ID: 1151826666

View in Genome Browser
Species Human (GRCh38)
Location 17:76527699-76527721
Sequence CAGGGCAGCCCCGGGGGATC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 339}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151826666_1151826682 23 Left 1151826666 17:76527699-76527721 CCGGATCCCCCGGGGCTGCCCTG 0: 1
1: 0
2: 2
3: 35
4: 339
Right 1151826682 17:76527745-76527767 CGGTCGAGGTTTCTGGACTGAGG 0: 1
1: 0
2: 0
3: 1
4: 56
1151826666_1151826680 9 Left 1151826666 17:76527699-76527721 CCGGATCCCCCGGGGCTGCCCTG 0: 1
1: 0
2: 2
3: 35
4: 339
Right 1151826680 17:76527731-76527753 GCAGGTGGAGCTAGCGGTCGAGG 0: 1
1: 0
2: 1
3: 7
4: 127
1151826666_1151826681 16 Left 1151826666 17:76527699-76527721 CCGGATCCCCCGGGGCTGCCCTG 0: 1
1: 0
2: 2
3: 35
4: 339
Right 1151826681 17:76527738-76527760 GAGCTAGCGGTCGAGGTTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 38
1151826666_1151826674 -9 Left 1151826666 17:76527699-76527721 CCGGATCCCCCGGGGCTGCCCTG 0: 1
1: 0
2: 2
3: 35
4: 339
Right 1151826674 17:76527713-76527735 GCTGCCCTGGTGGCCAAGGCAGG 0: 1
1: 0
2: 6
3: 178
4: 2938
1151826666_1151826678 3 Left 1151826666 17:76527699-76527721 CCGGATCCCCCGGGGCTGCCCTG 0: 1
1: 0
2: 2
3: 35
4: 339
Right 1151826678 17:76527725-76527747 GCCAAGGCAGGTGGAGCTAGCGG 0: 2
1: 0
2: 53
3: 2794
4: 14159
1151826666_1151826675 -6 Left 1151826666 17:76527699-76527721 CCGGATCCCCCGGGGCTGCCCTG 0: 1
1: 0
2: 2
3: 35
4: 339
Right 1151826675 17:76527716-76527738 GCCCTGGTGGCCAAGGCAGGTGG 0: 1
1: 1
2: 8
3: 139
4: 1380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151826666 Original CRISPR CAGGGCAGCCCCGGGGGATC CGG (reversed) Exonic
900095865 1:939919-939941 CAGGGCCGACCCGGGGGAAGGGG - Intronic
900391867 1:2437085-2437107 CAGGGCAGCCCCCATGGGTCAGG + Intronic
900393689 1:2444480-2444502 CAGGGCCGCCCCAGGGCCTCCGG - Intronic
900583822 1:3422937-3422959 CAGGCCAGGCCCCTGGGATCAGG + Intronic
900673054 1:3867919-3867941 CAGGGCAGGCCAGGGGCCTCTGG - Intronic
900764147 1:4492786-4492808 CAGGGAAGCCCCAGGGGAGCTGG - Intergenic
901065193 1:6490934-6490956 CAGAAAAGCCCCGGGGGACCAGG + Intronic
902330163 1:15727388-15727410 CGGGGCATCCCCGGGAGAGCCGG - Exonic
902731838 1:18374821-18374843 CAGGGCAGCCCCAGGGCCTCAGG + Intronic
904092454 1:27954858-27954880 CAGGGCATCCCCTGGAGATCTGG - Intronic
904334562 1:29788175-29788197 CAGGGCAGCCACGGGAGGCCAGG - Intergenic
904697462 1:32338251-32338273 CAGGGCATCCCCTGGGGACCAGG - Intergenic
905107807 1:35574407-35574429 CAGGTGAGACCCGAGGGATCCGG + Exonic
905939165 1:41849115-41849137 CGGGGCAGTCCTGGGTGATCTGG + Intronic
906154570 1:43606489-43606511 CAGGCCAGGCCCAGGGAATCAGG - Intronic
906983864 1:50662046-50662068 CAGGCCAGCCCTGGGGGAAGGGG - Intronic
907113161 1:51945669-51945691 CAGGGCAGACCCTGGGAAGCTGG - Intronic
908951406 1:69567478-69567500 CGGGCCAGCCCCGGGCGCTCGGG - Intergenic
909393108 1:75137097-75137119 CAGGTGAGCCCCGAGGGAGCGGG + Exonic
917724298 1:177814282-177814304 CAGGGCTGCCCAGGGGGAGGAGG + Intergenic
917966678 1:180183230-180183252 GAGGGCTGCCCCGGGGGAGCTGG - Intronic
919942282 1:202296502-202296524 CAGGGGAGCCCCGGGGAAAGAGG - Intronic
920253338 1:204637457-204637479 CAGGGCAGCCCTGTGGGGCCTGG - Intronic
920435396 1:205943730-205943752 CAGGGCCGCCTTGGGGGAGCCGG - Intergenic
922336550 1:224623117-224623139 CAGGGCAGGTCAGGGGGCTCAGG - Intronic
922423038 1:225471978-225472000 CAGGGCAGCCCCGGGACTTGGGG + Intergenic
922546858 1:226464363-226464385 CAGGGCAGTGCTGGGGGACCCGG - Intergenic
