ID: 1151843193

View in Genome Browser
Species Human (GRCh38)
Location 17:76632295-76632317
Sequence CAGGCACCTTAACTTGGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151843185_1151843193 18 Left 1151843185 17:76632254-76632276 CCCTATCTCGAACATTTTCATGG 0: 1
1: 0
2: 0
3: 15
4: 135
Right 1151843193 17:76632295-76632317 CAGGCACCTTAACTTGGCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1151843187_1151843193 17 Left 1151843187 17:76632255-76632277 CCTATCTCGAACATTTTCATGGA 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1151843193 17:76632295-76632317 CAGGCACCTTAACTTGGCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151843193 Original CRISPR CAGGCACCTTAACTTGGCCG TGG Intronic
901033044 1:6319670-6319692 CAGGCACTTGAACTTGTCTGAGG - Intronic
906541200 1:46587425-46587447 GAGGCACAGTAACTTGGCCTTGG - Intronic
907451416 1:54548024-54548046 CAGGCCCCTTGACGTGGCTGTGG + Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
1070659573 10:78294860-78294882 AAGGCAAATTAACTTGGCCAAGG - Intergenic
1075259089 10:120947692-120947714 CATGAGCCTTAACGTGGCCGTGG + Intergenic
1077480600 11:2812721-2812743 CAGGCACCCTTCCATGGCCGTGG + Intronic
1083470547 11:62881190-62881212 CAGGCCCGTGAACTTAGCCGCGG - Exonic
1084316203 11:68347293-68347315 CAGGCCCGTTTCCTTGGCCGTGG - Intronic
1085400225 11:76231529-76231551 GAGGCACAGTAACTTGGCCAGGG - Intergenic
1089144144 11:116312126-116312148 CCGGCTCCTTCACTGGGCCGTGG + Intergenic
1090335674 11:125961880-125961902 CAGGCACCTTCACGTGACTGAGG + Exonic
1090868841 11:130725316-130725338 CAGGCACCCTAACTTGCATGGGG + Intergenic
1091820607 12:3472836-3472858 CAGACACTTTAGCCTGGCCGTGG - Intronic
1100346313 12:93734916-93734938 CAGGGACCTAACCTTGGCAGGGG - Intronic
1106765887 13:32913656-32913678 CTGGCTTCTTACCTTGGCCGTGG + Intergenic
1107181041 13:37459300-37459322 CAGGAACCTTATCTTGCCAGTGG + Intergenic
1122406691 14:101505150-101505172 CACGCACCTCAACGTGGCCTTGG + Intergenic
1128055907 15:64700035-64700057 CAGGCTCCTCCACTTGGCCTGGG - Intronic
1128146167 15:65333554-65333576 TAGGCACCTTAACATGGAAGAGG + Intronic
1136109003 16:28052978-28053000 CAGGCAGCTCCACTTGGCCCGGG - Intronic
1140421266 16:74821288-74821310 CAGCCCCCTTATCTTGGCAGGGG + Intergenic
1142621607 17:1168967-1168989 CAGCCACCTTGACTTGGTCGAGG - Intronic
1147987162 17:44313242-44313264 CAGGCCCCTCACCTTGGCCCGGG - Exonic
1151843193 17:76632295-76632317 CAGGCACCTTAACTTGGCCGTGG + Intronic
1151852407 17:76698656-76698678 CTGACACCTTAACATGGCCTGGG + Intronic
1152816267 17:82409976-82409998 CAGGCTCCTGAGCTTGGCCCAGG - Intronic
1161534645 19:4811626-4811648 CAGGAACCTTCACTTGTCCCAGG - Intergenic
1163032253 19:14552446-14552468 CAGGCTACTTACCTTGGGCGAGG + Intronic
1164825193 19:31279649-31279671 CGGGCACATGTACTTGGCCGAGG + Exonic
1167801647 19:51746787-51746809 CAGTTACCTGAACCTGGCCGTGG - Exonic
