ID: 1151831126

View in Genome Browser
Species Human (GRCh38)
Location 17:76551895-76551917
Sequence CTGTGAAATGGGAAGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 774
Summary {0: 1, 1: 0, 2: 9, 3: 62, 4: 702}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151831117_1151831126 -8 Left 1151831117 17:76551880-76551902 CCTTGACTTCCTCAGCTGTGAAA 0: 1
1: 2
2: 32
3: 252
4: 1282
Right 1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG 0: 1
1: 0
2: 9
3: 62
4: 702
1151831116_1151831126 2 Left 1151831116 17:76551870-76551892 CCTTTCTGCACCTTGACTTCCTC 0: 1
1: 0
2: 7
3: 95
4: 712
Right 1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG 0: 1
1: 0
2: 9
3: 62
4: 702
1151831115_1151831126 9 Left 1151831115 17:76551863-76551885 CCTTTAACCTTTCTGCACCTTGA 0: 1
1: 1
2: 3
3: 31
4: 292
Right 1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG 0: 1
1: 0
2: 9
3: 62
4: 702
1151831114_1151831126 25 Left 1151831114 17:76551847-76551869 CCTTCACTTATGAGTTCCTTTAA 0: 1
1: 0
2: 1
3: 27
4: 284
Right 1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG 0: 1
1: 0
2: 9
3: 62
4: 702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151831126 Original CRISPR CTGTGAAATGGGAAGGTGGG GGG Intronic
900151562 1:1181204-1181226 CTGTGAGATGGACAGGTGGGTGG - Intronic
900207212 1:1436647-1436669 GTGAGGAATGGGAAGGTGTGGGG + Intronic
900498300 1:2986940-2986962 CTGTGAAATGGGACTGCAGGTGG + Intergenic
901244171 1:7715590-7715612 CTGTGAAAGGGGGATGTGGCTGG - Intronic
901778487 1:11576803-11576825 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
902162599 1:14543403-14543425 CTGTGAACTGTGAAGTTGGCTGG + Intergenic
902481028 1:16711965-16711987 CTGTGCAGTGGGAGGGAGGGAGG - Intergenic
902567408 1:17321246-17321268 CCGGGAGATGGGAAAGTGGGGGG + Intronic
902688037 1:18091634-18091656 TTGAAAAATGGGAAGGAGGGGGG - Intergenic
903314285 1:22489054-22489076 CTGTGAGGTGGGAAAGTGGCAGG + Intronic
903320228 1:22538727-22538749 CTGTGAAATGGGGAGGGTAGGGG + Intergenic
903375281 1:22861987-22862009 TTGTGCAATGGGTAAGTGGGTGG - Intronic
903646064 1:24897178-24897200 CTGTCAAATGGGACGGGGGCAGG - Intergenic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
904064867 1:27741635-27741657 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
904697338 1:32337689-32337711 CTGTGAAATGGGGCGGGGGTGGG - Intergenic
904963114 1:34350282-34350304 TTGTTGAATGGGTAGGTGGGTGG - Intergenic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905073238 1:35246463-35246485 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
905148592 1:35907879-35907901 CTTTGGAATGCCAAGGTGGGAGG + Intronic
905153411 1:35951630-35951652 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
905294670 1:36946693-36946715 CTGTGAAATGAGAAGGTGCATGG - Intronic
905374303 1:37508526-37508548 CTTTGGAATGGAGAGGTGGGAGG - Intronic
905806701 1:40882423-40882445 CTGAGAGATGGGGAGGAGGGGGG + Intergenic
905866403 1:41379406-41379428 TGGAGAAATGGGGAGGTGGGAGG + Intronic
906662174 1:47590719-47590741 CTGGTACATGGGAAGGTGGGAGG + Intergenic
906953141 1:50350441-50350463 CTGTGATATGGAAAGGAGGCAGG + Intergenic
907393054 1:54171187-54171209 GTGGGAGATCGGAAGGTGGGAGG + Intronic
907457725 1:54586103-54586125 CTGTGCAGTGGGTGGGTGGGTGG + Intronic
907717126 1:56936834-56936856 CTGTGAGAGGCCAAGGTGGGTGG - Intronic
908279185 1:62512652-62512674 CTGTGAGAGGCCAAGGTGGGAGG + Intronic
908486572 1:64600089-64600111 CTGTGAAATGGGTAGGAGAAAGG + Intronic
908768176 1:67572598-67572620 CTGTGAAATGGGAGTTTGGGAGG + Intergenic
908934824 1:69362656-69362678 CTGTCGAATGGGAAAGTGGGAGG - Intergenic
909134492 1:71780856-71780878 CTCAGAAGAGGGAAGGTGGGTGG - Intronic
909603129 1:77481275-77481297 CTGTAAAATGGAAGAGTGGGTGG + Intronic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
911075020 1:93864688-93864710 CTGTTCAATGGGGAGGTTGGGGG + Intergenic
911138317 1:94467306-94467328 CTGTGGGATGGGAAGGTTTGGGG - Intronic
911392018 1:97256947-97256969 GTGTGAAGTGGGAAGGTGGGTGG - Intronic
911627492 1:100141573-100141595 CTTTGGAAGGGTAAGGTGGGAGG - Intronic
912276092 1:108260598-108260620 CTGTGAAATGGAACAGAGGGAGG + Intergenic
912292136 1:108433760-108433782 CTGTGAAATGGAACAGAGGGAGG - Intronic
912361706 1:109100775-109100797 AGGAGAAATGGGAAAGTGGGAGG - Intergenic
912708717 1:111934165-111934187 CTGTAAAAGTGGGAGGTGGGAGG + Intronic
912971566 1:114288686-114288708 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
913301009 1:117368244-117368266 CTGTGATGTGGGAAGGAAGGCGG - Exonic
913600674 1:120418789-120418811 CTTTGAGATGCCAAGGTGGGAGG - Intergenic
914086384 1:144457844-144457866 CTTTGAGATGCCAAGGTGGGAGG + Intronic
914192278 1:145421795-145421817 CTTTGAGATGCCAAGGTGGGAGG + Intergenic
914222100 1:145690307-145690329 CTATGAAATGGAAAGGTGTAGGG - Intronic
914590184 1:149099739-149099761 CTTTGAGATGCCAAGGTGGGAGG + Intronic
914712270 1:150225424-150225446 CTGTGGGATGCCAAGGTGGGCGG + Intronic
914740865 1:150463897-150463919 CTTTGAAAAGCCAAGGTGGGAGG + Intronic
915079662 1:153343410-153343432 CTCTGAAAAGGGAAGGGGGTAGG - Intronic
915248138 1:154570370-154570392 AGGTGCAATGGGAAGGTTGGGGG + Intronic
916094409 1:161336213-161336235 CTTTGAGATGCCAAGGTGGGTGG + Intronic
916713316 1:167431108-167431130 CAGGGGCATGGGAAGGTGGGCGG - Exonic
916776871 1:167975794-167975816 CTGTGAGAGGCCAAGGTGGGAGG - Intronic
916809828 1:168295747-168295769 CTGGGAAACGGGGTGGTGGGGGG + Intronic
917102264 1:171458543-171458565 CTGTGAAAGTCCAAGGTGGGAGG + Intergenic
917106489 1:171497710-171497732 CTTTGAAAGGCGAAGGTGGGAGG - Intronic
917242214 1:172960690-172960712 CTGTGAAATGGGAATTTAGGTGG - Intergenic
917832318 1:178905209-178905231 CTTTGATATGGGAAGGAGGCTGG - Intronic
919540868 1:198843588-198843610 CTTTGAGATGCCAAGGTGGGTGG + Intergenic
919546001 1:198919599-198919621 CTGTTAACTGGTGAGGTGGGTGG - Intergenic
920035023 1:203060053-203060075 CTGTAAAATGGGAGAGTGAGGGG + Intronic
920329206 1:205193235-205193257 CTCTGAAAAGAGAAGATGGGAGG + Intronic
920940602 1:210478484-210478506 TGGTGAAATAGGAAGGTGAGGGG + Intronic
921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG + Intronic
921448845 1:215278959-215278981 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
922203392 1:223425996-223426018 CTATGGAGCGGGAAGGTGGGTGG - Intergenic
923762391 1:236858662-236858684 CTGTGAAAATGGAAGCAGGGTGG + Intronic
924064829 1:240210224-240210246 CTGTGGAATGTGTAGGTGGCAGG + Intronic
924172663 1:241357505-241357527 CTGTGCGATGGGTGGGTGGGTGG + Intergenic
924608606 1:245555828-245555850 CTGTGAAATGAGGACTTGGGGGG + Intronic
1063488114 10:6438839-6438861 CTTTGAAAGGCTAAGGTGGGAGG - Intronic
1063726961 10:8647800-8647822 CTGGGTAGTGGGAATGTGGGAGG + Intergenic
1063949400 10:11208173-11208195 CTGTAAAATGGGAGGGTGTGGGG + Intronic
1064598129 10:16966690-16966712 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1064642657 10:17430047-17430069 CTCAGAAAGGGGAAGATGGGAGG - Intronic
