ID: 1151840015

View in Genome Browser
Species Human (GRCh38)
Location 17:76611011-76611033
Sequence CACAGCAAAGAGCAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151840012_1151840015 4 Left 1151840012 17:76610984-76611006 CCTGAGGTCATAGGTGGATCTTT 0: 158
1: 377
2: 219
3: 116
4: 140
Right 1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151840015 Original CRISPR CACAGCAAAGAGCAGGAGGA TGG Intergenic
No off target data available for this crispr