ID: 1151828340

View in Genome Browser
Species Human (GRCh38)
Location 17:76535928-76535950
Sequence GAGTGTGCCAGACGCATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151828337_1151828340 1 Left 1151828337 17:76535904-76535926 CCTCGCTTCTTCATGGTGACCCA 0: 1
1: 0
2: 0
3: 1
4: 102
Right 1151828340 17:76535928-76535950 GAGTGTGCCAGACGCATGCAAGG 0: 1
1: 0
2: 1
3: 3
4: 95
1151828331_1151828340 24 Left 1151828331 17:76535881-76535903 CCTCCAAGGTCCTGAGGACCCTG 0: 1
1: 0
2: 4
3: 23
4: 214
Right 1151828340 17:76535928-76535950 GAGTGTGCCAGACGCATGCAAGG 0: 1
1: 0
2: 1
3: 3
4: 95
1151828332_1151828340 21 Left 1151828332 17:76535884-76535906 CCAAGGTCCTGAGGACCCTGCCT 0: 1
1: 0
2: 4
3: 35
4: 308
Right 1151828340 17:76535928-76535950 GAGTGTGCCAGACGCATGCAAGG 0: 1
1: 0
2: 1
3: 3
4: 95
1151828336_1151828340 5 Left 1151828336 17:76535900-76535922 CCTGCCTCGCTTCTTCATGGTGA 0: 1
1: 0
2: 2
3: 8
4: 137
Right 1151828340 17:76535928-76535950 GAGTGTGCCAGACGCATGCAAGG 0: 1
1: 0
2: 1
3: 3
4: 95
1151828333_1151828340 14 Left 1151828333 17:76535891-76535913 CCTGAGGACCCTGCCTCGCTTCT 0: 1
1: 0
2: 2
3: 17
4: 207
Right 1151828340 17:76535928-76535950 GAGTGTGCCAGACGCATGCAAGG 0: 1
1: 0
2: 1
3: 3
4: 95
1151828335_1151828340 6 Left 1151828335 17:76535899-76535921 CCCTGCCTCGCTTCTTCATGGTG 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1151828340 17:76535928-76535950 GAGTGTGCCAGACGCATGCAAGG 0: 1
1: 0
2: 1
3: 3
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151828340 Original CRISPR GAGTGTGCCAGACGCATGCA AGG Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
912302237 1:108530052-108530074 GAGTGTGCCTGGCACATTCAAGG - Intergenic
915893446 1:159792333-159792355 GAGGGTTCCAGGCCCATGCAGGG + Intergenic
921977875 1:221222131-221222153 GAGAGTGCCAGAAACATGCTTGG + Intergenic
1064435032 10:15303967-15303989 GTTTGTGCCACAGGCATGCAGGG + Intronic
1067804971 10:49386082-49386104 AAGTGGCCCAGTCGCATGCATGG + Intronic
1076763614 10:132618287-132618309 GAGTGTGCTTCACGGATGCAAGG + Intronic
1077170441 11:1163687-1163709 GAGGGTCCCAGCAGCATGCATGG + Intronic
1077177990 11:1199257-1199279 GCCTCTGCCAGACGCATGCCTGG - Intronic
1084394743 11:68901850-68901872 GAGTGTGGGAGAAGCAGGCATGG - Intronic
1084588521 11:70077523-70077545 CAGTGTGCCAGACCCCTGCTAGG + Intergenic
1098983356 12:76984311-76984333 GGGTGTTCCAGACCCAGGCACGG + Intergenic
1099481454 12:83171621-83171643 TAGTGTGCCTAACGCATGCTTGG - Intergenic
1102610816 12:114110571-114110593 GAATGTGACAGAAGCATGGAAGG + Intergenic
1104097129 12:125567998-125568020 GAGAGAGACAGACGCACGCAAGG - Intronic
1104153123 12:126104422-126104444 GAGTGTGCCAGAATCATTTATGG - Intergenic
1104842770 12:131832546-131832568 GCAGGTGTCAGACGCATGCAGGG + Intronic
1112319899 13:98396244-98396266 GTGTGTGCCAGAGGCATGGCGGG + Intronic
1112470854 13:99687365-99687387 GTGTGTGCCAAAGGCATGCCTGG - Intronic
