ID: 1151825712

View in Genome Browser
Species Human (GRCh38)
Location 17:76523146-76523168
Sequence CGCGCTGCAGCCTGAGACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151825712_1151825714 -1 Left 1151825712 17:76523146-76523168 CCTCGGTCTCAGGCTGCAGCGCG No data
Right 1151825714 17:76523168-76523190 GGCTGCAGCTCCCGAAAGTGAGG No data
1151825712_1151825722 29 Left 1151825712 17:76523146-76523168 CCTCGGTCTCAGGCTGCAGCGCG No data
Right 1151825722 17:76523198-76523220 TGGTCACCCCAGGAGGGTAATGG No data
1151825712_1151825721 23 Left 1151825712 17:76523146-76523168 CCTCGGTCTCAGGCTGCAGCGCG No data
Right 1151825721 17:76523192-76523214 AGCAAGTGGTCACCCCAGGAGGG No data
1151825712_1151825719 19 Left 1151825712 17:76523146-76523168 CCTCGGTCTCAGGCTGCAGCGCG No data
Right 1151825719 17:76523188-76523210 AGGGAGCAAGTGGTCACCCCAGG No data
1151825712_1151825715 0 Left 1151825712 17:76523146-76523168 CCTCGGTCTCAGGCTGCAGCGCG No data
Right 1151825715 17:76523169-76523191 GCTGCAGCTCCCGAAAGTGAGGG No data
1151825712_1151825720 22 Left 1151825712 17:76523146-76523168 CCTCGGTCTCAGGCTGCAGCGCG No data
Right 1151825720 17:76523191-76523213 GAGCAAGTGGTCACCCCAGGAGG No data
1151825712_1151825717 9 Left 1151825712 17:76523146-76523168 CCTCGGTCTCAGGCTGCAGCGCG No data
Right 1151825717 17:76523178-76523200 CCCGAAAGTGAGGGAGCAAGTGG No data
1151825712_1151825723 30 Left 1151825712 17:76523146-76523168 CCTCGGTCTCAGGCTGCAGCGCG No data
Right 1151825723 17:76523199-76523221 GGTCACCCCAGGAGGGTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151825712 Original CRISPR CGCGCTGCAGCCTGAGACCG AGG (reversed) Intergenic