923056065 1:230426412-230426434 CCGGACAGCCGCGGGGGAGCTGG + Intergenic
923730337 1:236543916-236543938 CAGAGCAGCCCCGTAAGATCAGG + Intronic
924183091 1:241458935-241458957 CAGGGGAGCTCAGGGGTATCTGG - Intergenic
1062860785 10:807631-807653 CAGGGCCGCCCGGTGGGGTCAGG - Exonic
1062991793 10:1826166-1826188 GCGGGCAGCCCCTGGGCATCGGG + Intergenic
1064094966 10:12417518-12417540 GAGGGCAGCCTCTGGGGCTCCGG + Intronic
1064134343 10:12737429-12737451 CAGTGCAGCCCGGGGTGGTCAGG - Intronic
1066332721 10:34442462-34442484 GAGGGGAGCCCCGGTGGCTCAGG + Intronic
1070570706 10:77637913-77637935 CAGCGCAGCCCGGGGCGAGCGGG - Intronic
1071565385 10:86668898-86668920 CAGGCCAGTCCCAGGGGATGGGG - Intronic
1071566595 10:86674410-86674432 AAGGGCAGCCCAGGGAGAGCTGG - Intronic
1072532200 10:96330067-96330089 CAGGGCAGCCCTCTGGGCTCTGG - Intronic
1073515443 10:104071708-104071730 CACGGCAGCCCATGGAGATCAGG - Intronic
1074103773 10:110374211-110374233 GAGGGCAGGTCCGGGGGAACTGG + Intergenic
1074752652 10:116601643-116601665 CGAGGCAGCCCCTGGGCATCAGG - Intronic
1076371704 10:129959663-129959685 CAGGGAGGCCCCGGGAGCTCGGG - Intronic
1077268893 11:1665955-1665977 GAGGGCGGGCCCGGGAGATCTGG + Intergenic
1077271859 11:1685225-1685247 GAGGGCGGGCCCGGGAGATCTGG - Intergenic
1077535054 11:3120087-3120109 CAGGGCAGCCCCGGGTTAGGAGG + Intronic
1078128692 11:8594034-8594056 CAGGGCGGGCCCGCGGGATGGGG - Intronic
1078729469 11:13962614-13962636 CAGCGCTGCGCTGGGGGATCTGG + Intergenic
1081350291 11:42043959-42043981 CAGGGCAGTCCCAGGGAAACTGG - Intergenic
1081851711 11:46278699-46278721 CCTGGCAGCCCCAGGGAATCAGG + Intronic
1083208836 11:61170042-61170064 CAGGGCTCCCCTGTGGGATCAGG - Intergenic
1083261258 11:61524303-61524325 CAGGGCAGGGCTGGGAGATCTGG - Intronic
1083673881 11:64314921-64314943 CAGGGCAGCCCCGGGTCACCTGG - Intronic
1084203493 11:67577399-67577421 CCATGCAGCCCCAGGGGATCAGG + Intergenic
1084418683 11:69049382-69049404 TTGGGCAGCCCCGAGGGAACCGG + Intronic
1084424900 11:69079261-69079283 CAGGGCTTCCCCTGGGGGTCGGG - Intronic
1084735615 11:71103420-71103442 CAGGGCAGTCCCGGGAAAACCGG + Intronic
1085179883 11:74524748-74524770 CAAGTGAGCCCCTGGGGATCTGG - Intronic
1085298663 11:75445584-75445606 CAGAGCAGGGCAGGGGGATCGGG - Intronic
1085642163 11:78199458-78199480 AAGGGCAGCCCCGGGGTCTGTGG - Intronic
1089310412 11:117554791-117554813 CAGGGCTGACCCAGGAGATCAGG - Intronic
1089743644 11:120602071-120602093 GAAGGCAGCCCCGGGGTACCTGG - Intronic
1089883214 11:121794855-121794877 CAGGGCAGCCCCCGGCGAGGCGG + Intergenic
1090658365 11:128862502-128862524 TAGGGCAGCCCCGGGGGGGATGG - Intronic
1091080901 11:132666710-132666732 CAGGGCAGCCATGTGGGGTCTGG + Intronic
1091349387 11:134880974-134880996 CCGGGCTGCCCCGGGGGCGCTGG + Intergenic
1091410247 12:234423-234445 CAGGGCAGCCCCAGGGCTACTGG - Intronic
1096575345 12:52549253-52549275 CAGGCCAGCCCCCGGGACTCAGG + Intronic
1097712620 12:62933342-62933364 CAAGCCTGCCCCGGGGTATCCGG + Intronic
1099890241 12:88580768-88580790 CAGGTGAGCCCCAGCGGATCCGG - Intronic
1102769847 12:115466096-115466118 AAGGGCAGCCCAGGGGCTTCAGG - Intergenic
1102879297 12:116472035-116472057 CAGGGCATCTCCGTGGAATCTGG - Intergenic
1103527189 12:121576872-121576894 CAGGGCAGCCTTGGGGGAGGAGG + Intronic
1103527523 12:121578395-121578417 CAGGGCGCCCCTGGGGCATCGGG - Intronic
1103856348 12:123973173-123973195 CGGGGAAGCCCCGGGGGAGCGGG - Exonic
1103921791 12:124403100-124403122 CAGGGCAGGGCTGGGGCATCAGG - Intronic
