ID: 1151826530

View in Genome Browser
Species Human (GRCh38)
Location 17:76527150-76527172
Sequence GGCGCCCTTGGTAGTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 4, 2: 0, 3: 1, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151826512_1151826530 29 Left 1151826512 17:76527098-76527120 CCTTGGTGTGGGAGAGGGGATGG No data
Right 1151826530 17:76527150-76527172 GGCGCCCTTGGTAGTGGGACAGG 0: 1
1: 4
2: 0
3: 1
4: 75
1151826523_1151826530 1 Left 1151826523 17:76527126-76527148 CCTTGGTAGTGGGACAGGGGATG No data
Right 1151826530 17:76527150-76527172 GGCGCCCTTGGTAGTGGGACAGG 0: 1
1: 4
2: 0
3: 1
4: 75
1151826522_1151826530 2 Left 1151826522 17:76527125-76527147 CCCTTGGTAGTGGGACAGGGGAT No data
Right 1151826530 17:76527150-76527172 GGCGCCCTTGGTAGTGGGACAGG 0: 1
1: 4
2: 0
3: 1
4: 75
1151826511_1151826530 30 Left 1151826511 17:76527097-76527119 CCCTTGGTGTGGGAGAGGGGATG No data
Right 1151826530 17:76527150-76527172 GGCGCCCTTGGTAGTGGGACAGG 0: 1
1: 4
2: 0
3: 1
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151826530 Original CRISPR GGCGCCCTTGGTAGTGGGAC AGG Intergenic
903138086 1:21322342-21322364 GGTGCCCATGGTTGTGGGAATGG - Intronic
903879755 1:26500741-26500763 GGCGCACTTGGGAGCTGGACAGG - Intergenic
904255958 1:29255082-29255104 GGGGACCTTGGTAGAGGGAGAGG + Intronic
907714913 1:56917455-56917477 GGCACCCTTGGGAGAGGAACTGG - Intronic
912302640 1:108533892-108533914 GGCGGCCTTTGTGGTGGGGCTGG + Intergenic
913301272 1:117371905-117371927 TGCTCCCTTGGGAGGGGGACGGG + Intronic
917110504 1:171542666-171542688 GGTGTCCTTGGTAGTAGAACAGG - Intronic
1070408570 10:76118315-76118337 GGAGCCCTTGGGAGTGGGTTGGG + Intronic
1071572004 10:86702392-86702414 GTGGCCCTTGGTGGTGGGAATGG - Intronic
1076551280 10:131279564-131279586 GGCGCCTTGGATGGTGGGACAGG - Intronic
1081648266 11:44805064-44805086 GGCTACCTTGTTAGTGGGAGGGG + Intronic
1084181367 11:67448220-67448242 GGGGTCCTTGGACGTGGGACTGG + Intergenic
1089282854 11:117386615-117386637 GGCCCCCTTGGTGGTGTGATAGG + Intronic
1089345745 11:117790343-117790365 GGCCCCAGTGGTAGTGGGAGTGG - Intronic
1096749743 12:53751334-53751356 GGCTCCTTTGGCAGTGGGAAGGG + Intergenic
1097153184 12:56994547-56994569 GGGGCCCTTGGCTGTGGGGCTGG - Exonic
1102595834 12:113991986-113992008 GGCACTCTTGGGAGTGGGTCAGG + Intergenic
1105865993 13:24460361-24460383 GGCCCCCTTGGCAGCGGAACTGG + Intronic
1110832821 13:80051314-80051336 TGGGCCCTTGGTCATGGGACTGG - Intergenic
1115441433 14:33440388-33440410 AGCACCCTTGGTCGGGGGACAGG - Intronic
1121895883 14:97647190-97647212 GGGGACCTAGGTATTGGGACAGG - Intergenic
1124646929 15:31443835-31443857 TGTGCCCTTGGCAATGGGACGGG - Intergenic
1128779263 15:70347914-70347936 GGGGACCTGGGTGGTGGGACAGG + Intergenic
1132618832 16:854969-854991 GGCCCACTTGGCAGAGGGACCGG + Intronic
1132623321 16:878622-878644 GGCGCCCATGGTTGTTGGCCGGG - Intronic
1134016295 16:10890819-10890841 GGAGCCCTTAGCAATGGGACTGG - Intronic
1135592053 16:23711932-23711954 GGTGCCCTTGGGAGGGGGGCTGG + Intronic
1140124876 16:72110808-72110830 GGCGGCTTTGGTACTGGGGCAGG + Intronic
1141699779 16:85636986-85637008 GGCGGACTTGGCAGTGGGAGGGG + Intronic
1141987422 16:87589032-87589054 GGAGCCCTTCGCAGTGGGGCTGG - Intergenic
1145056003 17:19704387-19704409 GGCGCAGGTGGTGGTGGGACTGG - Intronic
1147670576 17:42174662-42174684 GGCCCCCTTGGGTGTGGGGCGGG - Intronic