1064734769 10:18370541-18370563 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1066118323 10:32259735-32259757 CTTTGAGAGGGCAAGGTGGGAGG - Intergenic
1066195591 10:33096509-33096531 CTGTGAAATGTGATGTTGGCTGG - Intergenic
1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG + Intronic
1067092224 10:43273669-43273691 CTGTGCAAGGGGGCGGTGGGTGG + Intergenic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067899832 10:50228078-50228100 CTCTGAAAGGTCAAGGTGGGAGG + Intronic
1068510784 10:57963391-57963413 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1069421620 10:68251442-68251464 CTGTTAAAAGGGAATGAGGGCGG + Intergenic
1069563794 10:69450172-69450194 CTGAGAAAAGGCCAGGTGGGAGG + Intergenic
1069704742 10:70451262-70451284 AGGGGAAGTGGGAAGGTGGGAGG - Intergenic
1070334480 10:75442021-75442043 CTGTGCAAAGGGAAACTGGGAGG - Intronic
1070352655 10:75608333-75608355 CAGGGAAATGGGAAGGTTGTTGG + Intronic
1070885383 10:79892121-79892143 CTTTAGATTGGGAAGGTGGGGGG - Intergenic
1070984225 10:80674208-80674230 TTGTGAAATGTGGAGGTGGGAGG - Intergenic
1071752619 10:88497786-88497808 CTGTCCAAAGGGAAGGTGTGAGG + Intronic
1072671423 10:97432586-97432608 GTGTGACATGTGCAGGTGGGAGG - Exonic
1072726396 10:97816668-97816690 GTGAGAAATGGGATGGTGGCTGG + Intergenic
1072815869 10:98508764-98508786 CTGTGAGATGGGAAGGAGTTTGG + Intronic
1073011007 10:100359577-100359599 GTGTGAACTGGGGAGGAGGGGGG - Intronic
1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG + Intronic
1073557693 10:104468455-104468477 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1073649527 10:105343747-105343769 CTATGGAATGGGTGGGTGGGTGG - Intergenic
1074270169 10:111945524-111945546 CTGTGAAATAGCAAGGATGGCGG - Intergenic
1075077931 10:119363686-119363708 CTGGGAAGAGGGAAGCTGGGAGG + Intronic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1077176614 11:1193995-1194017 CTGTGAGATGAGACGGTGGGGGG + Intronic
1077243094 11:1521671-1521693 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
1077274547 11:1697840-1697862 CTGGGAACTGGGAAGGTGTTGGG - Intergenic
1077333659 11:1994155-1994177 CTGTGCACTGGGAATGGGGGTGG + Intergenic
1077498475 11:2898089-2898111 CTGAGAAATGGGACTGTGGCTGG - Intronic
1077756378 11:5033236-5033258 CTGTAAAATAGGAAGATAGGAGG + Intergenic
1078162587 11:8854630-8854652 CTTTGAGAGGGCAAGGTGGGAGG + Intronic
1078331878 11:10429090-10429112 CCATGAAATGGGAAGGTGGGAGG - Intronic
1078467621 11:11561865-11561887 AGGTGAAATGGGAGGGTGTGTGG - Intronic
1079159034 11:17975537-17975559 CTATGAGATGGGGAGATGGGTGG - Intronic
1079282732 11:19102470-19102492 CTGTGAAGTGGCATGGGGGGTGG - Intergenic
1079785603 11:24667557-24667579 CTGTGTAATGGGGAGCTGAGTGG + Intronic
1079939499 11:26660741-26660763 CAGTGTAATGGGAAAGAGGGTGG + Exonic
1080013052 11:27477400-27477422 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1080406211 11:31981711-31981733 CAGTGAAAAGGGAGGGTGTGGGG + Intronic
1080784103 11:35459336-35459358 CTGTCAAATGGGAATGTGTCAGG - Intronic
1080831299 11:35895645-35895667 CTTTGGAAGGGCAAGGTGGGCGG + Intergenic
1081094498 11:38916375-38916397 CTTTGAGATGCCAAGGTGGGCGG - Intergenic
1081709199 11:45206152-45206174 CTGTGAAATGGGTACCAGGGTGG + Intronic
1082054772 11:47804891-47804913 CTTTGGAAGGGTAAGGTGGGAGG + Intronic
1082715156 11:56603241-56603263 CTGTGGAAAGGGAAGGGGAGAGG - Intergenic
1082731936 11:56809076-56809098 CTATGAGATGAGAAGATGGGTGG - Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1083110199 11:60398906-60398928 TTGTGAAATGAGAAAGTGAGGGG - Intronic
1083172172 11:60929482-60929504 GGGTGAACTGGGTAGGTGGGTGG - Intronic
1083655867 11:64229369-64229391 CTGGGTCTTGGGAAGGTGGGTGG + Intronic
1083821649 11:65174951-65174973 GTGTGACATGTGCAGGTGGGAGG + Intergenic
1084096536 11:66915182-66915204 CTGTGAAATGGAGTGGAGGGCGG - Intronic
1084341726 11:68508371-68508393 CTGTGAGAGGTGGAGGTGGGTGG - Intronic
1084546433 11:69817353-69817375 CTGCGCACTGGGAAGGCGGGAGG - Intronic
1084601353 11:70147616-70147638 TTGGGAAATCAGAAGGTGGGAGG + Intronic
1084777346 11:71386326-71386348 CTTTGGAGTGAGAAGGTGGGAGG + Intergenic
1085045039 11:73347773-73347795 CTGACAGCTGGGAAGGTGGGTGG + Intronic
1085087749 11:73682770-73682792 CTTTGGAATGCCAAGGTGGGAGG - Intronic
1085324011 11:75592898-75592920 CTGTAAAATGGGAAGGAGCAGGG - Intronic
1085776666 11:79372680-79372702 CTGTGAAATGGGAGGGGAGGGGG + Intronic
1086870767 11:92033886-92033908 GGGTGAAGTGGGGAGGTGGGGGG - Intergenic
1087070022 11:94069362-94069384 CTTTGAAAGGCTAAGGTGGGAGG - Intronic
1087191118 11:95255693-95255715 CTGTGGAATGGAGAGGTGGCTGG - Intergenic
1087363604 11:97192101-97192123 CTCTGAAAAGGGTGGGTGGGAGG - Intergenic
1088368773 11:109066366-109066388 TTGTGAGATGGGAAGGAAGGTGG + Intergenic
1088930280 11:114344340-114344362 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089648209 11:119894123-119894145 CTGTAAAATGGGGAGTTGGGGGG + Intergenic
1090520855 11:127477464-127477486 TTGTGGAATGGGGATGTGGGTGG - Intergenic
1090739094 11:129640916-129640938 CTGTGAAATGAGTGAGTGGGAGG + Intergenic
1091058257 11:132438865-132438887 TGGGGAAATGGGTAGGTGGGTGG - Intronic
1202816640 11_KI270721v1_random:49337-49359 CTGTGCACTGGGAATGGGGGTGG + Intergenic
1091657593 12:2356824-2356846 CTGTGGAATGGGAATGCAGGTGG - Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091799182 12:3313947-3313969 CTGAGTAATGGGAAGGGTGGAGG - Intergenic
1091837129 12:3593999-3594021 CTGTGAAGTGGGAGGGCTGGGGG + Intergenic
1092988859 12:13875283-13875305 CTGTGAGAGGCCAAGGTGGGTGG + Intronic
1093832790 12:23784831-23784853 CTTTGAGAGGGTAAGGTGGGAGG + Intronic
1094639815 12:32262898-32262920 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
1095297359 12:40542251-40542273 CTGTGAGATAGAAAGGAGGGGGG - Intronic
1095792757 12:46185445-46185467 CTGTAAAAAAGGAAAGTGGGTGG + Intronic
1096503811 12:52080818-52080840 CTGGGGAATGGGGAGGTGTGTGG + Intergenic
1097548904 12:61041656-61041678 CTGTGGAATGGAAAGGTAGAGGG - Intergenic
1097875491 12:64639093-64639115 CTTTGAAATGGGAAGCTCTGAGG + Intronic
1098336847 12:69413167-69413189 CTGTGAGAGGCCAAGGTGGGAGG + Intergenic
1098447054 12:70576646-70576668 CTGTGATTTTGAAAGGTGGGGGG + Intronic
1098791800 12:74833574-74833596 CTGAGGAATGGGGGGGTGGGAGG + Intergenic
1099537021 12:83857624-83857646 CTGGGAACAGGGAAGTTGGGTGG + Intergenic
1100013031 12:89976545-89976567 CTGTTTAATGGGGAGCTGGGGGG + Intergenic
1100116864 12:91316478-91316500 CACTGAGATAGGAAGGTGGGAGG - Intergenic
1100121621 12:91375267-91375289 CTGGGCAAAGGGAAGGCGGGTGG + Intergenic
1100336965 12:93640738-93640760 GTGTGACATGTGCAGGTGGGAGG + Intergenic
1100847421 12:98674379-98674401 CTGGAAAGTGGGAAGGTAGGAGG - Intronic
1101361497 12:104031605-104031627 GTGTGACATGTGCAGGTGGGAGG - Intronic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101496935 12:105263618-105263640 ATGTGTAATGGGAACATGGGAGG - Intronic
