ID: 1151825484

View in Genome Browser
Species Human (GRCh38)
Location 17:76521649-76521671
Sequence GGCACCAGGGCACTCCAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151825484_1151825490 9 Left 1151825484 17:76521649-76521671 CCAAGTTGGAGTGCCCTGGTGCC No data
Right 1151825490 17:76521681-76521703 CACTGCAACCTCTGTCTCCTGGG 0: 1648
1: 33361
2: 107204
3: 169234
4: 198649
1151825484_1151825489 8 Left 1151825484 17:76521649-76521671 CCAAGTTGGAGTGCCCTGGTGCC No data
Right 1151825489 17:76521680-76521702 TCACTGCAACCTCTGTCTCCTGG 0: 2626
1: 54415
2: 106169
3: 144727
4: 111872

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151825484 Original CRISPR GGCACCAGGGCACTCCAACT TGG (reversed) Intergenic
No off target data available for this crispr