ID: 1151835265

View in Genome Browser
Species Human (GRCh38)
Location 17:76578717-76578739
Sequence GGGTGCTCAAAACTGCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151835258_1151835265 -3 Left 1151835258 17:76578697-76578719 CCTCCTCCCCACTAATTTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1151835265 17:76578717-76578739 GGGTGCTCAAAACTGCCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 102
1151835261_1151835265 -9 Left 1151835261 17:76578703-76578725 CCCCACTAATTTGAGGGTGCTCA 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1151835265 17:76578717-76578739 GGGTGCTCAAAACTGCCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 102
1151835260_1151835265 -6 Left 1151835260 17:76578700-76578722 CCTCCCCACTAATTTGAGGGTGC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1151835265 17:76578717-76578739 GGGTGCTCAAAACTGCCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 102
1151835256_1151835265 -2 Left 1151835256 17:76578696-76578718 CCCTCCTCCCCACTAATTTGAGG 0: 1
1: 0
2: 0
3: 11
4: 288
Right 1151835265 17:76578717-76578739 GGGTGCTCAAAACTGCCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 102
1151835262_1151835265 -10 Left 1151835262 17:76578704-76578726 CCCACTAATTTGAGGGTGCTCAA 0: 1
1: 1
2: 1
3: 5
4: 96
Right 1151835265 17:76578717-76578739 GGGTGCTCAAAACTGCCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151835265 Original CRISPR GGGTGCTCAAAACTGCCACA GGG Intronic
900483601 1:2910989-2911011 GGGGGCTCAGAACTGCCATGGGG - Intergenic
902107604 1:14050772-14050794 GGGTCCTCAGCACTGGCACATGG - Intergenic
904772359 1:32887196-32887218 GGGTCCTCCAAATGGCCACACGG + Intronic
905031027 1:34884825-34884847 GGGTGGTCAGAGCAGCCACAGGG - Intronic
909750170 1:79149542-79149564 CTGTGCTCAAAAATGACACAGGG + Intergenic
910134394 1:83950227-83950249 AGGTACACAAAACTGCCAAAGGG + Intronic
910854407 1:91680470-91680492 GGGTGTTCAAACTGGCCACAGGG + Exonic
916824814 1:168433044-168433066 GAGGGCTCATGACTGCCACACGG + Intergenic
919304211 1:195808955-195808977 GGGTCATAAAAACTGCCACTAGG + Intergenic
922324698 1:224517209-224517231 GTGTGCTCAGCACTGCCCCATGG - Intronic
922568720 1:226619144-226619166 GGGTGCTCAAAGCAACAACATGG - Intergenic
923517600 1:234710399-234710421 GGCTCCTCAAAACTGCCTCTTGG - Intergenic
1065275273 10:24079361-24079383 TGGTGCTCAGAACTGCCTCATGG - Intronic
1067700402 10:48567415-48567437 GGGTGCTGAGCAGTGCCACAGGG + Intronic
1070245864 10:74730767-74730789 GGGTGCGGAAGCCTGCCACAGGG + Intergenic
1070587804 10:77779875-77779897 AGGAGCTCAGAAGTGCCACATGG + Intergenic
1070754462 10:78983056-78983078 GGGGGCTCAAGGCTTCCACATGG + Intergenic
1071794013 10:88986239-88986261 GGGTGTTAAGAACTGACACAAGG - Intronic
1073540489 10:104313301-104313323 AGGTGCTCAAAAATGCTACCCGG - Exonic
1075068280 10:119304149-119304171 GGCTGCTCAAAGCTGCCTCTTGG - Intronic
1075922034 10:126221694-126221716 AGGTGCTGAAATCTGTCACAGGG + Intronic
1076190290 10:128478591-128478613 GGGGGCTCAGAACTGGCAGAGGG - Intergenic