1101618613 12:106361883-106361905 CTGTGGAAAGGGAATGTGAGGGG + Intronic
1101815485 12:108143055-108143077 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1101863494 12:108501809-108501831 CTGTGAGAGGCCAAGGTGGGAGG + Intergenic
1101879511 12:108616854-108616876 CTGTGGAAGGCCAAGGTGGGCGG - Intergenic
1102169140 12:110828891-110828913 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
1102414474 12:112748576-112748598 CTTTGAGATGCCAAGGTGGGAGG - Intronic
1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG + Intronic
1102666669 12:114580072-114580094 CTGTGGGAGGCGAAGGTGGGGGG + Intergenic
1102977226 12:117215325-117215347 CTGTGGAAAGAGAAGTTGGGGGG + Intronic
1103478030 12:121232818-121232840 CTTGGAGAAGGGAAGGTGGGAGG - Intronic
1103766505 12:123283967-123283989 CTGTGGGAGGGCAAGGTGGGTGG - Intergenic
1103921817 12:124403169-124403191 CTGTAAAACGGGGAGGTGGGGGG + Intronic
1103922284 12:124405251-124405273 CTGTAAGATGGACAGGTGGGTGG - Intronic
1103950231 12:124546654-124546676 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1103984712 12:124759600-124759622 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1104147320 12:126047632-126047654 CTTTGAAAAGCCAAGGTGGGAGG - Intergenic
1104295492 12:127508144-127508166 CTGTAAAATGGGTAGGAGGATGG + Intergenic
1104361618 12:128138490-128138512 CTGTGAGGTAGGAAGCTGGGGGG - Intergenic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1105318446 13:19291030-19291052 CAGAGAAATGGGTACGTGGGAGG + Intergenic
1106131507 13:26943444-26943466 ATGTGAAATGGGAAAGAGAGAGG + Intergenic
1106265620 13:28107025-28107047 ATATGAAATGGGAAGGTTGAGGG + Intergenic
1106456159 13:29929190-29929212 ATGGGAAATGGGGAGGAGGGAGG + Intergenic
1107317699 13:39151262-39151284 ATGTAAAAGGGAAAGGTGGGGGG + Intergenic
1108010702 13:46005848-46005870 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
1108090922 13:46849106-46849128 CTGGGATAAGGAAAGGTGGGGGG - Intronic
1108385555 13:49896219-49896241 CTGTGGAAGGTCAAGGTGGGTGG + Intergenic
1108513097 13:51172694-51172716 CTTTGAATTGGGAAGAAGGGCGG - Intergenic
1109392219 13:61707981-61708003 CAGTCAAATGGGAATGTGGTGGG - Intergenic
1109646215 13:65261441-65261463 CAGTGAAATGGGAAAATGAGTGG - Intergenic
1110222570 13:73089288-73089310 CTTTGGAAGGGCAAGGTGGGAGG - Intergenic
1111302150 13:86361233-86361255 CTTTGAATTGGGAAGAAGGGCGG - Intergenic
1111359245 13:87153001-87153023 GTGGGGAATGGGAAGGGGGGAGG + Intergenic
1111593939 13:90387801-90387823 CTGTGAGAGGTCAAGGTGGGAGG + Intergenic
1111987346 13:95078512-95078534 CTTTGCACTGGGAAGGTGGCAGG + Intronic
1112403762 13:99099658-99099680 CTTTGAGATGCCAAGGTGGGCGG + Intergenic
1112573584 13:100615694-100615716 CTGTGGGATGCCAAGGTGGGCGG - Intronic
1113750711 13:112774916-112774938 CCGTGACGGGGGAAGGTGGGAGG - Intronic
1113791575 13:113031603-113031625 CTGGGAGATGGGGAGGAGGGCGG + Intronic
1114315371 14:21505057-21505079 CTGTGAGAGGCCAAGGTGGGAGG + Intronic
1114469894 14:22953378-22953400 CTTTGAGATGCCAAGGTGGGAGG - Intronic
1115196234 14:30803011-30803033 CTATGGAAGAGGAAGGTGGGAGG - Intergenic
1115488290 14:33934181-33934203 CTGGGAATGGGGATGGTGGGAGG - Intronic
1115925934 14:38434665-38434687 CTGTGAGATGCCAAAGTGGGAGG - Intergenic
1115986440 14:39107176-39107198 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1116019013 14:39439492-39439514 CTATGAAAGGCTAAGGTGGGAGG - Intergenic
1116151376 14:41145791-41145813 CTGCCAACTGGGAAGGTGTGGGG + Intergenic
1116175630 14:41466541-41466563 CTTTGAAATGGGAAGATAGTAGG - Intergenic
1116256927 14:42569096-42569118 CTGTAAAATGGGAAGGTCTATGG - Intergenic
1117059745 14:51949981-51950003 CTCTGAAAGGTCAAGGTGGGAGG - Intronic
1117143113 14:52810009-52810031 GTCTGAAGTGGGGAGGTGGGGGG - Intergenic
1117162035 14:52999437-52999459 CTGTGAATGTAGAAGGTGGGGGG + Intergenic
1117162400 14:53002231-53002253 CTGGGAGATGAGAAGGAGGGAGG - Intergenic
1117386660 14:55221069-55221091 CTTTGAAAGGTCAAGGTGGGCGG + Intergenic
1117405005 14:55393483-55393505 CTGAGAAATGGGAAGGAGTCAGG - Intronic
1117461801 14:55952748-55952770 CTCTGTAATTGGAAGGAGGGAGG + Intergenic
1118018319 14:61684387-61684409 CTATGGAATGTGGAGGTGGGGGG - Intergenic
1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG + Intronic
1118626212 14:67661775-67661797 CTTTGAGATGCCAAGGTGGGAGG - Intronic
1118935537 14:70284618-70284640 CTTGGAAATGGGAATGTGGCAGG - Intergenic
1119054352 14:71403987-71404009 CTGTGATGTGGGTGGGTGGGTGG - Intronic
1119577563 14:75740613-75740635 CTTTGAAATTGGCAGGTGGAGGG - Intronic
1119831181 14:77703839-77703861 CTTTGAGATGCCAAGGTGGGTGG - Intronic
1119855867 14:77900288-77900310 CTTTGAAATGGGACGGAGGCTGG + Intronic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121001831 14:90456648-90456670 CTGTGCAGTGGGGAGGTGGGAGG - Intergenic
1121245918 14:92460770-92460792 CTGATAAGTGGGGAGGTGGGAGG + Intronic
1121794737 14:96725514-96725536 CTGTGGGCTGGGAAGGTGGGAGG - Intergenic
1122148175 14:99706538-99706560 CTGTGCAGAGTGAAGGTGGGTGG - Intronic
1122970932 14:105151926-105151948 CTGTGAGAAGGGTACGTGGGGGG - Exonic
1123106609 14:105844771-105844793 CTGAGGAATGAGCAGGTGGGTGG + Intergenic
1202835425 14_GL000009v2_random:74546-74568 GAGTGAAAGGTGAAGGTGGGGGG + Intergenic
1202843877 14_GL000009v2_random:149001-149023 GTGTGAAGTGGGAAAATGGGGGG + Intergenic
1124193469 15:27600052-27600074 CAGTTAGATGGGAAGATGGGAGG + Intergenic
1125783422 15:42292136-42292158 CTGTGAAATTGGAGGCTGGTGGG + Intronic
1126166210 15:45656196-45656218 CTGTTAAATGGGAATGATGGTGG + Intronic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1126649592 15:50908094-50908116 CTGGGATTTGGGGAGGTGGGCGG - Intergenic
1126813113 15:52428689-52428711 CTGTGATATTGGAAGGTGCTAGG - Intronic
1127441116 15:59009200-59009222 CTTTGAAAGGCCAAGGTGGGCGG - Intronic
1127465650 15:59241975-59241997 CTGTGATGTGGGAAGCTGGGAGG + Intronic
1127654459 15:61043330-61043352 CTGTGAGATGAGGAGTTGGGAGG - Intronic
1127664911 15:61136195-61136217 CTTTCAGATGGGAGGGTGGGTGG - Intronic
1127965815 15:63922160-63922182 CAGTGAGATAGGAAGGTGGGTGG - Intronic
1128166851 15:65473081-65473103 CTGGGAGGTGGCAAGGTGGGAGG + Intronic
1128214710 15:65926298-65926320 CTGTGGCATGAGAAGGTTGGTGG + Intronic
1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG + Intronic
1128999257 15:72319461-72319483 CTGTGATCTGGGAAGGGGGCTGG + Intronic
1129238307 15:74236868-74236890 CTGTGAAATGGGGAGTGAGGTGG + Intronic
1129823570 15:78620296-78620318 CCGTCAAATGAGGAGGTGGGCGG + Intronic
1129854984 15:78817175-78817197 CTTTGAGAGGGTAAGGTGGGAGG + Intronic
1130097524 15:80867084-80867106 CTGTAAAATGGGGAGGGTGGGGG + Intronic
1131053655 15:89363281-89363303 CTCTGAAATGGGAAGTTGTTGGG + Intergenic
1131134834 15:89926345-89926367 CTCTGAGAGGTGAAGGTGGGAGG + Intergenic
1131901275 15:97090296-97090318 CTTTGAGAAGGGAAGGTGGCTGG - Intergenic
1132319922 15:100918476-100918498 CTGTGAAATGGCAGTGAGGGTGG + Intergenic
