ID: 1151850149

View in Genome Browser
Species Human (GRCh38)
Location 17:76685190-76685212
Sequence GCCAGGAGTGCTGTAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151850143_1151850149 8 Left 1151850143 17:76685159-76685181 CCTTCTCCTGTGGAGGGGGGACC 0: 1
1: 0
2: 1
3: 12
4: 185
Right 1151850149 17:76685190-76685212 GCCAGGAGTGCTGTAGAGGCTGG 0: 1
1: 0
2: 1
3: 26
4: 259
1151850144_1151850149 2 Left 1151850144 17:76685165-76685187 CCTGTGGAGGGGGGACCCAGTAA 0: 1
1: 0
2: 0
3: 3
4: 98
Right 1151850149 17:76685190-76685212 GCCAGGAGTGCTGTAGAGGCTGG 0: 1
1: 0
2: 1
3: 26
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151850149 Original CRISPR GCCAGGAGTGCTGTAGAGGC TGG Intronic
900218221 1:1493486-1493508 GGCTGGAGTGCAGTAGAGACAGG + Intronic
900433775 1:2616830-2616852 GCCGTGGGAGCTGTAGAGGCAGG - Intronic
900566192 1:3333181-3333203 GCCAGGTGTCCTGGAGAGGTGGG + Intronic
902331214 1:15732059-15732081 GCCAGGTGAGCGGTAGGGGCAGG - Intronic
902532948 1:17102304-17102326 GCCAAGGGTCCTGTAGAGCCAGG + Intronic
904388625 1:30164244-30164266 GACAGGAGGGCTGCAGGGGCTGG + Intergenic
904537326 1:31208527-31208549 CCCAGGGGTGCTGTGAAGGCAGG - Intronic
904945506 1:34196163-34196185 GCCAAGAGTGCTGGTGAGGTGGG + Intronic
905029395 1:34871437-34871459 GCCAGGAGGGCTGCTGAGGGAGG - Intronic
910685573 1:89912520-89912542 GTCTGGAGTTCTATAGAGGCAGG - Intronic
911122582 1:94310960-94310982 GGCAGGAGTGCAGTAGAGAAGGG - Intergenic
913157170 1:116111303-116111325 GGCAGGAGTTCTGTAGAAGTTGG + Intergenic
916187357 1:162146088-162146110 GCTGGGAGTGCAGCAGAGGCAGG + Intronic
919169384 1:193934950-193934972 GCCTGGGGTGCGCTAGAGGCAGG + Intergenic
920182367 1:204140220-204140242 GGCAGGGTTGCTGCAGAGGCCGG - Intronic
923070365 1:230558746-230558768 GACAGGTGAGCAGTAGAGGCTGG - Intergenic
923311623 1:232741119-232741141 CTCAGGAGTGCTGTGTAGGCTGG + Intergenic
923417799 1:233781472-233781494 GTCTGGAGTGCTGTACAGTCAGG - Intergenic
924214992 1:241811734-241811756 GGCAGGGGAGCTGAAGAGGCTGG - Intergenic
924939744 1:248804748-248804770 GGCAGGTGGGCTGCAGAGGCAGG + Intergenic
1062844688 10:695351-695373 GGCAGGAGTGCTGCTGTGGCTGG + Intergenic
1063447166 10:6126608-6126630 TCCAGGACTGGTGCAGAGGCTGG - Intergenic
1065165017 10:22967115-22967137 TCCAGGGGTGCTGTACTGGCAGG + Intronic
1065971925 10:30812501-30812523 GCCAGGCGTCCTGTTGGGGCTGG - Intergenic
1067375792 10:45727046-45727068 GCCAGGAACGCTGCAGAGGCGGG - Intergenic
1067441957 10:46313521-46313543 GCCAGGAGTGCTGGCTAGGATGG + Intronic
1067883502 10:50067734-50067756 GCCAGGAACGCTGCAGAGGCGGG - Intergenic
1068287858 10:54962748-54962770 GCCAGGAGTGGAGTAGAGAGGGG - Intronic
1068919247 10:62465457-62465479 GCCAGGAATGCTCTGGAGGCTGG + Intronic
1069595256 10:69666065-69666087 ACCAGGAGTGCAGCTGAGGCTGG + Intergenic