1117253886 14:53959019-53959041 GAGTGTCACAGACTCATGGATGG - Intergenic
1118443997 14:65835627-65835649 TAGTGTGCTAGAAGCATCCAGGG - Intergenic
1118777846 14:68984812-68984834 GAGAGTGCCAGCCCCATGCCTGG + Intergenic
1120258496 14:82152017-82152039 GAGTGTGCCATACTCATCCAGGG + Intergenic
1122815614 14:104310691-104310713 GGGAGTGCCAGGAGCATGCAGGG + Intergenic
1122815624 14:104310730-104310752 GGGAGTGCCAGGAGCATGCAGGG + Intergenic
1123459842 15:20459694-20459716 GGGTGTGGCAGAGGCTTGCAGGG - Intergenic
1123658220 15:22540726-22540748 GGGTGTGGCAGAGGCTTGCAGGG + Intergenic
1124312085 15:28635218-28635240 GGGTGTGGCAGAGGCTTGCAGGG + Intergenic
1124633650 15:31351632-31351654 GAGTGTGCTACCCGCAAGCAAGG + Intronic
1125154995 15:36576094-36576116 GAATGAGCCAGTCACATGCATGG - Intergenic
1127597723 15:60503582-60503604 GAGTTTGCCAAACGCATTGATGG - Exonic
1130026775 15:80277086-80277108 CAGTGTGCCAGATGCAGACACGG + Intergenic
1132072934 15:98795807-98795829 GCATGTTCCAGTCGCATGCATGG - Intronic
1137282827 16:46992677-46992699 GAGGGGGCCAGGAGCATGCAGGG - Intergenic
1140378272 16:74463044-74463066 GAGTGTGCCAGGAGAATGTACGG - Intronic
1140928353 16:79603584-79603606 GACTGTGCCATACACATTCATGG + Intergenic
1144937098 17:18908616-18908638 GGGTGTTCCAGACCCAGGCATGG - Intronic
1147268425 17:39248966-39248988 GGGTGTGCCAGACGCATTGTAGG + Intergenic
1148330761 17:46812541-46812563 GAGTCTGCCAGACTCTTGCTGGG - Intronic
1149485518 17:57039756-57039778 GAGTGTGTCAGAGGGATCCAGGG - Intergenic
1151733980 17:75927420-75927442 GAGTGTCCCAGAGGCATGACAGG + Intronic
1151828340 17:76535928-76535950 GAGTGTGCCAGACGCATGCAAGG + Intronic
1152013618 17:77735630-77735652 GACTGGGCCAGAAGCAGGCAGGG - Intergenic
1152231840 17:79117749-79117771 GGGTGTGCCAGGCCCATGCCAGG + Intronic
1159587653 18:70296520-70296542 AAGAATTCCAGACGCATGCAAGG + Intronic
1160050743 18:75431054-75431076 GTGTGTGCCTGAGGCCTGCATGG - Intergenic
1164971028 19:32532881-32532903 GAGTGCGGCAGAGGCAGGCATGG - Intergenic
1166201574 19:41240850-41240872 GAGTGTGCAGTAAGCATGCAAGG - Intronic
925134284 2:1515553-1515575 GAGTGTCCAAGACCCATGCGAGG + Intronic
925160446 2:1680234-1680256 GAATATCCCAGACGCATCCAGGG - Exonic
925353476 2:3219791-3219813 GAGTGTACCAGAGCCATGCCGGG - Intronic
926973275 2:18487928-18487950 GTGTGTACCAGACACATGCTTGG - Intergenic
927853157 2:26512495-26512517 CAGTGTTCCAGACCCTTGCATGG - Intronic
930263448 2:49172948-49172970 AAATGTGCCAGACACATGCTTGG - Intergenic
937150445 2:119682536-119682558 GAGTGTGCCATCTGCATCCACGG - Intronic
948937762 2:241178786-241178808 GAGGCTGCCAGACACAGGCACGG - Intronic
1169512331 20:6277762-6277784 GAGTGTGACAGACACACACAGGG - Intergenic
1172455199 20:35066001-35066023 GAGTGTGACATCTGCATGCATGG - Intronic
1177705957 21:24705218-24705240 GAGGATGCCACATGCATGCAGGG + Intergenic