1132471056 16:103382-103404 CTTTGAAAAGCCAAGGTGGGAGG - Intronic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG + Intergenic
1133652883 16:7829601-7829623 CTTTAAAAGAGGAAGGTGGGTGG - Intergenic
1134009984 16:10844716-10844738 CTTTGAAAGGCGGAGGTGGGAGG - Intergenic
1134060058 16:11194027-11194049 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1134630735 16:15753960-15753982 CTGTGGAAGGCCAAGGTGGGTGG + Intronic
1135257842 16:20955541-20955563 CTGTGGGATGGTGAGGTGGGAGG - Intronic
1135624590 16:23982752-23982774 CTGTAATAAGGGAGGGTGGGAGG + Intronic
1135941928 16:26829312-26829334 CTTTGAAAGGTCAAGGTGGGTGG + Intergenic
1136508830 16:30723485-30723507 CTGGGAAATGGGAAGCTTGGGGG + Intronic
1136522128 16:30803901-30803923 CTTTGAGAAGCGAAGGTGGGTGG - Intergenic
1137603088 16:49769749-49769771 GTGTGAAATGAGGTGGTGGGGGG - Intronic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1137701696 16:50502358-50502380 CTGGGAGATGGGAAGGAGGTAGG + Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1137774383 16:51043235-51043257 TTGAGACAGGGGAAGGTGGGTGG - Intergenic
1138212238 16:55173305-55173327 CTGTGAAGGGGGAAGGAGTGGGG + Intergenic
1138231723 16:55342448-55342470 CTGTGGAAAGCCAAGGTGGGAGG + Intergenic
1138903388 16:61301444-61301466 CTTTGGAATGGGGTGGTGGGTGG + Intergenic
1138923736 16:61565673-61565695 CTTTGAGATGCCAAGGTGGGTGG + Intergenic
1139356728 16:66371265-66371287 CTGTGGAATGGGAAAGCGGTGGG + Intronic
1139774147 16:69303574-69303596 CTGTGAAATGAAAGTGTGGGAGG + Exonic
1139875867 16:70145508-70145530 CAGTTAGGTGGGAAGGTGGGAGG - Intronic
1140295084 16:73702162-73702184 GTGTGAACGGGGAGGGTGGGGGG - Intergenic
1140314275 16:73879509-73879531 ATGAGAAATGGGAAGGAGGTAGG + Intergenic
1140359920 16:74335590-74335612 CAGTTAGGTGGGAAGGTGGGAGG + Intergenic
1140407653 16:74721727-74721749 CTGTGAAGTAGGAAGCTGGGTGG - Intronic
1140517407 16:75553978-75554000 ATGTGATAGGGGATGGTGGGAGG - Intronic
1140588043 16:76317923-76317945 CTGTCAAATGGGAAACTGGGGGG + Intronic
1140952500 16:79832793-79832815 CTGAGAAATGGGACCCTGGGTGG + Intergenic
1141112937 16:81285134-81285156 ATGAGAAATGGGAAGCTGGCTGG - Intronic
1141251648 16:82364088-82364110 GTGTGGAGTGGGAGGGTGGGGGG + Intergenic
1141416922 16:83882836-83882858 ATGTGAAATGGGAAGTTTTGGGG + Intergenic
1141585376 16:85030006-85030028 CTGTGGAATGGGAAGTGGGGCGG + Intronic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1142233715 16:88911603-88911625 CTGTAAAATGGGAATGGGGATGG + Intronic
1142262620 16:89049989-89050011 CTGTGAAATTCGGAGGTGGAGGG + Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142326215 16:89416539-89416561 CTTTGAGATGTCAAGGTGGGTGG - Intronic
1142696961 17:1639108-1639130 CCGTGAAATGGGCAGCGGGGTGG - Intronic
1142791681 17:2271468-2271490 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
1143032987 17:3978031-3978053 CTGTGAAGTGGGAAGCACGGCGG + Intergenic
1143329347 17:6121967-6121989 CAGGGAGGTGGGAAGGTGGGTGG + Exonic
1143464923 17:7130348-7130370 CTTTGAGATGCCAAGGTGGGTGG + Intergenic
1144113499 17:12062891-12062913 CTGGGAAAAGGGAAGAGGGGAGG - Intronic
1144421914 17:15106702-15106724 CTGTGAAGAATGAAGGTGGGTGG - Intergenic
1144497087 17:15754819-15754841 CTGGGAAGTGGCATGGTGGGGGG - Intergenic
1144625152 17:16840672-16840694 GGGTGAAATGGGAAGGAGTGAGG - Intergenic
1144847818 17:18229203-18229225 CTGTGAAAGGGGCAGGGGAGCGG + Intronic
1144881277 17:18432049-18432071 GGGTGAAATGGGAAGGAGTGAGG + Intergenic
1145150955 17:20512337-20512359 GGGTGAAATGGGAAGGAGTGAGG - Intergenic
1145295350 17:21587340-21587362 CTTTGAGATGCCAAGGTGGGTGG - Intergenic
1146286024 17:31574680-31574702 CTTTGAAATGGGAGAGAGGGTGG + Intronic
1146532747 17:33623880-33623902 GTGACAGATGGGAAGGTGGGGGG - Intronic
1147001677 17:37367822-37367844 CTGTGAGAGGCCAAGGTGGGTGG + Intronic
1147257256 17:39189119-39189141 CTTTGAAAGGCTAAGGTGGGTGG + Intronic
1147579305 17:41619371-41619393 GGGTGAAATGGGAAGGAGTGAGG - Intergenic
1148150609 17:45394728-45394750 CTGTAAAATGGGATGGTGTGTGG + Exonic
1148151621 17:45399921-45399943 CTTTGGAAGGGCAAGGTGGGAGG + Intronic
1148326450 17:46786063-46786085 CTGTGAAATGAAGGGGTGGGGGG - Intronic
1148353514 17:46958237-46958259 CTGTAAAATGTGAAGGTTGACGG - Intronic
1148377065 17:47158194-47158216 ATGTGAAATAGGTAGGTGGGTGG - Exonic
1148382273 17:47208823-47208845 CTGTGAGTTGGGAGGGTGTGGGG + Intronic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1151210066 17:72537842-72537864 CTTTGAGAGGGCAAGGTGGGCGG - Intergenic
1151322440 17:73360001-73360023 CTGAGAGGTGGGGAGGTGGGAGG - Intronic
1151623194 17:75259904-75259926 CTTTGTAAGGGAAAGGTGGGAGG + Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151979430 17:77499782-77499804 CTCTGAGCTGGGGAGGTGGGAGG + Exonic
1152302595 17:79503968-79503990 CAAGGAAATGGGAAGGTGGGTGG + Intronic
1152642258 17:81454175-81454197 ATGTGAAATGGGGCAGTGGGAGG + Intronic
1152769610 17:82159108-82159130 CTTTGGAATGGTGAGGTGGGAGG - Intronic
1153019565 18:614574-614596 GTGAGAAATGGGAGGGTGAGAGG - Intronic
1153243898 18:3055054-3055076 CTTTGAGAAGGCAAGGTGGGAGG + Intergenic
1153799848 18:8659433-8659455 CTGTGAATTGGGACGATGCGCGG + Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154344176 18:13528554-13528576 CTTTGGAAGGTGAAGGTGGGTGG - Intronic
1155261001 18:24042398-24042420 CTGTGAACTGTGCACGTGGGGGG - Intronic
1155995831 18:32330684-32330706 CATTTAAATGGGAGGGTGGGAGG + Intronic
1156449666 18:37259711-37259733 CTGCGAGAAGGGAAAGTGGGGGG - Intronic
1157326092 18:46669668-46669690 CTTGGAGATGGGAAGGTGGAAGG + Intronic
1157543188 18:48526872-48526894 AGGTGAAATGGGAAGATGGGAGG + Intergenic
1157773422 18:50371169-50371191 CTGTGAACTTGGAAAGTGGATGG - Intergenic
1157990247 18:52487118-52487140 CTGTGGACTGGGAGGGTTGGTGG + Intronic
1158267552 18:55677012-55677034 CTGAGAAATGTGGTGGTGGGGGG + Intergenic
1160717665 19:583687-583709 CTGGGAACTTGGAAGGTGGCTGG + Intergenic
1160833873 19:1115712-1115734 CCCTGAAAACGGAAGGTGGGAGG + Intronic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1160976786 19:1796682-1796704 CTCAGAGATGGGGAGGTGGGTGG + Intronic
1161030007 19:2053440-2053462 CTTTGAAAAGCCAAGGTGGGAGG - Intergenic
1161473260 19:4471978-4472000 AGGTGAAAGGGAAAGGTGGGAGG - Intergenic
1161635613 19:5387030-5387052 CTGTAAAATGGGGATGTGTGTGG - Intergenic
1161846343 19:6713736-6713758 CTGGGAGTGGGGAAGGTGGGGGG - Intronic
1162087985 19:8260012-8260034 CTGTGAGATGGGGAGATGGTGGG + Intronic
1162726863 19:12695108-12695130 CTGGGAAATGGGCAGGCAGGTGG - Intronic
1162799100 19:13101267-13101289 CCCTCAAATGGGAAGGAGGGAGG + Intronic
1162873771 19:13605752-13605774 CTGTGAAATGGGAAGAAGAATGG - Intronic
1162939098 19:13997385-13997407 CTGTGAAATGGGAGGACGGCTGG + Intronic
1163229297 19:15989303-15989325 CTCAGAAGAGGGAAGGTGGGAGG - Intergenic
1163242268 19:16071554-16071576 CTGTGAAATGGGAACACGTGAGG + Intronic
1163282991 19:16328404-16328426 CTGAGAATGGGGAAGGTGAGGGG - Intergenic