1070575863 10:77678328-77678350 GCCAGGATGGATGTAAAGGCAGG - Intergenic
1073122993 10:101133330-101133352 GGCAGAAGTGGTGTGGAGGCTGG + Intronic
1075083106 10:119396971-119396993 GCCAGGACTGGAGTAGGGGCGGG + Intronic
1075786570 10:125053949-125053971 CCCAGAAGTCCTGTAGGGGCTGG - Intronic
1075923215 10:126230152-126230174 GCCATGAGTGCTTTGGGGGCTGG - Intronic
1076219229 10:128719582-128719604 TCCATGAGTGCTGTGGAGGAAGG - Intergenic
1076637379 10:131891354-131891376 GGCAGGAGGGCTGGAGAGGGAGG - Intergenic
1076653174 10:132003916-132003938 GCCAGGAGTGATGCAGAGAGAGG - Intergenic
1076715326 10:132361121-132361143 GCCAGGTTTGCTGCAGTGGCTGG - Intronic
1076891077 10:133283712-133283734 GCAGGGAGTGCGGGAGAGGCAGG - Intronic
1076891082 10:133283730-133283752 GCAGGGAGTGCAGGAGAGGCAGG - Intronic
1076891090 10:133283767-133283789 GCAGGGAGTGCAGGAGAGGCAGG - Intronic
1077093938 11:791530-791552 GCCAGGATGGCTGTGGAGACTGG + Exonic
1077139033 11:1015467-1015489 GCCAGGAGTGCAGCAGTGACCGG + Intronic
1077192993 11:1263275-1263297 GCAAGGAGGGCAGGAGAGGCTGG - Intergenic
1078855284 11:15201661-15201683 GCCAGGAGAGCTGGGGAGGCAGG + Intronic
1079114834 11:17634462-17634484 GCAGGGAGTGCTGTGGAGCCAGG + Intronic
1082260038 11:50071661-50071683 GCCAGGAGGGAGGCAGAGGCTGG + Intergenic
1082260440 11:50073420-50073442 GCCAGGAGGGAGGCAGAGGCTGG + Intergenic
1083506014 11:63157979-63158001 GCCAGGAGTGCTGATGGGTCGGG - Intronic
1083759196 11:64806538-64806560 GCCAGCAGTCCTGTAGACCCAGG - Intronic
1083872279 11:65496411-65496433 GACAGAAGTGCTGGAGAGGAAGG + Intergenic
1084215537 11:67645233-67645255 GCCAGGAGGGCTGGAGGGGCGGG - Intronic
1084681366 11:70668367-70668389 GGCTGGAGTGATGTGGAGGCTGG + Intronic
1084694232 11:70744300-70744322 TCCATGACTGCAGTAGAGGCTGG + Intronic
1085342843 11:75744676-75744698 GCCAGGAGAGTTGCATAGGCAGG - Intergenic
1091102892 11:132892182-132892204 GGCTGGAGAGCTGGAGAGGCTGG + Intronic
1091589682 12:1835878-1835900 GCCAGGAGTACTGAAGATGGAGG - Exonic
1091642550 12:2248484-2248506 GCCTGCAGTGCTGTAGAAACTGG + Intronic
1091782639 12:3223640-3223662 GCAGGGACTGCTGGAGAGGCAGG - Intronic
1091921121 12:4305755-4305777 GCCAGGAAAGCTGCAGGGGCAGG - Intergenic
1093466403 12:19453838-19453860 GGCTGGAGTGCGGTGGAGGCGGG + Intronic
1094757061 12:33483570-33483592 GCCTGGTGTGCTGTATATGCTGG + Intergenic
1095709781 12:45275983-45276005 TCCAGGAGTGCTGTCAAGGAGGG - Intronic
1096623545 12:52879340-52879362 GGAAGGAGTGCTGTGGAGGAAGG + Intergenic
1097524261 12:60710739-60710761 CCCAGGAGTGGTGCAGAGGAAGG - Intergenic
1098144692 12:67486847-67486869 CCCAGGAGTGATGTGGAGCCAGG + Intergenic
1098887009 12:75970378-75970400 GCCAGGAGTGATTTGAAGGCAGG + Intergenic
1099120993 12:78689017-78689039 GCCAGGAGTGCTGATTAGCCAGG - Intergenic