1104038438 12:125114451-125114473 CAGGGGAGACACGGGGGAGCGGG - Intronic
1104319953 12:127741705-127741727 CAGAGCAGCCCCGAGGGCTGCGG + Intergenic
1104970719 12:132529471-132529493 AAGGGCAGCCTCAGGGGAGCTGG - Intronic
1106327706 13:28710136-28710158 CAGGGTAGCCCAGGGTGAACTGG + Intronic
1107069993 13:36258740-36258762 CAGAGCAGCCCCCGGGGTGCTGG - Intronic
1113508520 13:110832863-110832885 CACGGCAGCCCCGGGAGCTGGGG + Intergenic
1113906475 13:113821650-113821672 CAGACCAGCCCCGGGGGAGAGGG - Intronic
1114050113 14:18914970-18914992 CTGGGGACCCCTGGGGGATCGGG - Intergenic
1114112445 14:19486961-19486983 CTGGGGACCCCTGGGGGATCGGG + Intergenic
1115493484 14:33981125-33981147 CAGGGCAGCCGTGGGGAGTCAGG - Intronic
1118748867 14:68792607-68792629 CAGGGCAGCCCGGGGGCTTCGGG - Intronic
1122204839 14:100143216-100143238 CAGGGCAGTCCCTGGGGTCCAGG + Intronic
1122838937 14:104445209-104445231 CAGGGCAGCCCCCGGGACTTGGG + Intergenic
1122985343 14:105209172-105209194 CAGGGCAGCCCCTGGGTCTCAGG + Intergenic
1123441613 15:20295594-20295616 CGGCGCAGCCCGGGAGGATCAGG + Intergenic
1123710014 15:22980255-22980277 CAGGGCAGGCGCGGGCGAGCGGG + Intronic
1124095069 15:26641703-26641725 CAGGGAAGCCAAGGGGCATCTGG - Intronic
1124653988 15:31494020-31494042 AAGGCCAGCCCCTGAGGATCGGG + Intronic
1125706199 15:41738732-41738754 CAGCGCAGTCCCAAGGGATCCGG + Intronic
1126506219 15:49406928-49406950 CAGGGCATCCTCGGGTGTTCTGG - Intronic
1128234732 15:66059741-66059763 CAGGGGAGTCCCTGGGGTTCTGG - Intronic
1128312409 15:66639496-66639518 CAGGACAGCTCCAGAGGATCGGG + Intronic
1129449225 15:75640643-75640665 CAGGTCAGCCCCAGGAGAGCCGG - Intronic
1129832414 15:78679453-78679475 CAGGGCAGGCCTGGGGGACCGGG + Intronic
1131171929 15:90184965-90184987 CGGCGCAGCCCCTGGGGACCCGG - Intronic
1131259903 15:90882855-90882877 CAGGGCAGCCAGGGAGGAGCAGG - Exonic
1132581915 16:688693-688715 CAGGGCAGCCATCGGGGAGCTGG + Intronic
1132598689 16:764483-764505 CAGCGCTGCCCTGGGGGATGGGG - Intronic
1132703721 16:1232292-1232314 CAGGGGAGCGGCCGGGGATCGGG - Intergenic
1132704789 16:1239069-1239091 CAGGGGAGCGGCCGGGGATCGGG + Intergenic
1132707797 16:1254103-1254125 CAGGGGAGCGGCCGGGGATCGGG + Intergenic
1132774628 16:1586191-1586213 CTGGGCAGCCCCGGGGCAGAGGG - Exonic
1132862330 16:2077838-2077860 CTGGCCAGCCCAGGGGGAGCCGG + Intronic
1132978417 16:2721575-2721597 CTGGGCAGCCCCTGGGGGTCTGG + Intergenic
1133287877 16:4698863-4698885 CAGGGCATCCCCGGGTGGGCGGG + Exonic
1134005972 16:10818987-10819009 CAGGCCCGGCCCGGGGGATGTGG + Intergenic
1134006027 16:10819152-10819174 CAGGCCCGGCCCGGGGGATGTGG - Intergenic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136230141 16:28880903-28880925 CAGGCCAGCACCTGGGGAGCAGG - Exonic
1136294828 16:29295566-29295588 CAGGGCAGCCCAGGTGGAGGCGG - Intergenic
1136719596 16:32309916-32309938 CAGTGCAGCCCGGGAGGCTCAGG - Intergenic
1136837970 16:33516196-33516218 CAGTGCAGCCCGGGAGGCTCAGG - Intergenic
1137738525 16:50742422-50742444 CCGGGAAGCCTCGGGGGATGGGG - Intronic
1138481362 16:57305484-57305506 CAGGCCAGCCCCAGGGGAATGGG + Intergenic
1138492145 16:57382924-57382946 GAGGGCAGCCCTGGAGGCTCTGG - Exonic
1141203644 16:81915781-81915803 CAGGGCAGGCAGGGGGGCTCTGG - Intronic
1142063598 16:88047183-88047205 CCTGGCAGCCCCGGGAGCTCTGG - Intronic
1142145469 16:88491178-88491200 CAGGGCAGCACTGTGGGGTCGGG + Intronic
1142187249 16:88700484-88700506 CAGGGCAGCCCCTGGACATCTGG + Intronic
1142284053 16:89164488-89164510 CTGGGCCGTCCTGGGGGATCAGG - Intergenic