1168317467 19:55490398-55490420 CAGGGAGCTTACCTTGGCGGGGG - Exonic
935374534 2:102381118-102381140 CAGGAACCTCACCTTGGCCCTGG - Intronic
937083721 2:119157676-119157698 CTGGCAGCTGAACTTGCCCGTGG + Exonic
940945923 2:159617014-159617036 CAGCCAGTTTAACTTGTCCGTGG - Intergenic
941286452 2:163619391-163619413 CAGGCACCATGACTTGGACTAGG + Intronic
948853264 2:240718579-240718601 CAGGCTCCTGAACTTGTCCAGGG + Intronic
948874769 2:240820549-240820571 CGTGCACCTGAACTTGCCCGCGG + Intergenic
949009575 2:241670875-241670897 CAGGCAGCCTCACTGGGCCGTGG + Intronic
1173064850 20:39700522-39700544 CAGTCACCTTAAGTTGGTCATGG + Intergenic
1173588936 20:44209627-44209649 CAGGCAATTTAACTTTGCCTCGG + Intronic
1176258133 20:64164287-64164309 TAGGCACCTTCTGTTGGCCGAGG + Intronic
1177020158 21:15845146-15845168 AAGGCACATTAATGTGGCCGTGG + Intronic
1178280662 21:31279906-31279928 CAGTCACCTTAAATTTGCTGTGG + Intronic
1183077400 22:35435726-35435748 CAGCCTCCCTAACTTGGCCTTGG + Intergenic
1185318942 22:50191368-50191390 GAGGCATCTTAACTTGGATGTGG + Intronic
953486374 3:43300984-43301006 GAGGCACAGTAACTTGGCCTAGG - Intronic
954238563 3:49275855-49275877 CAGGCACCTTGACTTGGAGAAGG - Intronic
955730937 3:61985574-61985596 CAGGCAGCTTAAATTGTCCAAGG + Intronic
967367571 3:188705012-188705034 CAGGGTCCTTCACTTGGCCTGGG + Intronic
978385647 4:108173151-108173173 CAGGCGCCTGAACTTGGCATGGG + Intergenic
985510918 5:313416-313438 CGGGCTCCTTGACTTGGCAGAGG - Intronic
987771028 5:22305548-22305570 CAGGCACTTTAAGGTGGCCAAGG - Intronic
997646655 5:135486570-135486592 CAGGCAACTTAACTTCTCTGTGG + Intergenic
1001133089 5:169080433-169080455 CAGACTCCTTGCCTTGGCCGTGG - Intronic
1003679808 6:8241665-8241687 TAGGCAGCTTAACTTAGCAGTGG + Intergenic
1009610809 6:65938157-65938179 GATGCTCCTTAACTTGGCCCAGG - Intergenic
1021803002 7:24326430-24326452 CAGGCACCTTGCCTTTGCAGGGG - Intergenic
1023846564 7:44124007-44124029 AAGGCCCACTAACTTGGCCGGGG + Intronic
1025928279 7:65976077-65976099 CTGGCACCTTAAGTTGGCCCTGG + Exonic
1028719070 7:94008454-94008476 CAGGCCCCTGAACCTGGCCCTGG + Intergenic
1031641981 7:124175888-124175910 CTGGCACCTTAAGTTGGCAATGG + Intergenic
1032283772 7:130526399-130526421 CAGGTACCTTCCCTTGGCCAAGG + Intronic
1032285324 7:130535204-130535226 CAGGTACCTTCCCTTGGCCAAGG + Intronic
1032286108 7:130539604-130539626 CAGGTACCTTCCCTTGGCCAAGG + Intronic
1034150694 7:148912978-148913000 CAGGCCCCTTAACTTCCCCAGGG - Intergenic
1038381739 8:27101745-27101767 CAGGAACCTTAGGTTGGCCTTGG - Intergenic
1048799944 8:138186122-138186144 CGGGCACCTTATCTTGCCTGGGG - Intronic
1049583415 8:143422673-143422695 CAGGCACCCCAACCTGGCTGTGG - Intronic
1057704207 9:97386211-97386233 CAGGCACCTGAGCTTGACTGTGG + Intergenic
1187470105 X:19562078-19562100 CAGGCTCCTAACCTTGGCCAAGG + Intronic
1190012900 X:46800666-46800688 CAGGAATCTTAACTTGGCTGTGG + Intergenic