1080896448 11:36452406-36452428 GGGTGGTGAAAACTGCCAGCTGG - Intronic
1081078497 11:38708162-38708184 GGGGACGCAAAACTGACACAGGG - Intergenic
1081182802 11:40005089-40005111 CGGTGCTACAAACTGCCAAAAGG + Intergenic
1089513575 11:119017137-119017159 GGCTTCACTAAACTGCCACAGGG + Intronic
1091837557 12:3596265-3596287 GGGTGATCAGAACTGCCCCTAGG - Intergenic
1097341584 12:58444358-58444380 GTGTGCAAAAAACTGCGACAAGG + Intergenic
1104016061 12:124963180-124963202 GGGTGCTGACACCTGCCACCCGG + Intronic
1113735100 13:112672731-112672753 GGGGGCTCACACCTGCAACAGGG + Intronic
1118041252 14:61919623-61919645 GGGTTCTTAAAACTGGCAGAGGG - Intergenic
1121332264 14:93057062-93057084 GGGTGCTCCCAAATGCCACCCGG + Intronic
1123582729 15:21731015-21731037 GGGTACTCAGAACTGCCAGGGGG - Intergenic
1123582913 15:21731759-21731781 GGGTGCACAGAACTGCCAGGAGG - Intergenic
1123619379 15:22173611-22173633 GGGTACTCAGAACTGCCAGGGGG - Intergenic
1123619563 15:22174355-22174377 GGGTGCACAGAACTGCCAGGAGG - Intergenic
1133916453 16:10113309-10113331 AGGAGCTCAGAAGTGCCACATGG - Intronic
1134884039 16:17774139-17774161 TGCTGCTCAAAGCTGCCTCATGG + Intergenic
1138053339 16:53805889-53805911 AGCTGCTCACAAATGCCACACGG - Intronic
1138499790 16:57433298-57433320 GGATGCTCATACCTTCCACAAGG + Intronic
1139275866 16:65727134-65727156 TGGAGCTCAAAACTGCCAGTTGG - Intergenic
1139416054 16:66811626-66811648 GGGTGGTGAAATGTGCCACAAGG - Intronic
1140834994 16:78785301-78785323 GGGTGCTCAAAGCTGCTGCTGGG - Intronic
1149418706 17:56487431-56487453 GGGTGCTCACAACTGACAGCCGG + Intronic
1151835265 17:76578717-76578739 GGGTGCTCAAAACTGCCACAGGG + Intronic
1162124412 19:8491558-8491580 GAGTCCTCAGAACTGACACAGGG - Intronic
925113033 2:1352472-1352494 GTGTGCTCAAACCTGACACGGGG - Intronic
927540372 2:23905215-23905237 AGGTACTGAAAAATGCCACATGG + Intronic
928054766 2:28041787-28041809 GTTTGCTCAAAACTACCAAATGG - Intronic
929860471 2:45672721-45672743 GGATGGTAAAAACTGCCATAAGG + Intronic
930017895 2:46983472-46983494 GGGAGCTCACAACTGGCAGAGGG - Intronic
933785528 2:85838254-85838276 TGGTGCTCAAAGCTTCCACTTGG - Intergenic
937900718 2:127016880-127016902 GGGGGATTAAATCTGCCACAAGG - Intergenic
939530708 2:143357276-143357298 GTGTGCTCAAATCAGCAACAGGG + Intronic
939906530 2:147923011-147923033 GGGTGCTATAAACTTCCAAAGGG + Exonic
948380515 2:237547238-237547260 GTGTGCTCGAAAATGGCACAGGG + Intronic
1169088655 20:2843075-2843097 GGTCTCTAAAAACTGCCACAGGG - Intronic
1177060975 21:16373715-16373737 GGATGCTCAAAGATGCCATAAGG + Intergenic
1180184343 21:46132024-46132046 GGGTGAGCAGAACTTCCACAAGG + Exonic
1180637018 22:17269551-17269573 GGGTTCACCAAACTGCCACCTGG - Intergenic
1184675685 22:46041739-46041761 GGGTGCTGAATGCTGCCTCAGGG - Intergenic
1184842172 22:47058457-47058479 GGGTGGTCATAACCACCACAAGG - Intronic
1185007460 22:48289977-48289999 GGGTGCTCAGAACAGACACTAGG - Intergenic
950434270 3:12969009-12969031 AGGTGCTCTAAACTGGCATAAGG - Intronic
951097860 3:18652695-18652717 GGACGCTCAAAAGTGCAACAAGG - Intergenic