1163450621 19:17375063-17375085 CTGTGAGAGGCCAAGGTGGGTGG - Intronic
1163468015 19:17480619-17480641 CTTTGAAAGGTCAAGGTGGGAGG - Intronic
1164647293 19:29868686-29868708 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1164821007 19:31251266-31251288 CTCTGAAATGGGAAGGATGCAGG - Intergenic
1164847860 19:31449749-31449771 CTGTGAGAGGCCAAGGTGGGTGG + Intergenic
1164973562 19:32552947-32552969 CTTTGAGAGGTGAAGGTGGGAGG + Intergenic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165683974 19:37802148-37802170 CTGTGAACTGTGCATGTGGGGGG - Intronic
1166058805 19:40311600-40311622 CTGTGAAAGCGCAAGGTGTGGGG - Intergenic
1166189351 19:41165475-41165497 CTTTGTAAGGCGAAGGTGGGCGG + Intergenic
1166407104 19:42529049-42529071 CTGTGATAGAGGGAGGTGGGTGG + Intronic
1166565966 19:43765680-43765702 ATGTGAAACGGGTATGTGGGTGG + Intergenic
1166708650 19:44923217-44923239 CTTTGAGATGCCAAGGTGGGAGG + Intergenic
1166822028 19:45586461-45586483 CTGTAAAATGGGAAGGGGGCTGG - Intronic
1166881112 19:45930690-45930712 CTGGGAAGGGGGAAGGAGGGAGG - Intergenic
1166939285 19:46353055-46353077 CTGTCAAATGGGCACGAGGGAGG + Intronic
1167146716 19:47685227-47685249 CTGTGAGAAGCCAAGGTGGGAGG - Intronic
1167323923 19:48812651-48812673 CTGTAGAATAGGAAGGTGGCTGG - Intergenic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG + Intergenic
1167793514 19:51694602-51694624 CTAAGAAATGGGTATGTGGGAGG + Intergenic
1167929787 19:52854779-52854801 CTCTGAAAGGCCAAGGTGGGTGG + Intronic
925351149 2:3201395-3201417 GAGTGAAATAGGAAGGTGGGAGG - Intronic
925410544 2:3637425-3637447 CTGTGATGTAGGAAGGAGGGCGG + Intronic
925773442 2:7307394-7307416 CTGAGAAATTGGAAGGTGACTGG - Intergenic
925989866 2:9246010-9246032 CTGTGAAAAGGACAGGAGGGTGG + Intronic
926009437 2:9396518-9396540 CTCTGAAAGGCCAAGGTGGGAGG - Intronic
926294368 2:11558112-11558134 CTGTGATTTGGGAAGATGGAAGG + Intronic
927368509 2:22327370-22327392 CTTTGAGATGCCAAGGTGGGAGG + Intergenic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
927670656 2:25066110-25066132 GTGTGACGTGGGGAGGTGGGGGG - Intronic
928448147 2:31351124-31351146 CTGGGAAATAGGAAGCTGGTAGG - Intronic
928915314 2:36464377-36464399 CTGGGAAATGGGAAGGCAGGAGG - Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929677187 2:43948200-43948222 CTGTGAGAAGGGAAGGGAGGGGG + Intronic
929752671 2:44732195-44732217 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
929766908 2:44851741-44851763 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
930002951 2:46873588-46873610 CTGTGCAATGGGGTGGTGGTGGG - Intergenic
930027862 2:47040332-47040354 CTGGGAAAGGGGAAGGAGCGTGG - Intronic
932202405 2:69842910-69842932 ATTTGAAAATGGAAGGTGGGGGG - Intronic
932233991 2:70106503-70106525 CTTTGAAAGGCCAAGGTGGGCGG + Intergenic
932315392 2:70778131-70778153 CTTTGAAATGTAAAGGAGGGTGG - Intronic
932716020 2:74101225-74101247 CTGTGAAGTGGGAAGGGGCCAGG - Exonic
932723410 2:74157133-74157155 CTGTGATCTGGGAAGGGGAGAGG - Intronic
933395722 2:81728506-81728528 ATGTGAACTTGGGAGGTGGGTGG + Intergenic
933674783 2:85045001-85045023 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
935126075 2:100223991-100224013 CTGTGAAGTGGGCAGTTGGTGGG - Intergenic
935296630 2:101655451-101655473 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
935593017 2:104857724-104857746 CTCTGAAATGGGAAGGAGGGGGG + Exonic
935944074 2:108270224-108270246 CTTCCAGATGGGAAGGTGGGTGG - Intergenic
936441187 2:112554935-112554957 CTTTGAGATGCCAAGGTGGGTGG + Intronic
937387805 2:121452948-121452970 TTGTGAATTGGGAAGGTTGTAGG - Intronic
937705682 2:124918181-124918203 CTGAGAAAAGGGAAGGAGAGGGG - Intergenic
937770239 2:125712384-125712406 CTGTGAAATGGGAATGTTAATGG + Intergenic
938044619 2:128106791-128106813 CTTTGGAAGGGGCAGGTGGGTGG - Intronic
938861488 2:135374161-135374183 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
938877988 2:135553931-135553953 CTTTGAGAAGGCAAGGTGGGCGG - Intronic
939245272 2:139615575-139615597 TTTTGAAATGGGAAGATGAGTGG + Intergenic
939306084 2:140414157-140414179 CTTTGAAAGGTAAAGGTGGGAGG - Intronic
939732379 2:145800403-145800425 CAGTGCAAAGGGAAGATGGGGGG + Intergenic
939971694 2:148669431-148669453 CTTTGAAAGGGCAAGGTGGGAGG + Intronic
940451355 2:153842119-153842141 CTGTGGGATGGGGAGGTGGGGGG + Intergenic
941180888 2:162258052-162258074 CTGTGAAATGGATTGTTGGGGGG - Intergenic
941185189 2:162313965-162313987 CTGTGTAAATGGAAGGTGTGTGG + Intronic
941190467 2:162375682-162375704 CTTTGAGATGCCAAGGTGGGTGG + Intronic
942362020 2:175182055-175182077 CTGTGAAATAGGACTGTGGCTGG + Exonic
942579413 2:177401421-177401443 CTGTGAAATGGGCAGTTGTGAGG - Intronic
942715020 2:178882126-178882148 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
944294507 2:198047423-198047445 CTTTGAAAGGCCAAGGTGGGCGG - Intronic
944320831 2:198339819-198339841 TTGGGAACTGGGTAGGTGGGGGG + Intronic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945541844 2:211097654-211097676 CTTTGAAAAGCCAAGGTGGGTGG - Intergenic
946349975 2:219143955-219143977 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
946896375 2:224328394-224328416 TTGAGAAATGGGAGTGTGGGAGG - Intergenic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
947784860 2:232807813-232807835 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
948543378 2:238705597-238705619 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
948633842 2:239321220-239321242 CTTTGGAAGGTGAAGGTGGGCGG + Intronic
949062989 2:241972155-241972177 CTGTGGCCTGGGAAGGTGGGTGG + Intergenic
1169034495 20:2438508-2438530 CTTTGAGATGCCAAGGTGGGCGG + Intergenic
1169278909 20:4250762-4250784 CTGGGCAATGGGGAGGAGGGAGG - Intergenic
1169338540 20:4777313-4777335 TTTTGAAAGGGTAAGGTGGGTGG - Intergenic
1169431368 20:5539280-5539302 CTTTCAGAGGGGAAGGTGGGTGG + Intergenic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1171844851 20:30261377-30261399 CTTTGAGAGGGCAAGGTGGGTGG - Intergenic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1172088888 20:32412800-32412822 CTTTGGAATGGCAAGGCGGGAGG - Intronic
1172292549 20:33786723-33786745 CTTTGGAAGGTGAAGGTGGGTGG + Intronic
1172397413 20:34618536-34618558 CTTTGAAAGGCAAAGGTGGGAGG + Intronic
1172726467 20:37046854-37046876 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1172771279 20:37384069-37384091 CTGTGGAATGGGTGGGAGGGAGG + Intronic
1172937188 20:38628828-38628850 CTGTGAAAAGGGGTTGTGGGTGG + Intronic
1172948616 20:38707308-38707330 CTTTGAAAGGCCAAGGTGGGCGG - Intergenic
1173299503 20:41789215-41789237 CTGTCAACAGGGAAAGTGGGGGG + Intergenic
1173526737 20:43738525-43738547 CTTTGGAAGGGTAAGGTGGGTGG + Intergenic
1173570761 20:44074592-44074614 CAGAGAGATGGGCAGGTGGGTGG - Intergenic
1173673324 20:44812797-44812819 CTGTGAGATGGGAGGGTTTGGGG - Intergenic
1174858343 20:54067751-54067773 CTGTTGAATGGGAGGGGGGGTGG + Intronic
1175281198 20:57805145-57805167 GTGTGAAATGGGAACATGGCAGG - Intergenic
