ID: 1151837004

View in Genome Browser
Species Human (GRCh38)
Location 17:76588318-76588340
Sequence TTCCCAGCAAAACTCTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151837000_1151837004 5 Left 1151837000 17:76588290-76588312 CCCAGATTCTCTTGTGTTCCTGG No data
Right 1151837004 17:76588318-76588340 TTCCCAGCAAAACTCTGACCTGG No data
1151836999_1151837004 18 Left 1151836999 17:76588277-76588299 CCTGCATCAGTAACCCAGATTCT No data
Right 1151837004 17:76588318-76588340 TTCCCAGCAAAACTCTGACCTGG No data
1151837002_1151837004 4 Left 1151837002 17:76588291-76588313 CCAGATTCTCTTGTGTTCCTGGC No data
Right 1151837004 17:76588318-76588340 TTCCCAGCAAAACTCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151837004 Original CRISPR TTCCCAGCAAAACTCTGACC TGG Intergenic
No off target data available for this crispr