ID: 1151846503

View in Genome Browser
Species Human (GRCh38)
Location 17:76659617-76659639
Sequence CTGTCTGAGAAGAGGGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151846503_1151846511 29 Left 1151846503 17:76659617-76659639 CCTGAGGCCCTCTTCTCAGACAG No data
Right 1151846511 17:76659669-76659691 TTGGAACACTCAGAAGCCAAAGG No data
1151846503_1151846508 10 Left 1151846503 17:76659617-76659639 CCTGAGGCCCTCTTCTCAGACAG No data
Right 1151846508 17:76659650-76659672 CTTTCTGCTACCCTTCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151846503 Original CRISPR CTGTCTGAGAAGAGGGCCTC AGG (reversed) Intergenic
No off target data available for this crispr