1175498065 20:59428884-59428906 CAGTGAAGTGGGAACATGGGAGG + Intergenic
1175608208 20:60328687-60328709 CTGTGAATTAGGGAGGTGGAGGG - Intergenic
1175654763 20:60760533-60760555 CTCTGTAGTGGGGAGGTGGGTGG - Intergenic
1175739993 20:61413499-61413521 CTGTAAACTGGGGAGGTGGTGGG + Intronic
1177169813 21:17642584-17642606 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1178576638 21:33798341-33798363 CTCTGAAAGGCCAAGGTGGGAGG - Intronic
1179387660 21:40957778-40957800 CTTTGAATTGGGAAGAAGGGTGG - Intergenic
1179429104 21:41306899-41306921 ATGTCAAATGGGAAGGAGGAAGG - Intronic
1179593575 21:42427563-42427585 CTGTAAAATGGGTAGGGGGCAGG - Intronic
1179708225 21:43194668-43194690 CTGAGAAATGAGGAGGGGGGAGG - Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180636957 22:17269240-17269262 CTAGGAAAGGTGAAGGTGGGGGG + Intergenic
1180901312 22:19375429-19375451 CCTTGAAGTGGGAAGGTGGCTGG - Intronic
1180983313 22:19889717-19889739 CTTTGGAATGCCAAGGTGGGAGG - Intronic
1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG + Intergenic
1181063450 22:20293253-20293275 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1181775850 22:25159662-25159684 CTGTAAAATGGGAAGCTTGGAGG - Intronic
1182663426 22:31941255-31941277 CTGTAAAACGGGAAGGAGGCCGG + Intronic
1182939290 22:34259431-34259453 CTGATACCTGGGAAGGTGGGTGG - Intergenic
1183327937 22:37204557-37204579 ATGAGAAATGGGCAGTTGGGGGG - Exonic
1183330255 22:37216190-37216212 CTGTGGGATGGGGGGGTGGGAGG - Intergenic
1183449336 22:37883051-37883073 CTTTGAGAGGCGAAGGTGGGCGG + Intronic
1183467869 22:37988920-37988942 CTATGCACTGGGAAGGTGGAGGG + Intronic
1184480048 22:44741061-44741083 CTTTGAGAGGGCAAGGTGGGTGG + Intronic
1184502014 22:44880063-44880085 CTCTGAGATGGGGAGGTGGGAGG + Intergenic
1184647120 22:45902351-45902373 CTGTGAGATGCCAAGGTGGGAGG - Intergenic
1184894790 22:47400608-47400630 CTGTAAATTGGGAGTGTGGGTGG - Intergenic
949462646 3:4309614-4309636 GTGTGAAGGGGGAAGGTGGTGGG - Intronic
949543849 3:5055280-5055302 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
950219330 3:11182646-11182668 CTGTGAAATGGAGGGGAGGGAGG + Intronic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
951888428 3:27547049-27547071 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
952318040 3:32248889-32248911 CTGTGAGAGGCCAAGGTGGGAGG - Intronic
952687350 3:36164901-36164923 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
952843876 3:37670388-37670410 CTGTCCTATGGGAAGGTGAGTGG - Intronic
953195400 3:40727511-40727533 CTCAGAAGAGGGAAGGTGGGAGG - Intergenic
953548226 3:43880374-43880396 CTGTGAAATGTGAGGCAGGGGGG - Intergenic
953796540 3:45990300-45990322 CTGTGAAAAGGGGCAGTGGGTGG + Intronic
954011629 3:47644933-47644955 CCATGAAACGGCAAGGTGGGGGG + Intronic
954288373 3:49635729-49635751 CTTTGAGAGGCGAAGGTGGGAGG + Intronic
954347048 3:50008792-50008814 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
955126014 3:56113732-56113754 ATCTGAAGTGGGAGGGTGGGGGG - Intronic
955247867 3:57245119-57245141 CTGTCACTTGGGAAGGTGAGAGG + Intronic
956211767 3:66808998-66809020 CTGTGAACAGGGAAGGAGAGCGG - Intergenic
956738738 3:72258777-72258799 CAAAGAAATAGGAAGGTGGGGGG + Intergenic
957333209 3:78792854-78792876 CTTTGGAAGGCGAAGGTGGGAGG + Intronic
958443800 3:94190300-94190322 CTTTGAGATGCCAAGGTGGGTGG + Intergenic
958786581 3:98603247-98603269 AAGTGAAATGGGGGGGTGGGAGG + Intergenic
959189079 3:103086562-103086584 CTGAGGGATGGGAAGGTTGGAGG - Intergenic
959480860 3:106871258-106871280 CTTTGGAATGCCAAGGTGGGCGG - Intergenic
959943255 3:112101798-112101820 CTGAGAAAGGCGTAGGTGGGAGG - Intronic
960614397 3:119583666-119583688 CTGTGAAAGGCCAAGGTGAGAGG + Intronic
961386290 3:126525053-126525075 GTGTGAAATGGGTTGATGGGAGG - Intronic
961864825 3:129945997-129946019 CTGTGAAATGGGAGGGTGAATGG - Intergenic
962317040 3:134365398-134365420 GTGTGCAATGGGAATGTGAGAGG - Intronic
962346550 3:134623329-134623351 CTGTGAATGAGGAAAGTGGGTGG - Intronic
962767800 3:138581458-138581480 CTTTGAGAGGTGAAGGTGGGTGG + Intronic
962778482 3:138687696-138687718 CTTTGAAAGGCTAAGGTGGGAGG - Intronic
962922198 3:139960327-139960349 CTCTGAAAGGGAAATGTGGGGGG - Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963496853 3:146075147-146075169 CTGTGAAAGAGGAAGGTATGTGG + Intronic
964234364 3:154507529-154507551 CTTTGAGAGGTGAAGGTGGGAGG - Intergenic
964270987 3:154956659-154956681 CAGTGAAGTGGGGAAGTGGGTGG + Intergenic
964310526 3:155386953-155386975 CTGGGAAAAGGGAAGTGGGGAGG + Intronic
964683724 3:159370810-159370832 CTGAAAACTGGGGAGGTGGGAGG - Intronic
964790000 3:160445169-160445191 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
964958165 3:162388441-162388463 TTGTGAAATTGGGAGGAGGGAGG - Intergenic
965301826 3:167014483-167014505 ATGAGAAATGGGAAGGTAGTAGG - Intergenic
965488520 3:169308055-169308077 CTGTGAAATGGCAGTGAGGGAGG - Intronic
965689846 3:171344003-171344025 TTGAGCAATGGGAAGGAGGGAGG - Intronic
966625554 3:182012469-182012491 CTGTGAAATGGGCAGATGGTGGG - Intergenic
967365116 3:188677619-188677641 CTGGGAAATGGGAGAGGGGGAGG + Intronic
967741519 3:193008198-193008220 CAGAGAAATGGGATGGTAGGTGG - Intergenic
967913452 3:194560434-194560456 CTGGAGAATGGGCAGGTGGGTGG - Intergenic
967962138 3:194933902-194933924 CTGTGAAGAGGGGAGCTGGGAGG + Intergenic
968006571 3:195247244-195247266 CTGTGAAATCTGAGGGTGGTCGG + Intronic
968794682 4:2694847-2694869 CTGTGAAATGGGCAGGACAGTGG + Intronic
969310052 4:6347795-6347817 CTGTGCATTGGGCAGGCGGGCGG - Intronic
969486199 4:7473736-7473758 CTTGGCAATGGGGAGGTGGGAGG + Intronic
969911566 4:10451928-10451950 ATGTGAAAAGGAAAGGTGGGTGG + Intronic
970629825 4:17928161-17928183 CTTTGGGATGGTAAGGTGGGTGG + Intronic
972287315 4:37661521-37661543 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
972701617 4:41499574-41499596 CTTTGGAAGGGCAAGGTGGGGGG + Intronic
973224058 4:47762779-47762801 CTGGCAGATGGGAGGGTGGGAGG + Intronic
973778526 4:54266488-54266510 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
973869055 4:55146282-55146304 CTTTGAAATGGGCAAGTTGGAGG + Intergenic
973955460 4:56058952-56058974 CTGTGCATTGTGAAGGTTGGAGG + Intergenic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
975157815 4:71091189-71091211 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
975197418 4:71541746-71541768 GAGTGGAAAGGGAAGGTGGGTGG + Intronic
975694479 4:76998280-76998302 CTGTGAAATGGAAATGGGGGTGG - Intronic
976110851 4:81672329-81672351 CTGTGAAATGTTAAAGTGGTGGG - Intronic
976934772 4:90616435-90616457 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
977058535 4:92225183-92225205 CTGTTGAATAGGAAGGAGGGAGG + Intergenic
977509530 4:97945207-97945229 CTTAGAAAGGGGAGGGTGGGAGG - Intronic
979284830 4:118910641-118910663 CTATGAAATGTGAAGGTAGTTGG - Intronic
979990414 4:127368248-127368270 CCATGAAATGGGAGGGTGTGGGG - Intergenic
980030463 4:127823390-127823412 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