952550456 3:34471227-34471249 GGATGTTCAAAACTATCACAAGG - Intergenic
953584736 3:44189330-44189352 AGGTGCTCAAACCTGATACAAGG - Intergenic
954035033 3:47846832-47846854 TGGTGCTCATGAGTGCCACAGGG + Exonic
956374532 3:68600317-68600339 GGGTGCTCAGAACTGCACAAAGG + Intergenic
956898775 3:73691748-73691770 GTTTGCTCACAAATGCCACAAGG + Intergenic
958469436 3:94498906-94498928 AGGTGCTCAACATAGCCACAGGG + Intergenic
961383173 3:126508897-126508919 GGGTGCCCAAGACAGGCACATGG + Intronic
963059608 3:141214536-141214558 GGGTCCTCAATCCTGCCACTAGG - Intergenic
963168543 3:142228498-142228520 GTCTCCTCAAAACTGCAACATGG - Intergenic
966744203 3:183260113-183260135 AGCTGCTCTAAGCTGCCACAGGG + Intronic
976136836 4:81946943-81946965 TGGTGCTCTTAACTGCCTCATGG - Intronic
977634165 4:99276583-99276605 GGAGGCTGAAGACTGCCACAAGG + Exonic
977639241 4:99336711-99336733 GGAGGCTGAAAACTGCTACAAGG + Exonic
979499475 4:121422677-121422699 GGGTGCTCAGAACTCCAACAGGG + Intergenic
983054604 4:163086601-163086623 ATGTGCTCAAAACTGCCTGAAGG - Intergenic
991202217 5:64007832-64007854 AGGTGGTCAAAACTGCCTCTGGG - Intergenic
993153507 5:84191494-84191516 GCCTCCTCAAATCTGCCACAAGG - Intronic
997373151 5:133375158-133375180 GGGTGCTCAAGAGTGCTGCAGGG - Intronic
997571396 5:134930519-134930541 GGGTGCTCTGCATTGCCACAGGG + Intronic
1004731770 6:18366287-18366309 TGGAGCTCAGAACTGCCACATGG + Intergenic
1005800534 6:29417847-29417869 GGCTGCTCAGTACTGTCACAGGG + Intronic
1006710797 6:36068530-36068552 GGGTGCTTAAAACAATCACAGGG - Intronic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1021830709 7:24605019-24605041 GGGTGCTGAAAATTGCCCAAAGG - Intronic
1022809031 7:33850732-33850754 GGGTTCACAAAACTGATACAGGG - Intergenic
1023815787 7:43948961-43948983 GTGTGCTCAAGACTGTCACATGG + Intronic
1024342464 7:48281487-48281509 GAGTTCTGAAAACTGGCACAGGG - Intronic
1030115421 7:106059027-106059049 GGGCCCTCAAATCTGCCACATGG + Intergenic
1032018110 7:128392558-128392580 AGGAGCTCAGAAGTGCCACATGG + Exonic
1034548235 7:151802881-151802903 GGGGGCTCAGGACTCCCACAAGG + Intronic
1042663947 8:71185682-71185704 TGGGGCTCAAAATTCCCACATGG + Intergenic
1047096486 8:121631698-121631720 GGATGCTGAAAACTCCCACATGG + Intronic
1047275604 8:123402518-123402540 AGGAGCTCAGAAGTGCCACATGG - Intronic
1053150264 9:35738772-35738794 GGGTGATCAAAACTTCCTGAAGG - Exonic
1053434509 9:38066606-38066628 GGGTGCCCCAAACTGCCTCCAGG + Intronic
1058684407 9:107467572-107467594 GAGTGCTCAAAACAGCCATCTGG + Intergenic
1060151328 9:121290146-121290168 GGGTTCTAGAAACTCCCACATGG + Intronic
1061388710 9:130305443-130305465 GGGTTCTTAAAACTCCCAGATGG - Intronic
1062065929 9:134526198-134526220 GGGTGCTCAGAAGAGCCACTAGG - Intergenic
1186828708 X:13368090-13368112 GGGTGCACAAAACTATCATACGG - Intergenic
1187359771 X:18614679-18614701 GGGAGCTTAAAACAGTCACATGG - Intronic
1189361714 X:40358738-40358760 AGGAGCTCAGAAGTGCCACATGG + Intergenic
1189498123 X:41528517-41528539 GGATTCTAAAAAATGCCACAAGG + Intronic
1189624819 X:42885443-42885465 GGCGGCTCAAAAATGTCACAGGG - Intergenic