1142338808 16:89507853-89507875 GAGGGCAGCCCCGGAGGAGGAGG - Intronic
1142374111 16:89697954-89697976 CAGGGGAGCCTCGGGGGGGCAGG + Exonic
1203006835 16_KI270728v1_random:207853-207875 CAGTGCAGCCCGGGAGGCTCAGG + Intergenic
1142489667 17:270102-270124 CACGGCATCCCTGGGGGACCCGG - Intronic
1142549975 17:732500-732522 CAGAGCCGCGCCGCGGGATCGGG + Exonic
1142562142 17:816513-816535 CAAGGATGCCCCAGGGGATCTGG - Intronic
1142752809 17:1998544-1998566 CAGGAAAGCCGCCGGGGATCCGG - Intronic
1145009959 17:19362428-19362450 CAGGGCAGCCCGGGGGGTTGCGG + Intronic
1146296973 17:31657954-31657976 CAGGGCAGGCCAGGGGGAGCCGG + Intergenic
1146945437 17:36870116-36870138 TAGAGCAGCCCCAGGGGAGCTGG + Intergenic
1147285704 17:39401465-39401487 CAGGACAGGCCCGGGAGTTCCGG + Exonic
1147614952 17:41822194-41822216 CAGGGGAGAGCCGGGGGAGCGGG - Intronic
1148323127 17:46769528-46769550 CATGGCCACCCCGTGGGATCAGG - Intronic
1148469093 17:47882516-47882538 CAGGGCACCCCGTGGGAATCAGG + Intergenic
1148722509 17:49763965-49763987 CAGCCCAGCCCGGGGGGAGCCGG + Exonic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1148804437 17:50257236-50257258 CAGGGCAGCCCCGGTGGTGTGGG + Intergenic
1150220765 17:63494566-63494588 CAGGGCAGACCCGGGGGAGCCGG + Intronic
1151131031 17:71896101-71896123 CTGTGCGGCCCCGGGGGATTGGG - Intergenic
1151826666 17:76527699-76527721 CAGGGCAGCCCCGGGGGATCCGG - Exonic
1152365091 17:79850925-79850947 CAGGTCAGTCCCCGTGGATCTGG - Intergenic
1152639718 17:81444505-81444527 CGGGGCAGCCAGGGGGGATGGGG - Exonic
1154123611 18:11671169-11671191 TGGGGCAGCCCAGGGGCATCAGG - Intergenic
1157899293 18:51498681-51498703 GAGGGCAACGCCAGGGGATCTGG - Intergenic
1158291366 18:55948486-55948508 CAGAGCAGCCCCGAGGGCTGTGG - Intergenic
1159702120 18:71641625-71641647 GTGGGCAGCCCCTGGGGGTCAGG - Intergenic
1160683917 19:424767-424789 CAGGGAGGCCCCGGGAGATGGGG + Intronic
1160704617 19:524210-524232 CAGGGGAGGCCCCGGGGAGCTGG - Intergenic
1160716091 19:577456-577478 CTGGGCAGCCCTCGGGGCTCAGG + Intronic
1160861512 19:1239012-1239034 AAGGGCAGCCCCAGGGAACCTGG + Intergenic
1160950751 19:1666075-1666097 CAGGGCAGGCCCAGGGGCACGGG + Intergenic
1161027093 19:2041782-2041804 CAGGGCAGGCCCGGGGGAGGAGG + Intronic
1161384175 19:3982226-3982248 CAGGTGAGCCCCGCGGGATATGG - Exonic
1161512579 19:4679719-4679741 CAGGGGCTCCCTGGGGGATCTGG - Intronic
1161870499 19:6866035-6866057 CTGGGCATTCCCGGGAGATCAGG - Intergenic
1162069969 19:8147590-8147612 TGGGGCAGCCCCGGGGCCTCTGG + Intronic
1162362389 19:10227851-10227873 CAGGGCAGCCTGGGGGTGTCTGG - Intronic
1162367344 19:10257462-10257484 CAGGGTAGCTCCGGGGGATGTGG - Intronic
1162911495 19:13850300-13850322 CTGGGGAGCCCCGGTGGGTCTGG + Intergenic
1162940459 19:14006075-14006097 CAGGGCGGCCCCGGGGTGGCTGG - Intronic
1163513112 19:17747829-17747851 CAGGGTATCCCAGGGGGTTCCGG - Intronic
1163517299 19:17772748-17772770 CAGGGCAGCCATTGGGGGTCGGG + Intronic
1164431657 19:28194184-28194206 CAGGGCAGCAAGGGGGAATCAGG - Intergenic
1165070282 19:33251519-33251541 CAGGGCAGCCCCGATGGGCCAGG - Intergenic
1165318772 19:35073683-35073705 CTGGCCAGCCCCGGGGGCCCAGG - Intergenic
1165328964 19:35130867-35130889 CAGGACAGCCCAGGACGATCTGG - Intronic
1165442227 19:35835667-35835689 CAGGGGAGCCGGGAGGGATCAGG + Intronic
1165448060 19:35867744-35867766 CAGGGCTGCCCCAGGGGTCCTGG + Intronic
1166337378 19:42116684-42116706 AAGGGCAGCCACTGGGGACCAGG - Intronic
1166500499 19:43337614-43337636 CAGGGCAGGCCCTGGGGAAGGGG + Intergenic
1166509625 19:43396085-43396107 CAGGGCAGGCCCTGGGGAAGGGG - Intergenic