981175929 4:141683325-141683347 CTTTGGAAGGGCAAGGTGGGTGG + Intronic
981736055 4:147951427-147951449 TTGTGAAATGGGAATGTAGGGGG + Intronic
982303459 4:153903802-153903824 ATGGGAAAAGGGAAGGTGGCTGG + Intergenic
982376069 4:154692321-154692343 CTGTGAAATCTGAAGGGAGGTGG - Intronic
982436747 4:155389019-155389041 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
982516648 4:156359601-156359623 CTTTGGAAGGCGAAGGTGGGTGG - Intergenic
983693632 4:170502354-170502376 GTGTGCATTTGGAAGGTGGGAGG + Intergenic
985237323 4:187890328-187890350 CTGTGAGAGGCCAAGGTGGGAGG + Intergenic
1202764518 4_GL000008v2_random:138660-138682 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
985812768 5:2102346-2102368 CTGTGAAAGGCCAAGGTGGCTGG - Intergenic
987147732 5:15008794-15008816 CAGTGATGTGGGAAGGTGGGAGG + Intergenic
988458629 5:31411868-31411890 CTTTGAAAGGTCAAGGTGGGTGG - Intronic
988719068 5:33858411-33858433 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
988924562 5:35976594-35976616 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
988949697 5:36243489-36243511 CTGTGAAATGGGAAGAAATGAGG - Intergenic
989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG + Intronic
989251297 5:39319047-39319069 CTGTGCTATGGGAGGGTTGGGGG - Intronic
990149332 5:52799398-52799420 CTGTGAAATGTTTAGGTTGGGGG - Intronic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
992503290 5:77362701-77362723 GTGTGACTTGGGAAGGTGGCAGG - Intronic
992564046 5:77980585-77980607 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
993401788 5:87462355-87462377 CTGTGAAGTGGGTGGGTGTGGGG - Intergenic
993654864 5:90564989-90565011 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
995242185 5:109898089-109898111 CTGAGAGATGGGAAAGAGGGAGG + Intergenic
995271807 5:110228184-110228206 TGGTGAAATGGGTAGGTGGGTGG - Intergenic
995667355 5:114557661-114557683 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
997264115 5:132485153-132485175 CTTTGGAAGGCGAAGGTGGGTGG - Intronic
997333863 5:133089768-133089790 CTTTGAAAGGCTAAGGTGGGAGG + Intronic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
998400368 5:141845707-141845729 GTGTGAAGGGGGAGGGTGGGTGG - Intergenic
999764209 5:154726081-154726103 CTGTGGAAGGCCAAGGTGGGCGG - Intronic
1000797428 5:165682415-165682437 TTGTGGAAAGGGAATGTGGGAGG + Intergenic
1000925413 5:167187800-167187822 CTTTATAATGGGAAGGAGGGTGG - Intergenic
1001106502 5:168858913-168858935 ATGTGAAATGCAAAAGTGGGTGG + Intronic
1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG + Intronic
1003954710 6:11151013-11151035 CTGTGAAAAGAGGAGGTGGTGGG - Intergenic
1004300356 6:14452152-14452174 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1004376385 6:15094185-15094207 CTGAGAAATGGGGATGGGGGAGG + Intergenic
1005098274 6:22142242-22142264 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
1005647743 6:27857207-27857229 CTCTGGAATGGTGAGGTGGGAGG + Intronic
1006187894 6:32190940-32190962 CAGTAAGAAGGGAAGGTGGGTGG - Exonic
1006453181 6:34117236-34117258 CTGGCAGATGGGAAGCTGGGGGG + Intronic
1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG + Intergenic
1008506782 6:52238284-52238306 CTGGGAAATGGGATGTTAGGTGG - Intronic
1008730440 6:54475688-54475710 CTCAGAAAGGGGAAAGTGGGAGG + Intergenic
1008877806 6:56348550-56348572 CTGTAGCATGGGAAGGTGGCTGG + Intronic
1008966024 6:57313632-57313654 CAGTGAAATGGGGAGGGTGGAGG + Intergenic
1009934191 6:70214044-70214066 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010148995 6:72708358-72708380 ATGTGAAATGGAAAAGAGGGTGG + Intronic
1010221808 6:73454469-73454491 CTTTGGAAGGCGAAGGTGGGTGG + Intergenic
1011309699 6:85968418-85968440 TTTGGAAATGGGAAGGTAGGAGG - Intergenic
1012713095 6:102632953-102632975 CTCTTGAATGGGAAAGTGGGAGG + Intergenic
1012959790 6:105610182-105610204 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013094844 6:106935270-106935292 CTTTGAAAGGTGGAGGTGGGAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014028407 6:116674465-116674487 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1015017745 6:128434774-128434796 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1015278255 6:131405641-131405663 CTTTGAATTGGGAAGAAGGGCGG - Intergenic
1015436472 6:133195378-133195400 CTGAAAAAGTGGAAGGTGGGAGG + Intergenic
1015438238 6:133215970-133215992 CTGTGGGTTGGGAAGATGGGAGG - Intergenic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1015788841 6:136945953-136945975 CAGTGAAATGAGAACGTGGGTGG - Intergenic
1015935345 6:138402831-138402853 AAGAGAAATGGGAAGGAGGGTGG - Intergenic
1016233205 6:141831114-141831136 CTGTGCACTGGGAGGATGGGAGG - Intergenic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017399109 6:154039317-154039339 CTGTGAACTACTAAGGTGGGAGG + Intronic
1017992230 6:159501065-159501087 GTGTGAAGTGGGGTGGTGGGTGG - Intergenic
1018349762 6:162943958-162943980 CTGTGGGCTGGGCAGGTGGGTGG - Intronic
1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG + Intergenic
1019064835 6:169288174-169288196 CTGAGAAGTGGGAAGGGGTGAGG - Intergenic
1020237262 7:6366020-6366042 CTTTGAAAGGGCGAGGTGGGTGG + Intergenic
1020434865 7:8151711-8151733 CTGAGAAATGTGGAGGTGGGTGG + Intronic
1020579406 7:9976068-9976090 CTGTGAAAGGCCAAGGTGAGCGG - Intergenic
1021217915 7:17940233-17940255 CTGTGAAATGGGGAAGGGGCCGG - Intronic
1022021382 7:26402436-26402458 CTTTGAGATGTCAAGGTGGGTGG + Intergenic
1023120393 7:36903082-36903104 CTGTGAGATGGGCAGGTAGACGG - Intronic
1023347467 7:39286130-39286152 CTGGGAAGTGGGAAGTGGGGAGG + Intronic
1023393950 7:39734996-39735018 CTTTGAAAGGCCAAGGTGGGCGG + Intergenic
1023713022 7:43014634-43014656 CTGTGCAATGGAAGGGTAGGTGG + Intergenic
1024006002 7:45225181-45225203 CCATGAAATGGCAAGGTGGGAGG - Intergenic
1025934250 7:66021952-66021974 CTTTGAAAGGCTAAGGTGGGTGG + Intergenic
1026185786 7:68081864-68081886 CTGTGAAGAGAGAAGGTGGTGGG + Intergenic
1026978659 7:74514088-74514110 CTGTGAAAGGGGAGGACGGGTGG + Intronic
1028089504 7:86680765-86680787 ATGTGAAATGGGAAGGGGCTGGG - Intronic
1028399393 7:90408257-90408279 CTTTGAAAGGTGGAGGTGGGGGG + Intronic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029237258 7:99131454-99131476 CAAGGAAATGGGTAGGTGGGTGG + Intronic
1029482483 7:100821710-100821732 CTTTGAGATGCCAAGGTGGGAGG - Intronic
1029878788 7:103783236-103783258 CTTTGAGAGGGCAAGGTGGGAGG - Intronic
1030610609 7:111684940-111684962 CTTTGGGATGCGAAGGTGGGTGG + Intergenic
1030912590 7:115270363-115270385 CTTTGAGAGGGTAAGGTGGGAGG - Intergenic
1031552685 7:123134134-123134156 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1031630488 7:124037706-124037728 CTTTGAGATGGCAAGGTGGGAGG - Intergenic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032966971 7:137108885-137108907 CCCCAAAATGGGAAGGTGGGAGG - Intergenic
1033052234 7:138015880-138015902 CAGTGACTTGTGAAGGTGGGAGG + Intronic
