ID: 1151840015 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:76611011-76611033 |
Sequence | CACAGCAAAGAGCAGGAGGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1151840012_1151840015 | 4 | Left | 1151840012 | 17:76610984-76611006 | CCTGAGGTCATAGGTGGATCTTT | 0: 158 1: 377 2: 219 3: 116 4: 140 |
||
Right | 1151840015 | 17:76611011-76611033 | CACAGCAAAGAGCAGGAGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1151840015 | Original CRISPR | CACAGCAAAGAGCAGGAGGA TGG | Intergenic | ||
No off target data available for this crispr |