1100608467 12:96170968-96170990 GCCAAGAGGGCTGTAGAATCTGG - Intergenic
1103274730 12:119701743-119701765 TCCAGGAATTCTGTAAAGGCAGG + Exonic
1103498673 12:121383283-121383305 GAGAGCAGTGCTTTAGAGGCTGG + Intronic
1103956031 12:124577365-124577387 GCCAGGAGTGCTGCAGAGCACGG + Intergenic
1105573962 13:21632284-21632306 GACAGGTGTGCTGTAGATGCAGG - Intergenic
1105766106 13:23560814-23560836 GCCAGGGGTGTAGCAGAGGCAGG - Intergenic
1111790385 13:92847584-92847606 CCCAGCAGTGCTGTACAGCCTGG + Intronic
1113435332 13:110286706-110286728 GCCAGCAGGGCTGCAGAGCCGGG - Intronic
1113743515 13:112726615-112726637 GCCGGGGGTGCTGCAGATGCTGG + Intronic
1113748514 13:112762818-112762840 TCCAGGAGTGGCGTGGAGGCCGG + Intronic
1113831668 13:113300335-113300357 GCCAGGCGTGGTGTGGTGGCAGG + Intronic
1118719794 14:68585869-68585891 GCAAGGAGAGCTGCAGAGGGGGG + Intronic
1120160618 14:81141195-81141217 GCCAGGAGTGGGGTAGAGGATGG + Intronic
1120965807 14:90166772-90166794 GGAAGGAGAGCTGCAGAGGCAGG + Intronic
1121656369 14:95599254-95599276 GCCGGGAGAGCAGTAGAAGCTGG + Intergenic
1122833948 14:104421842-104421864 ACCAGGACAGCTGCAGAGGCCGG - Intergenic
1123078282 14:105680133-105680155 GCCAGGCGTGCTCTCGGGGCCGG - Intergenic
1123107124 14:105846879-105846901 ACCAGTGGTGCTGTAGAGGGAGG - Intergenic
1125129470 15:36265500-36265522 GCAAGGAGTCCTGTTGATGCAGG + Intergenic
1125795884 15:42403614-42403636 TCCAGGGGTTCTCTAGAGGCTGG + Intronic
1127214952 15:56814397-56814419 GCCAGGAGGGCTAGAGAGCCAGG - Intronic
1127654763 15:61045682-61045704 GCCAGGAGTCAGGGAGAGGCTGG + Intronic
1128765936 15:70251135-70251157 CCCAGGAGTCCTGCATAGGCCGG + Intergenic
1129032560 15:72629447-72629469 GCCAGGGCTGCTCTGGAGGCAGG - Intergenic
1129217333 15:74107796-74107818 GCCAGGGCTGCTCTGGAGGCAGG + Intronic
1129470512 15:75751058-75751080 GCCAGGGCTGCTCTGGAGGCAGG - Intergenic
1129734490 15:77952080-77952102 GCCAGGGCTGCTCTGGAGGCAGG + Intergenic
1129841100 15:78743911-78743933 GCCAGGGCTGCTCTGGAGGCAGG - Intergenic
1131292863 15:91122227-91122249 GCCAGGGGTGTCGTAGATGCAGG + Intronic
1133200017 16:4198356-4198378 GAGAGGAGAGCTGCAGAGGCTGG - Intronic
1133741388 16:8654285-8654307 ACCAGGAGTGGTGAAGAGCCTGG - Intergenic
1138249662 16:55492058-55492080 GCCAGGAGTGCTGGAGACGAGGG + Intronic
1138521045 16:57570967-57570989 GACAAGAGTGCTGTGGGGGCTGG + Intronic
1138606548 16:58093781-58093803 GCTACGAGTGCTGGAGAGCCTGG - Intergenic
1139968241 16:70757455-70757477 CCCAGGAGTGCTGGGGAGGCTGG + Intronic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1140696115 16:77535884-77535906 GCCAGGAGAGGTGCAGAGTCTGG - Intergenic
1141486229 16:84342093-84342115 GCCGGGAGTACTGAAGTGGCCGG - Intergenic
1141665965 16:85465247-85465269 GGCAGGAGAGCTGGGGAGGCAGG - Intergenic
1141909278 16:87047519-87047541 GACAGGAGAGCTGAAAAGGCAGG + Intergenic