1166851791 19:45764880-45764902 CAGGGCTGCCCCCAGGGATGAGG + Exonic
1166943474 19:46383257-46383279 CAGGGCAGGCCTGGGGGAGCGGG - Intronic
1168269388 19:55241409-55241431 AAGGGCAGCCCTTGGGAATCAGG - Intronic
1168630889 19:57955217-57955239 ATGGGCAGCCCCGGGGGCACAGG - Intergenic
925297916 2:2790402-2790424 CAGGGCAGCCCCCAGAGAACAGG - Intergenic
925922497 2:8646966-8646988 CAGGGCAGACCCCAGGGACCCGG - Intergenic
926428959 2:12766762-12766784 GAGAGCAGCACCGGCGGATCCGG - Intergenic
926724041 2:15983740-15983762 GAGGGCAGCCCATGGGCATCTGG - Intergenic
927210937 2:20638627-20638649 CCCTGCAGCCCCTGGGGATCTGG + Exonic
927215545 2:20666408-20666430 GACGGCAGCCCCGGGTGATGGGG - Intergenic
927216624 2:20671063-20671085 CAGGGCAGCGGCGGGGGCGCGGG + Exonic
927572810 2:24175022-24175044 CGGGGCAGCACCCCGGGATCTGG + Intronic
927857616 2:26537275-26537297 CAGGGCAGCCCCGGGCACTGAGG - Intronic
927911578 2:26903641-26903663 CAAGGCAGACCCAGGGGATTCGG - Intronic
928428522 2:31199250-31199272 GAGGGCTGCCCCAGGGGATGAGG + Intronic
929780209 2:44952442-44952464 CAGCCCAGCCCCGCGGGAACCGG - Intergenic
930772924 2:55145662-55145684 CAAGGCAGGCCAGGGCGATCAGG + Intergenic
934049870 2:88200951-88200973 CAGGGCAGTCCCTGGGGGTGGGG + Intergenic
934529432 2:95075847-95075869 CACGGCAGCCCCCGGGGTTAAGG + Intergenic
934966989 2:98731514-98731536 TGGGGCAGCCCCGGGTGGTCGGG - Intergenic
936251452 2:110871215-110871237 CAAGGCAACCCATGGGGATCTGG + Intronic
937257330 2:120564697-120564719 CAGGGGAGCCCTGGGGGCTAGGG + Intergenic
937629512 2:124084548-124084570 CAGGGCAGGCACGGTGGCTCAGG - Intronic
937925501 2:127164885-127164907 CATGGCAGCCCATGGGGGTCTGG + Intergenic
938233266 2:129680102-129680124 CAGGGAAGCCCAGGGAGAGCCGG + Intergenic
940639034 2:156329206-156329228 CTGGGCAGTCCCGGGAGAGCTGG + Intronic
940883256 2:158968340-158968362 AGGCGCAGCCCCGGGGGACCCGG + Intergenic
940911647 2:159214967-159214989 CATGGCAGCCCAGGGAGCTCAGG - Intronic
946071250 2:217036048-217036070 CAAGGCAGCCCTGGGCAATCTGG + Intergenic
946321974 2:218959741-218959763 TACTGCAGCCCCGGGGGACCCGG - Exonic
946411989 2:219520078-219520100 CCAGGCAGCCCCGGGGGGCCAGG + Intronic
947456100 2:230255309-230255331 CAGGGCAGACCAGGAGGACCTGG + Intronic
947867404 2:233408765-233408787 CAGTGCAGGCCTGCGGGATCAGG + Intronic
948467645 2:238159861-238159883 CAGGGCTGCCCCAGGGAAGCCGG + Intronic
948559908 2:238845919-238845941 CAGGGCGTCCCCGGGGCCTCTGG + Intergenic
948636976 2:239344919-239344941 GTGGGCAGCCCTGGGGGTTCTGG - Intronic
948690014 2:239696062-239696084 CAGGGCAGCCGCAGGGGTCCTGG - Intergenic
948769924 2:240246486-240246508 GAGGGCAGAGCCGGGGGATGAGG - Intergenic
948896739 2:240931157-240931179 CAGGGAGGGCCCGGGGGGTCGGG + Intronic
1171389655 20:24793188-24793210 CAGGGCAGCACAGTGGAATCTGG + Intergenic
1171464726 20:25319524-25319546 CAGGGCAGCCCTGGAGGAGGTGG - Intronic
1171896534 20:30814343-30814365 CTGGGCAGCCCTGGCGGCTCTGG - Intergenic
1172930219 20:38581186-38581208 CAGGGCTGCCCCATGGGACCTGG - Exonic
1172933243 20:38600884-38600906 CAGGGCGGGCCCGGGCAATCTGG + Intergenic
1175520984 20:59602828-59602850 CAGGACAGCCCCTGGGGACTTGG + Intronic
1175777771 20:61663848-61663870 CAGGGCGGCCTCGAGGGAGCTGG - Intronic
1175844417 20:62051145-62051167 CAGGGCAGCCCCGCAGGCGCTGG + Intronic
1175875776 20:62228539-62228561 CAGGGCAGCTCCTGGGGACCTGG + Intergenic
1176092597 20:63325683-63325705 CAGGGCATCCCCGGGAGAGTTGG + Exonic
1176411252 21:6450656-6450678 GAGGGCAGGTCGGGGGGATCAGG + Intergenic