1148091572 17:45025389-45025411 GTCCCCCTTAGTTGTGGGACAGG + Intronic
1148394681 17:47298664-47298686 GGCTGCTTTGTTAGTGGGACGGG + Intronic
1149182079 17:53951237-53951259 GGAACCCTGGGAAGTGGGACTGG - Intergenic
1151826454 17:76526950-76526972 GGTGCCCTTGGTAGTGGGACAGG + Intergenic
1151826486 17:76527035-76527057 GGTGCCCTTGGTAGTGGGACAGG + Intergenic
1151826497 17:76527064-76527086 GGTGCCCTTGGTAGTGGGACAGG + Intergenic
1151826519 17:76527121-76527143 GGTGCCCTTGGTAGTGGGACAGG + Intergenic
1151826530 17:76527150-76527172 GGCGCCCTTGGTAGTGGGACAGG + Intergenic
1152409553 17:80116559-80116581 GTTGCCTTTGGTTGTGGGACTGG + Intergenic
1152543357 17:80988242-80988264 GGCTCCCTTGCCAGTGGGAGTGG + Intergenic
1162079776 19:8210894-8210916 GGCGGCCTTGGTCGTTGAACTGG + Intronic
1163506285 19:17708986-17709008 GGTGCCCTGGGTAGAGGAACTGG - Intergenic
1164146903 19:22518021-22518043 TGCGGCCTTGGCAGTGGGCCCGG + Intronic
1167520474 19:49951686-49951708 GGGGCCCTTGGTTCTGGGAGGGG + Intronic
926731635 2:16039925-16039947 GGCGCCAGTGGTATTGAGACAGG - Intergenic
937891558 2:126942994-126943016 TGCACCCCTGGTGGTGGGACGGG + Intergenic
948386785 2:237585606-237585628 GGCGGCCTGGGTGGTGGGAGAGG + Intronic
948411011 2:237760754-237760776 GGCGGCCGTGGTAGTGGGTGTGG + Intronic
1168971607 20:1935087-1935109 GGCGCTCCTGGTAGAGGGATGGG - Intronic
1172846892 20:37934931-37934953 TGCGCCCTTGGCAGAGGGTCGGG - Intronic
1178951495 21:36989799-36989821 GGGGCCCGTGGGAGGGGGACAGG + Intronic
1180022689 21:45138685-45138707 GGCACCCTTGGTAGAGGGGTAGG + Intronic
1182008523 22:26981313-26981335 GCCGTCCTTGGAAGTGGGAGAGG - Intergenic
1184075259 22:42172917-42172939 GGGGCTCTTGGCACTGGGACTGG + Intronic
1184670154 22:46008025-46008047 GGAGCCCCTGGGAGTGGGAGTGG + Intergenic
1184770576 22:46594525-46594547 GGGGCCCTTGGTAGAGGAAGGGG + Intronic
1185394135 22:50578232-50578254 GGCGCCCCTGGAAGTGGAGCCGG + Intronic
949168415 3:968550-968572 GGCTCCCTTAGAAGTGGAACTGG - Intergenic
950430404 3:12947651-12947673 TGGGCCCCTGGTGGTGGGACAGG + Intronic
954793784 3:53151058-53151080 GGTGCCCTTGGTGCTGGGCCGGG - Intergenic
969322346 4:6420267-6420289 GGAGACATTGGCAGTGGGACTGG - Intronic
973097257 4:46217818-46217840 GGGGCCCTCAGTAGTGGGATTGG - Intergenic
977377524 4:96225157-96225179 GGTGACATTGGTAGTGGGGCTGG + Intergenic
985782400 5:1878140-1878162 GGCGCCCTTGGCGGTGGCCCAGG + Exonic
989170962 5:38469941-38469963 GGAGCCCTTGGGAGTGGGTTGGG + Intergenic
997724217 5:136106666-136106688 GGAGCCCCTGGTTGTGGGCCTGG - Intergenic
999386470 5:151157440-151157462 GGCGCCCTGGCTAGGGGGAGGGG - Intronic
1014159730 6:118154117-118154139 GGTGCCAATGGTAGTGGGAAGGG - Intronic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1029253167 7:99251210-99251232 GGCCCCCTGGCTGGTGGGACAGG + Intergenic
1030304315 7:108003279-108003301 GGCGCCCCGGGGGGTGGGACCGG - Intergenic
1031899215 7:127392029-127392051 GGCGCACTTGGTTGTGGGGACGG - Intronic
1035675957 8:1455642-1455664 CGTGCCCCTGGCAGTGGGACTGG - Intergenic
1047570460 8:126093477-126093499 ACCGCCCTTGGTAGTGGAATTGG + Intergenic
1048980599 8:139701867-139701889 AGCGCCCTTGGCAGTGGGGCTGG + Intronic
1057546924 9:96026054-96026076 GGGGCCCTGGGGAGTGGAACCGG + Intergenic
1061405463 9:130391142-130391164 GGCTGCCATGGGAGTGGGACAGG - Intronic
1062075458 9:134586245-134586267 GGTTCCCTTGTTAGTGGGGCTGG - Intergenic
1197675271 X:129323202-129323224 GGGGCCCTTTGTAATGGGGCTGG - Intergenic