959121 16:87392639-87392661 TCCCGGCTCGGTCCCGGCCTGGG - Intronic
1143487202 17:7261573-7261595 ACCCAGCCTCGTCCCCGGCTCGG - Intronic
1143732800 17:8890536-8890558 AACCAGCTGGGTGGCAGCCTGGG - Intronic
1144720014 17:17462633-17462655 CCCCAGCTGGGCCCCAGCCATGG - Intergenic
1144794186 17:17880027-17880049 ACCAAGCTGGCTCTCCGTCTCGG + Intronic
1144968693 17:19093740-19093762 GCCCAGAGGGGTCCCTGCCTGGG - Exonic
1144979221 17:19158326-19158348 GCCCAGAGGGGTCCCTGCCTGGG + Exonic
1144989001 17:19219906-19219928 GCCCAGAGGGGTCCCTGCCTGGG - Exonic
1145995456 17:29102421-29102443 TGCCAGCTGGGCCCCTGCCTAGG - Intronic
1146057609 17:29589185-29589207 TCCAGGCTGGGCCCCCGCCTCGG - Intronic
1146790021 17:35745844-35745866 ACCTGGCTGGGTCCACGCATGGG - Exonic
1147661270 17:42118296-42118318 ACACAGCTGGTTCCCCGGCCAGG - Exonic
1147722985 17:42550117-42550139 ACCCAGCTGAATCCCTGCCTCGG - Exonic
1147724197 17:42556344-42556366 ACCCAGCTGAATCCCTGCCTCGG - Intergenic
1147748330 17:42709994-42710016 GCCCAGCTGGGTGCTGGCCTTGG + Intronic
1148862043 17:50609546-50609568 GCCCAGCTGGCTCCCCTTCTGGG + Intronic
1149793635 17:59500288-59500310 GCCCAGCTGCGACCCCGTCTGGG + Intergenic
1151822019 17:76501579-76501601 ACCCAGCTGGGTCCCCGCCTGGG + Intronic
1152146061 17:78569681-78569703 ACCGAGCTGCTTCCCCTCCTCGG + Intronic
1152165713 17:78703944-78703966 ACCCAGCAGTGTCCACCCCTGGG - Intronic
1152392025 17:80008943-80008965 ACCCAGCTGGGTCTGCCCCAGGG - Intronic
1152699924 17:81813690-81813712 ACCCTGCTGGGACCCCAGCTAGG + Exonic
1152814554 17:82399778-82399800 ACCCAGCTGGGGCCACGCCCTGG + Intronic
1155220647 18:23682469-23682491 ACCCAGCTATGTGCCTGCCTGGG - Intergenic
1160385835 18:78495715-78495737 CCCCAGCCGGGCGCCCGCCTGGG - Intergenic
1160675323 19:388028-388050 ACACAGCAGGGTCTCAGCCTCGG + Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1162135402 19:8552116-8552138 CCCCATCTGGCTCCCCACCTCGG + Exonic
1163675147 19:18651987-18652009 GCCCAGCTGGGTCCCCATCCAGG - Intronic
1165861655 19:38912216-38912238 CCCCTGCAGGGTCCCCGCGTGGG - Intergenic
1165939473 19:39407947-39407969 GCACCGCTGGCTCCCCGCCTGGG + Exonic
925287897 2:2727662-2727684 CCCCTGCTGGGTCCCCGCCTTGG - Intergenic
929721420 2:44372406-44372428 ACCCAGCTGGGTGACAGGCTGGG + Intronic
931584226 2:63809023-63809045 ACCCGGCCGGGACCCCGTCTGGG + Intronic
936055415 2:109258595-109258617 AGCCAGCTGTGGCCCGGCCTGGG - Intronic
936531242 2:113278237-113278259 CCCCAGCTGGGTCCCCACGCGGG + Intronic
937335261 2:121058589-121058611 ACCCAGATCGGTCCCAGCCCGGG - Intergenic
937694935 2:124798340-124798362 ACCCAGCGGAGTCTCAGCCTGGG + Intronic
940906189 2:159171935-159171957 ACCCAACTGGTTCCCCTCCCTGG - Intronic
940913210 2:159227122-159227144 ACCCAGCAGGGTTCCTGGCTTGG + Intronic
947741641 2:232487497-232487519 AGCCAGCTCGCTCCCCGCCGGGG - Intronic
948576117 2:238950686-238950708 ACCCAGCAGGGTCCAGGCTTCGG - Intergenic
948624757 2:239262024-239262046 ACCCTGCTGGATTCCCACCTAGG - Intronic