1178434583 21:32547014-32547036 CAGGGCTGGCGCAGGGGATCTGG + Intergenic
1179534362 21:42041887-42041909 GGGGGCAGCCCCGGGGGGTGTGG - Intergenic
1179686745 21:43058978-43059000 GAGGGCAGGTCGGGGGGATCAGG + Intronic
1179965537 21:44802450-44802472 CAGGGCACCCCCGGGAGAGAGGG + Intergenic
1180078998 21:45477831-45477853 CACGGGAGACCCGGGGGACCAGG - Exonic
1180105469 21:45615611-45615633 CAGAGCAGCCCCGGGGGGGCAGG + Intergenic
1180132573 21:45835876-45835898 CACGGCAGCCCCAGGGGAACAGG + Intronic
1180468593 22:15637345-15637367 CTGGGGACCCCTGGGGGATCGGG - Intergenic
1180695667 22:17750074-17750096 CAAGGCACCCGCAGGGGATCTGG + Intronic
1181155521 22:20917684-20917706 CACGGCAGAGCCGGGGGGTCGGG - Exonic
1181467581 22:23118478-23118500 CAAGGCAGCCGCGGGGGGTGGGG - Intronic
1181512419 22:23394845-23394867 CAGCGCAGCCACTGGGCATCTGG - Intergenic
1181577621 22:23805341-23805363 CAGGACAGCCCATGGGGACCAGG + Intronic
1182524773 22:30908231-30908253 CAGGGCACCCCAGGGGCATCAGG + Intergenic
1183492293 22:38123070-38123092 GAGGGCGGCCCCTGGGGATGGGG - Intronic
1183568051 22:38630795-38630817 CAAGGCATCCCAGGGGGATGTGG + Intronic
1183952014 22:41357503-41357525 CAGGGCAGGCCAGGGGGGTGGGG + Exonic
1184086633 22:42269918-42269940 CCTGGCAGCCCCGGGGGCACCGG - Intronic
1184457310 22:44618526-44618548 CAGGCCAGCCACGGGCGCTCTGG - Intergenic
1184650911 22:45919105-45919127 CAGGGCAGCCCGAGGGGACTGGG + Intergenic
1185050336 22:48551019-48551041 CAGAGCAGCCCTGGGGGAGAGGG - Intronic
1185287797 22:50010334-50010356 CGGGGCAGCCTCTGGGGAACGGG + Intronic
1185394173 22:50578346-50578368 CAGGGCGGCCCGCGGGGGTCTGG - Intronic
1185396941 22:50597286-50597308 CAGAGCAGCCCTGGGGGACTGGG + Intronic
1185413355 22:50697343-50697365 CAGGGCAGCCTAGTGGGAGCGGG - Intergenic
1185420193 22:50730761-50730783 CAGCGCAGCCCCGGGGGCCCGGG + Intergenic
953226998 3:41030209-41030231 CAGGGCTTCCCCGAGGGATCAGG - Intergenic
954135497 3:48580325-48580347 CAGGGCAGCCCTGGATCATCTGG - Exonic
954368583 3:50158600-50158622 CAGGGCAGATCTGGGGGATGGGG + Intronic
954522651 3:51243000-51243022 CAGGGCAGCCTCAGGTGACCTGG - Intronic
954575737 3:51675026-51675048 GAGGGCAGTCCCTGGGGATGGGG + Intronic
959849894 3:111072712-111072734 CAGGGCAGAGCCGGGGGAGTGGG - Intronic
960047346 3:113211261-113211283 CAGGGGAGCCCCCTGGGTTCGGG + Intronic
960302918 3:116026286-116026308 CAGGGCAGACCCTGGAGATCTGG - Intronic
960971549 3:123143487-123143509 CCTGGCAGCCCCAGGGGAGCCGG - Intronic
961337087 3:126187017-126187039 CAGGGCTGCTCAGGGGGAGCGGG + Intronic
961823876 3:129588729-129588751 CAGGGCTGCACCTGGGGGTCTGG + Intronic
963827398 3:149970529-149970551 CAGCGCAGCCCCGGGTGAGGGGG + Intronic
964071939 3:152645995-152646017 CAGGCCAGCCCTGGTGGATAGGG - Intergenic
966926442 3:184647585-184647607 CAGGCCAGCCCAGGGGGATCTGG - Intronic
967100717 3:186213310-186213332 CAGAGCAGCCAGGTGGGATCTGG + Intronic
968858544 4:3148084-3148106 CTGGCCAGCCCTGGGGGACCGGG + Exonic
968945158 4:3659823-3659845 CAGGGAAGCCACTGGGGACCTGG - Intergenic
969447993 4:7256263-7256285 CAGGGCCGCCACGAGGGACCAGG + Intronic
969613272 4:8238571-8238593 CAGGCCTGCCGCGGGGGATACGG - Intronic
972680882 4:41305828-41305850 CAGAGCTTCCCTGGGGGATCAGG + Intergenic
976589322 4:86833388-86833410 CAGGGCGGCCACGGTGGAACAGG + Exonic
979158611 4:117429738-117429760 CAGGTCAGCCCCGAGTGGTCTGG - Intergenic
985475181 5:74830-74852 CAGGGCAGGCCTGGGGAGTCGGG + Intergenic
985605970 5:858232-858254 CAGGACAGACTCTGGGGATCTGG - Intronic