1178787204 21:35664666-35664688 GAGTGAGGTAGAAGCATGCAGGG - Intronic
1181025535 22:20125348-20125370 GGGTGTTCCAGACCCAGGCACGG - Exonic
1181602157 22:23959080-23959102 CTGTGTGCCAGCCCCATGCAGGG - Intronic
1181606353 22:23982227-23982249 CTGTGTGCCAGCCCCATGCAGGG + Intronic
1183092157 22:35529891-35529913 GAGTGTGCCAGTCCCAGGGAGGG + Intergenic
950677930 3:14565709-14565731 GGGTGTGACAGACCCTTGCAGGG + Intergenic
953296583 3:41723871-41723893 GAGTGTTCCAGTCACATGCTCGG - Intronic
956173233 3:66449609-66449631 CACTGTGCCAGAGGCAGGCAGGG - Intronic
964739625 3:159951794-159951816 CAGGATGCCAGAAGCATGCAGGG - Intergenic
967943282 3:194782826-194782848 GAGTGTTCCAGACCCAAGCTAGG - Intergenic
971375931 4:26055910-26055932 AAGTGTACCAGCCGGATGCAAGG + Intergenic
974077273 4:57178718-57178740 GACTGTGCCAGAGGGATGCTAGG + Intergenic
976571492 4:86616875-86616897 GAGTGTTCTAGACAAATGCAAGG + Intronic
979212332 4:118120272-118120294 GAGTGTGCCACAAGGATGCAGGG + Intronic
980864464 4:138538542-138538564 CAGTGTGCCAAATGCAAGCATGG + Intergenic
985653225 5:1116600-1116622 GAGTGTGTCGGACTCATCCACGG - Intergenic
993043313 5:82839685-82839707 TAATGTGCCAGACACATGGAGGG + Intergenic
994187570 5:96832081-96832103 GAGTGTGCCAGAACCATGCAGGG + Intronic
995251438 5:109997462-109997484 GATTGTGCCTGAAGCATGGAAGG + Intergenic
1000249557 5:159481122-159481144 GAGTGTGCAAGAAACATTCAGGG + Intergenic
1016622152 6:146123415-146123437 GAGTTTGCCTGATGGATGCAGGG + Intronic
1017905051 6:158752230-158752252 GAGTCTGCCAGACTCAGGAATGG + Intronic
1018669819 6:166168719-166168741 GAGTGTGCCAGGCGTGTGCGTGG + Intergenic
1019455665 7:1125749-1125771 GAGTGTGCCATCCGCAGACACGG + Intronic
1024226417 7:47329435-47329457 GAGTGTGCCAGGGTCGTGCAGGG - Intronic
1026295999 7:69052938-69052960 GAGTGAGCCAGGAGCATGCCAGG + Intergenic
1033417124 7:141172239-141172261 GAGTCTGCCAGATGCTAGCATGG + Intronic
1035321906 7:158035458-158035480 GAGTGTGGCAGTGGCAGGCAGGG + Intronic
1043702148 8:83302127-83302149 GAGTATGCTAGACCCAAGCAGGG + Intergenic
1045009320 8:97943949-97943971 GAGTTTGCCAGACCCCTGCCTGG + Intronic
1049095328 8:140545126-140545148 GAGTGAGTCACAGGCATGCAGGG - Intronic
1053020161 9:34689067-34689089 GAGTGTGCCAGACCAAGGGAAGG + Intergenic
1053137711 9:35662081-35662103 GGGTGTGCCAGACCAATGTAGGG + Intronic
1057527386 9:95815082-95815104 GAGTGTGCCAGATTCATGCCAGG - Intergenic
1057797651 9:98170114-98170136 CTTTGTGCCAGACACATGCAAGG - Intronic
1188064796 X:25645955-25645977 GGGTGTTCCAGACCCAGGCACGG + Intergenic
1194872657 X:99152638-99152660 GAGTGTGCCAGTCTTATTCATGG - Intergenic
1198800986 X:140447414-140447436 GAGTGGGGCAGAAGCATGGAAGG - Intergenic
1198827106 X:140710931-140710953 GAGAGTGACTGACGCATCCAGGG + Intergenic
1199667508 X:150111565-150111587 GAGTCTGTCACACACATGCATGG + Intergenic
1201562148 Y:15328938-15328960 TAGTGTGCTATACACATGCATGG - Intergenic