948802482 2:240439209-240439231 ACCCGGCTGGCTCCCGGCCCAGG + Intronic
1172096112 20:32461250-32461272 CCCCAGCTGTGACCCAGCCTTGG + Intronic
1172258112 20:33536689-33536711 ACCCGGCTGCGACCCCGTCTGGG - Intronic
1172271346 20:33657350-33657372 ACCCAGCTCAGGCCCAGCCTCGG + Exonic
1172482264 20:35277974-35277996 ACCCCGCTAGGGCCCCGCCCCGG + Intergenic
1173805808 20:45924601-45924623 ACCCAGCTGGGACCCAGGCTGGG + Intergenic
1175931649 20:62496473-62496495 ACCCAGCAGGGTCCGGGGCTCGG - Intergenic
1176030011 20:63007240-63007262 TCCCAGGTGGGCACCCGCCTCGG + Intergenic
1176169561 20:63690753-63690775 CCCCAGCTGGGGCCCCCCGTGGG + Intronic
1178314577 21:31558144-31558166 ACCCGGCTGGGGACCCGCGTGGG - Intronic
1178551503 21:33543271-33543293 GCCCCGCTAGGGCCCCGCCTGGG + Intronic
1179922450 21:44514440-44514462 TCACAGCTGGGCCCCCGACTTGG - Intronic
1179953350 21:44724009-44724031 ACCCCGCTGGGGCCCGCCCTGGG + Intergenic
1180859056 22:19066689-19066711 AGCCAGCTGGCTCCCATCCTGGG - Intronic
1181165557 22:20981162-20981184 AGCCACCTGGCTCCCCTCCTGGG + Exonic
1183032726 22:35117683-35117705 ACCCAGCTGGTACCCCGGGTGGG + Intergenic
1183211705 22:36455291-36455313 ACCCAGCTGGCTCCGCACCGAGG + Intergenic
1184692294 22:46122842-46122864 ACCCAGCTCTGTGCCCGCCCGGG - Intergenic
949744069 3:7268205-7268227 ACCCAGCTGTGTCTCCCCTTTGG - Intronic
950410804 3:12835469-12835491 CACCAGTTAGGTCCCCGCCTTGG + Exonic
950641869 3:14353666-14353688 TCCCAGCAGGGCCCCCGCCTGGG + Intergenic
964066017 3:152580554-152580576 ACCTTGCTGGGTCCCCTTCTAGG - Intergenic
967131354 3:186473586-186473608 ACCCAGGTGGGTCTCCACCAAGG + Intergenic
968765041 4:2463685-2463707 ATCCATCTTGGTCCCTGCCTTGG - Intronic
969183660 4:5460262-5460284 CCTCTGCAGGGTCCCCGCCTTGG + Intronic
969322391 4:6420515-6420537 CCCCAGCTATGTCCCTGCCTTGG + Intronic
972497981 4:39651707-39651729 TCCCAGCAGGCTCCCTGCCTTGG - Intergenic
974016811 4:56655851-56655873 ACGCACCTGGGTCTCCTCCTCGG + Exonic
975485254 4:74928276-74928298 AGCCAGCTGGGTCCATACCTTGG - Intergenic
979622348 4:122811873-122811895 GCCCAGCTGCGACCCCGTCTGGG + Intergenic
983218161 4:165020222-165020244 ACCCGGCTGCGACCCCGTCTGGG - Intergenic
985064206 4:186105201-186105223 ACCCAACGGGGTGCCCGCCCTGG - Intronic
985791538 5:1930986-1931008 ACCCCTCCAGGTCCCCGCCTCGG + Intergenic
985925397 5:3012164-3012186 ACTCAGCTGGGTCCTCTGCTTGG + Intergenic
991723689 5:69515811-69515833 ACCCAGCCGCGACCCCGTCTGGG - Intronic
992527912 5:77629992-77630014 ACCCAGCTGCGCCCTCGGCTCGG - Exonic
998395031 5:141812704-141812726 ACCCACCTGGAACCCTGCCTTGG - Intergenic
1001268759 5:170295093-170295115 TACCAGCTGGGACCCCACCTGGG + Intronic
1001757113 5:174179136-174179158 TCCCACCTGGGACCCTGCCTAGG + Intronic
1005922529 6:30415148-30415170 GCCCAGCTGGGACCCCTCCCTGG - Intergenic
1013681355 6:112528561-112528583 ACCCGGCTGCGACCCCGTCTGGG - Intergenic
1016863990 6:148747872-148747894 ACCCAGCGGCGCCCCCGCCTCGG - Intronic