986190751 5:5494571-5494593 CAGTGCAGCCCCGGGAGAACAGG - Intergenic
986321288 5:6633989-6634011 GGGGGACGCCCCGGGGGATCTGG - Intronic
986326835 5:6682143-6682165 CAGGGCAGCCTCAGAGGAGCAGG + Intergenic
987073637 5:14360472-14360494 CAGGGCAGCCCAGAGGTATGTGG - Intronic
987655644 5:20801708-20801730 CAGGGAAGACTCGGGGTATCTGG + Intergenic
988767910 5:34402180-34402202 CAGGGAAGACTCGGGGTATCTGG - Intergenic
991900558 5:71455808-71455830 CCGGGCAGCCGCCGGGGCTCGGG + Exonic
994174043 5:96691520-96691542 CAGGGCAACCCCAGTGGGTCTGG - Intronic
995105414 5:108372001-108372023 CAAGGCAACCCCTGGGGAACAGG - Intronic
997474149 5:134133117-134133139 CAGGGTAGCCCTGGGGTGTCTGG + Intronic
997513148 5:134466612-134466634 CCGGGCACCCCCGGGGCAGCCGG - Intergenic
997673724 5:135696835-135696857 CAGTGCAGCCACAGGGGAGCTGG + Intergenic
997697493 5:135873080-135873102 CAGGGCAGCACCTGGGGAAGTGG + Intronic
998407682 5:141883216-141883238 CTGGGCAGCCCCCGGGGACCCGG + Intergenic
998963151 5:147509632-147509654 CAGGGCAGCGACCGAGGATCGGG - Exonic
999265642 5:150265109-150265131 CAGGGCAGCCCCTGGGGGCTGGG + Intronic
999268618 5:150283244-150283266 CATGTCAGCCCTGGGGGATCTGG - Intronic
999696335 5:154190975-154190997 GACGGCACCCCTGGGGGATCGGG + Exonic
999910761 5:156196053-156196075 CAAGGAAGCCCCAAGGGATCTGG - Intronic
1001642566 5:173254939-173254961 AGGGCCAGCCCCGGGGGATGGGG + Intergenic
1001838174 5:174849898-174849920 CAGGGAAGCCCCGTGGGGTCAGG - Intergenic
1002298719 5:178245949-178245971 CAGGGCAGACCCGGGGAGCCAGG - Exonic
1002533972 5:179865994-179866016 CAGGCCAGGCCCTGGGGAGCAGG + Intronic
1002691539 5:181053608-181053630 CAGGGCGGCCACCGGGGAACGGG + Intronic
1003137018 6:3441579-3441601 CAGGGAAGCCCAGGGGGCTGTGG - Intronic
1006177065 6:32128802-32128824 CCGGGCAGCCCAGGAGGAACTGG - Exonic
1006473988 6:34243725-34243747 CAGGGCAGGGCAGGGGGATGTGG - Intronic
1007072838 6:39049183-39049205 CAGGGCGGCCGCGGGGCAGCGGG - Intronic
1007255893 6:40528450-40528472 CAGGGCAGGCCAGAGGCATCAGG - Intronic
1007842932 6:44731403-44731425 CAGGGCAGCAGCAGGGGTTCAGG + Intergenic
1016453687 6:144209827-144209849 CAGGGCAGCCTCGGGTGCCCTGG - Intergenic
1017616429 6:156251514-156251536 CAGGGCTGGCGCGGGGGATCTGG + Intergenic
1017678136 6:156836321-156836343 CAGGGCAGTCACGGGAGATTAGG - Intronic
1017756117 6:157531161-157531183 CAGAGCAGACCCGGGACATCTGG - Intronic
1017962536 6:159233968-159233990 CAGGGCAGCGCCGGGGAAGTCGG + Exonic
1018681762 6:166270904-166270926 CAGGACAGCCCCTGGGAATTGGG - Intergenic
1019525708 7:1479560-1479582 CAGGGCAGCCCCGAGGTGCCGGG - Exonic
1019724080 7:2591318-2591340 CAGGGCCTCACCGGGGGTTCTGG + Intronic
1020272486 7:6605626-6605648 CAGGCCTGCCCCGGGAGGTCAGG - Intronic
1020807006 7:12802397-12802419 CACAGCAGCCCTAGGGGATCTGG - Intergenic
1022134165 7:27431822-27431844 CAGGGCAGTCCCTGGGGACTTGG - Intergenic
1023071719 7:36441481-36441503 CAGGGCAGCCCTGGCACATCAGG - Intronic
1023990076 7:45123621-45123643 GGGGTCAGCCCCGGGAGATCTGG + Intergenic
1024224513 7:47315349-47315371 CGGGGCAGCCCCCCGGGACCGGG + Intronic
1026447559 7:70498934-70498956 CAGGGCAGCCCCAAGGCATGGGG + Intronic
1029495979 7:100895684-100895706 CGGGGCAGGCCCGGGGAAGCGGG + Intronic
1029524865 7:101088318-101088340 CAGGGCTGCCCCTGGGCACCAGG + Exonic
1029927133 7:104329382-104329404 CTGGGGAACCCCGGGGGTTCCGG - Intronic
1032079106 7:128849835-128849857 CAGGGCAGCCTCTGGGGAGATGG - Intronic
1032084618 7:128877411-128877433 AAGGGCAGCCCGGAGGGCTCAGG - Intronic
1032239428 7:130149511-130149533 CCCGGCCGCCCCGGGGGAGCAGG - Intergenic
