ID: 1151826530

View in Genome Browser
Species Human (GRCh38)
Location 17:76527150-76527172
Sequence GGCGCCCTTGGTAGTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 4, 2: 0, 3: 1, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151826522_1151826530 2 Left 1151826522 17:76527125-76527147 CCCTTGGTAGTGGGACAGGGGAT No data
Right 1151826530 17:76527150-76527172 GGCGCCCTTGGTAGTGGGACAGG 0: 1
1: 4
2: 0
3: 1
4: 75
1151826512_1151826530 29 Left 1151826512 17:76527098-76527120 CCTTGGTGTGGGAGAGGGGATGG No data
Right 1151826530 17:76527150-76527172 GGCGCCCTTGGTAGTGGGACAGG 0: 1
1: 4
2: 0
3: 1
4: 75
1151826511_1151826530 30 Left 1151826511 17:76527097-76527119 CCCTTGGTGTGGGAGAGGGGATG No data
Right 1151826530 17:76527150-76527172 GGCGCCCTTGGTAGTGGGACAGG 0: 1
1: 4
2: 0
3: 1
4: 75
1151826523_1151826530 1 Left 1151826523 17:76527126-76527148 CCTTGGTAGTGGGACAGGGGATG No data
Right 1151826530 17:76527150-76527172 GGCGCCCTTGGTAGTGGGACAGG 0: 1
1: 4
2: 0
3: 1
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151826530 Original CRISPR GGCGCCCTTGGTAGTGGGAC AGG Intergenic