1019262444 7:88973-88995 ACCCAGCAGGCTCCTCTCCTAGG + Intergenic
1019522768 7:1468129-1468151 TCCCAGCTGGGTGCAAGCCTGGG - Intergenic
1020978804 7:15042082-15042104 ACCCTGCTGGGTCACAGGCTTGG - Intergenic
1021969448 7:25951643-25951665 ACCCAGCCGGAGCCCTGCCTGGG + Intergenic
1023096831 7:36669960-36669982 ACCCAGCTGTGTCACTGGCTGGG + Intronic
1023984039 7:45085129-45085151 CCCCAGCCAGGTCCCCACCTGGG + Exonic
1024081477 7:45859566-45859588 GCTCAGCTGGGTCTCTGCCTGGG - Intergenic
1024262154 7:47581289-47581311 ACACAGCTGGCCCCCAGCCTGGG + Intronic
1028622213 7:92836714-92836736 CCCCAGCTGCCTCCCCGGCTGGG - Intergenic
1029080767 7:97972254-97972276 TCCCGGCCGGGTCCCCACCTCGG + Intergenic
1029273991 7:99393441-99393463 CCCCAGCTGTGACCCCGCCCAGG - Intronic
1034982668 7:155488754-155488776 GCCCAGCTGAGTCCAGGCCTGGG - Intronic
1042168633 8:65971423-65971445 ACACAGCTGTCTCCCAGCCTTGG - Intergenic
1043916443 8:85927965-85927987 ACCCACTTGGGTCCCCTTCTAGG + Intergenic
1043958576 8:86390049-86390071 GCCCAGCTGCGACCCCGTCTGGG - Intronic
1048469954 8:134696761-134696783 ACCCAGCAGGGGTCCCTCCTAGG + Intronic
1048973128 8:139656292-139656314 ATCCAGCTGGGGCTCAGCCTGGG + Intronic
1049205583 8:141362006-141362028 ACCCAGCGGCAGCCCCGCCTAGG - Intronic
1049595611 8:143481941-143481963 AGCCAGCTGGGTCTCCGCCCTGG + Intronic
1049741920 8:144245014-144245036 ACCACTCTGGGTCCCCGGCTTGG + Intronic
1049821544 8:144636698-144636720 ACCAAGGTGGTTCCCAGCCTTGG + Intergenic
1049843398 8:144788166-144788188 GCCCTGCTGGGTCACTGCCTAGG + Intergenic
1049956656 9:699162-699184 ACACAGCAGGGACCCTGCCTAGG - Intronic
1055559982 9:77513100-77513122 AGCCAGCTGGATCCCAGCCAGGG + Intronic
1056564434 9:87759214-87759236 GCCCAGCTGCGACCCCGTCTGGG - Intergenic
1058425014 9:104868803-104868825 TCCCAGCTGGTTCCCCGGCTTGG - Intronic
1059635359 9:116164998-116165020 ACCCAGCTTGGTCACTGACTTGG - Intronic
1060827990 9:126697249-126697271 ACCCAGTTGTATCCCAGCCTGGG + Exonic
1060832088 9:126723110-126723132 GGCCAGCTCGGCCCCCGCCTGGG - Intergenic
1061189764 9:129075532-129075554 AGCCAGCTGGGTGCCACCCTCGG - Intergenic
1061324894 9:129857762-129857784 CCCCAGCTGGGACCCCGCCTGGG + Intronic
1061449786 9:130661722-130661744 ACCCACCTGGACCCCCGCCCGGG - Intergenic
1061875005 9:133539267-133539289 ACTAAGCTGGGTCCCCTCCGAGG + Intronic
1061998985 9:134206578-134206600 AGCCAGCTGTGTCCCTGCTTTGG - Intergenic
1062093039 9:134688569-134688591 ACCCAGCTCTGTCACCCCCTCGG - Intronic
1203793932 EBV:166147-166169 ACCCATCCGGATCCCCGCCGGGG - Intergenic
1187266751 X:17740797-17740819 ACCCTGTTGTGTCTCCGCCTAGG - Intronic
1193345287 X:80397244-80397266 GCCCAGCTGCGACCCCGTCTGGG - Intronic
1195949506 X:110253059-110253081 ACCAAGCATGGTCCCCGCCAGGG - Intronic
1196182239 X:112704579-112704601 ACCCAGCTGGCACCCCCCCATGG - Intergenic
1197728842 X:129793851-129793873 TTGCAGCTGGGTCCCAGCCTTGG - Exonic
1200248931 X:154541975-154541997 AACCAGCTGGGCCCCTGCCAAGG - Intronic