1032461855 7:132117821-132117843 CAGAGGAGCCCCGGGGGAAGAGG - Intergenic
1034269709 7:149797647-149797669 CCGGGAAGCCCCTGGGGACCCGG - Intergenic
1035020113 7:155796048-155796070 CAGGGCATCCCTGGGGCAGCTGG + Intergenic
1035469074 7:159098202-159098224 CAGGGCAGGGCCGGGTGGTCGGG + Intronic
1036545766 8:9768215-9768237 CAGTGCAGCCCCAGGGAAGCAGG + Intronic
1040286925 8:46105212-46105234 CGGGACAGCCCAGGGGCATCTGG + Intergenic
1040333266 8:46403196-46403218 CAGGGCAGCCCTGGGGCTTCTGG - Intergenic
1041107938 8:54459467-54459489 CCGGGCAGTCCCCGGGCATCGGG - Exonic
1047097840 8:121642796-121642818 CAGGTCAGCCCCTGGGGACTGGG - Intergenic
1049592016 8:143466873-143466895 CTGAGGAGCCCTGGGGGATCTGG + Intronic
1049973594 9:841911-841933 CAGGGCAGAGCCGGGGGCTTTGG + Exonic
1052142520 9:25004395-25004417 CAGTGCAGCCTCGGGTGCTCTGG - Intergenic
1052381038 9:27771115-27771137 CAGAGCAGCCCCGAGGGCTGTGG - Intergenic
1053123013 9:35560303-35560325 CAGGGCAGCCCAAGGGGAGCGGG + Exonic
1053749171 9:41235656-41235678 CTGGGCAGCCCTGGCGGCTCTGG - Intergenic
1054254608 9:62800509-62800531 CTGGGCAGCCCTGGCGGCTCTGG - Intergenic
1054336695 9:63815093-63815115 CTGGGCAGCCCTGGCGGCTCTGG + Intergenic
1054454849 9:65424544-65424566 CAGGGCAGCCACGTGGGGTGAGG + Intergenic
1054456533 9:65434258-65434280 GGGGGCAGGCCCCGGGGATCCGG - Intergenic
1056796454 9:89662139-89662161 GAGGGCAGCCCAGGAGGAGCGGG + Intergenic
1057024595 9:91725451-91725473 CGGGGCAGCCCCAGGGCAGCTGG - Intronic
1057864456 9:98667956-98667978 CTGGGCTGCCCCGTGGGATGAGG - Intronic
1059328949 9:113523099-113523121 CTGGGCAGCCCTCTGGGATCTGG + Intronic
1060161663 9:121370232-121370254 CAGGGCATTCCCGGCGGCTCCGG - Intronic
1061187453 9:129063179-129063201 CAGCGATGCCCCGGGGGGTCAGG - Intronic
1061365922 9:130172477-130172499 CTGGGCAGGCCCGGGCGGTCCGG - Intergenic
1061378684 9:130241337-130241359 CAGGGCAGCCCCTGAGGACCGGG + Intergenic
1061411184 9:130422574-130422596 CAGGGGAGCCCCAGGGGAGCTGG + Exonic
1061892329 9:133629393-133629415 CAGGGCAGGTCCGGGGGTCCTGG + Intergenic
1061903565 9:133685120-133685142 GAGGGGTGCGCCGGGGGATCTGG - Intronic
1062018964 9:134307313-134307335 CAGGGCAGCCCCAGAAGATGAGG + Intergenic
1062019004 9:134307437-134307459 CAGGGCAGCCCCGGGCAGCCAGG - Intergenic
1062358817 9:136177881-136177903 CAGGGGAGCACTGGGGGAACTGG + Intergenic
1062429518 9:136520835-136520857 CAGGGCAGCCCTGGGGTCGCAGG - Intronic
1062496185 9:136832940-136832962 CAGGGCAGCCCAGGGCGAGGAGG - Intronic
1062496200 9:136832984-136833006 CAGGGCAGCCCAGGGCGAGGAGG - Intronic
1062599622 9:137314044-137314066 CAGGGCAGCCTGGGGGCCTCAGG - Intronic
1062732882 9:138119460-138119482 CAGGGCTGGCACGGGGGCTCCGG - Intronic
1187181532 X:16947210-16947232 CAGGGCTGCCCCCAGGGACCCGG + Intronic
1189259596 X:39669064-39669086 CAGTGCTGCCCTGTGGGATCAGG + Intergenic
1192533660 X:71910868-71910890 GTGTGCAGCCCCGGGGGAGCCGG + Intergenic
1194412892 X:93578232-93578254 CAGGGCAGTCCCTGGGGATGCGG - Intergenic
1196828260 X:119757950-119757972 CTGGGCAGCCCCGGGTGCTGCGG + Intergenic
1197727819 X:129788079-129788101 CAGGGCATCCTTGTGGGATCTGG + Intronic
1198862711 X:141088158-141088180 CAGAGCAGCCCGGAGGGCTCTGG + Intergenic
1198899982 X:141499228-141499250 CAGAGCAGCCCGGAGGGCTCTGG - Intergenic
1199842461 X:151664168-151664190 CAGGGCAGACCCAGTGGACCTGG + Exonic
1199984692 X:152941999-152942021 CAGGGCTGCCCAGGGGGAGGGGG + Intronic
1201900690 Y:19044168-19044190 GAGGGCAGCCCCAGGGGGTCAGG - Intergenic