1033147989 7:138887576-138887598 CTTGGGAAAGGGAAGGTGGGAGG - Intronic
1033418584 7:141185812-141185834 CTGTGATATGGAAAGGGGGAAGG - Intronic
1033454967 7:141494658-141494680 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1033988041 7:147250536-147250558 CTGTCAGATGGGGGGGTGGGGGG - Intronic
1034095902 7:148407458-148407480 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1034245073 7:149637823-149637845 CAGAGAAATGGGTATGTGGGAGG - Intergenic
1034616202 7:152418948-152418970 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1034844271 7:154430024-154430046 CTGAGAACTGGGAGGGTGGATGG - Intronic
1035173406 7:157033504-157033526 CTGAGAAATGACAATGTGGGTGG + Intergenic
1036465240 8:8991333-8991355 GTGTGAAATGGGGAGGTGTCTGG + Intergenic
1036672302 8:10799552-10799574 CTTTGAAATGGACAGGTGAGCGG + Intronic
1037215005 8:16438643-16438665 CTTTGAAATGAGAATCTGGGAGG + Intronic
1037512188 8:19594793-19594815 CTGTGGAAGGCCAAGGTGGGTGG - Intronic
1038376574 8:27046099-27046121 TTGTGAAATGGAAAGCTGTGAGG + Intergenic
1038843319 8:31206061-31206083 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1039102651 8:33957676-33957698 CTGTGAAATGGCAAAGTCAGCGG + Intergenic
1039635475 8:39159887-39159909 GTGTGAGATGGGATGGTAGGTGG + Intronic
1039639006 8:39198619-39198641 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1041607674 8:59802327-59802349 CTGTGAAAATGGAAGTTAGGAGG - Intergenic
1041710069 8:60886391-60886413 CTGTGAATAGGGATGGTTGGAGG - Intergenic
1043056166 8:75442463-75442485 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
1043508352 8:80924814-80924836 CAGAGAAATGGAAAGGTTGGTGG + Intergenic
1044550847 8:93510850-93510872 AAGTAAAATGGAAAGGTGGGGGG - Intergenic
1044962585 8:97545379-97545401 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1046885681 8:119364408-119364430 CTGAGAAAGGGGAAAGGGGGAGG - Intergenic
1047006048 8:120621451-120621473 GTGAGAAATGGGAAAGTGGAGGG + Intronic
1047015698 8:120720849-120720871 CTGTGGAAGGGTAAGGTAGGTGG - Intronic
1047349313 8:124058465-124058487 CTGTGAAATGGGTTGGTTGCTGG - Intronic
1047733802 8:127748342-127748364 CTGTGATAGAGGAAGGGGGGAGG - Intergenic
1048381927 8:133872911-133872933 CTGTTAAATGGGATTGGGGGAGG - Intergenic
1048501917 8:134985757-134985779 CTGTAAAGTGTTAAGGTGGGAGG - Intergenic
1048533297 8:135270425-135270447 CTGGGAAAAGAGAAGGTTGGAGG + Intergenic
1048898980 8:139020145-139020167 CTATGAAATGGGACATTGGGAGG - Intergenic
1048922220 8:139241617-139241639 ATGTGAGTTGTGAAGGTGGGAGG + Intergenic
1049120374 8:140731649-140731671 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
1049157488 8:141075735-141075757 CTGTGCAATGGGGACGCGGGAGG - Intergenic
1049238363 8:141524186-141524208 CTGTGAAATGGGAGGCTGTGGGG + Intergenic
1049365240 8:142233897-142233919 CTGTGCAGGGGGAAGCTGGGAGG - Intronic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049420244 8:142513235-142513257 CTGTGAGATGGGAGGGCGGTTGG + Intronic
1049833660 8:144718805-144718827 CTTTGGAAGGGCAAGGTGGGTGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG + Intergenic
1051813227 9:21074549-21074571 GTGTGATATGGGAAGGGGGAAGG + Intergenic
1052029691 9:23614356-23614378 CTTTGAAAGGCCAAGGTGGGGGG + Intergenic
1052749598 9:32476250-32476272 CTTTGAGAGGGCAAGGTGGGAGG + Intronic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1055588477 9:77783610-77783632 CTGAGCAGTGGGAAGGTAGGTGG - Intronic
1055668408 9:78575147-78575169 CTGTGAACTGGGGTGTTGGGGGG + Intergenic
1055913226 9:81374601-81374623 CTGCTGAGTGGGAAGGTGGGAGG - Intergenic
1056004327 9:82251096-82251118 TTGTCAAGTGAGAAGGTGGGTGG - Intergenic
1056526429 9:87447018-87447040 CTGTCCAATGGGCAGGTAGGAGG - Intergenic
1057778261 9:98028263-98028285 CTGTGGGATGCCAAGGTGGGCGG - Intergenic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058234402 9:102471162-102471184 CTTTGAGATGCCAAGGTGGGGGG - Intergenic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1058585749 9:106504594-106504616 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
1058952273 9:109915069-109915091 CTGGGAAATGGGAAGATCTGGGG - Intronic
1058971365 9:110086158-110086180 CTGAGAAGTGGGAGGGTGTGGGG + Intronic
1059520725 9:114939289-114939311 CTATGAAATAGGAAGCTTGGTGG + Intergenic
1059732627 9:117072029-117072051 CTGTAAAATGGGAGTGGGGGAGG - Intronic
1060116999 9:120949830-120949852 CTGGGATTTGGGTAGGTGGGAGG - Intergenic
1060690889 9:125659004-125659026 CTTTGGAAAGGCAAGGTGGGAGG + Intronic
1061509636 9:131052703-131052725 CTGAGAGATGGGGAGGTGAGAGG + Intronic
1061864507 9:133485422-133485444 CCGTGTCTTGGGAAGGTGGGAGG + Intergenic
1203545267 Un_KI270743v1:123547-123569 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG + Intronic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1186816209 X:13240470-13240492 CTGGGAACTGGGCAGGTAGGAGG - Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1188582482 X:31731401-31731423 CTGTGACATGGGAAGCTGAAAGG + Intronic
1189000435 X:36938355-36938377 CTGTTAAATGACAAGGTAGGTGG - Intergenic
1189002240 X:36958765-36958787 CTTTGAACTGGGGAGATGGGAGG - Intergenic
1189307713 X:39999525-39999547 CTTTGAAAGGTTAAGGTGGGAGG + Intergenic
1189537670 X:41953376-41953398 CTGTAAAATGGGATAGTGGTGGG + Intergenic
1190399204 X:50014722-50014744 CTATGACAGGGGAGGGTGGGAGG - Intronic
1190534417 X:51411520-51411542 CTGTGAACTGGGAAAGAGGTGGG + Intergenic
1190809676 X:53871096-53871118 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1192375848 X:70560990-70561012 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1192415976 X:70981151-70981173 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1192808332 X:74529099-74529121 CTATAAAATGGGGTGGTGGGAGG - Intronic
1193135684 X:77968790-77968812 GTGTGACATGTGCAGGTGGGAGG + Intronic
1193425097 X:81332539-81332561 CTTTGAGATGCCAAGGTGGGAGG - Intergenic
1195688490 X:107605390-107605412 CTGTGTGTTGGGGAGGTGGGAGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196097739 X:111817648-111817670 CTGTGAACTGTGAAGTTGGCAGG + Intronic
1196375148 X:115025518-115025540 ATGTGGAATTGGAAGGGGGGTGG - Intergenic
1196512156 X:116524322-116524344 CAGTGGACTGGGAAGGTGGGTGG - Intergenic
1196753670 X:119139362-119139384 CAGGAAAGTGGGAAGGTGGGAGG + Intronic
1197683897 X:129417543-129417565 CTCTGAAGTGGAAAGGAGGGAGG + Intergenic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1198374339 X:136023052-136023074 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1199276341 X:145947577-145947599 CTGAGAAATTTGAAGCTGGGAGG - Intergenic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic
1199754707 X:150853391-150853413 CAGTGAAGTGGGTGGGTGGGGGG - Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200808388 Y:7456737-7456759 CTTTGGGATGGCAAGGTGGGAGG - Intergenic
1201684925 Y:16690446-16690468 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1201702555 Y:16900472-16900494 GAGGGAAATGGGAAGGAGGGAGG - Intergenic