1141948181 16:87324422-87324444 ACCAGGAGTGCTGGTGTGGCTGG - Intronic
1142265537 16:89062559-89062581 GGCAGGAGGGCTGCAGGGGCAGG + Intergenic
1144283140 17:13746465-13746487 GCCAGGAGAGCCATTGAGGCAGG + Intergenic
1145973001 17:28967950-28967972 GCCAGGAATGCTGAGGATGCAGG + Intronic
1147439682 17:40440398-40440420 GGCAGGAGTGCAGGAGAGGCCGG - Intergenic
1148755633 17:49971712-49971734 GCCAGCAGTGGGGTCGAGGCAGG + Intronic
1149151063 17:53564443-53564465 GCCAGGGTTGCTGCAGAAGCTGG + Intergenic
1149380276 17:56086641-56086663 GCCAGGACTGCTGTCCAGGATGG - Intergenic
1150280679 17:63928251-63928273 GGTGGGAGTGTTGTAGAGGCAGG + Intergenic
1150323583 17:64237307-64237329 GACAGGAGTGCGGCAGGGGCTGG + Intronic
1150656538 17:67043500-67043522 CCCAGGAGAGATGTAGAGGCTGG + Intergenic
1151473570 17:74332596-74332618 TCCCGGGGTGCTGTAGAGCCAGG + Intronic
1151850149 17:76685190-76685212 GCCAGGAGTGCTGTAGAGGCTGG + Intronic
1203160432 17_GL000205v2_random:44062-44084 GCCATGAATGCTGTATAGTCTGG + Intergenic
1154378086 18:13825352-13825374 GCAAGGAGAGCAGAAGAGGCTGG + Intronic
1157261331 18:46177970-46177992 GCCAGCAGTGCTCTAGTTGCAGG + Intronic
1158184046 18:54751205-54751227 GACAGGAGTGCTGAAGAGGATGG + Intronic
1159264754 18:66065810-66065832 GCCAGGAGTGCTGGAGGGCCAGG + Intergenic
1159902446 18:74060272-74060294 GCCAGGAGAGCTGTAGACAGAGG - Intergenic
1160369293 18:78358308-78358330 GCCAGGAGTGCAGAAGGTGCTGG + Intergenic
1160550317 18:79690785-79690807 CCCAGGACTCCTGTAGTGGCTGG - Intronic
1160683323 19:422469-422491 GACAGGAGTGCTGGGCAGGCAGG + Intronic
1160784352 19:892695-892717 GACTGGGGGGCTGTAGAGGCAGG - Intronic
1161707302 19:5828209-5828231 GCCAGTGGTGCCGTCGAGGCGGG - Exonic
1162310733 19:9905664-9905686 GCCACTAGTGCTGAAGGGGCCGG + Intronic
1163291067 19:16379259-16379281 CCCAGGAGTGCTGCTGTGGCGGG - Intronic
1163367060 19:16881154-16881176 GTCAGAAGTGCTGCAGGGGCTGG + Intergenic
1163866322 19:19776385-19776407 GCCAGCAGTGCTTTAGACACAGG + Intergenic
1166034088 19:40154688-40154710 CCCTGGAGTACTGTAGAAGCTGG + Intergenic
1166369366 19:42292694-42292716 GCCAGGGGTGCTGAGGAGGTGGG - Exonic
1166405833 19:42521411-42521433 GCCAGGAGTACTGTGCAGGTGGG + Exonic
1166987459 19:46669886-46669908 GACAGGAGTGTTGTAGGGGATGG + Intergenic
1167496294 19:49820755-49820777 GCCAGGCGTGGTGGTGAGGCAGG - Intronic
1168011806 19:53538967-53538989 GCCAGAAGTGCTGTGCATGCAGG + Intronic
1168227375 19:55005482-55005504 GCCAGGAGTGCTGTTTGGTCAGG + Intergenic
1168513184 19:56989748-56989770 GGCAGGACTGCTTTAGATGCAGG + Intergenic
1168725995 19:58582352-58582374 GCCGGGAGTGCTGTCCAGGATGG - Intergenic
925530230 2:4851030-4851052 GCCAGGAGTGCAGGAGAGACCGG + Intergenic
925695130 2:6568419-6568441 GCCAGGACAGCAGCAGAGGCAGG - Intergenic
926213565 2:10889688-10889710 GCCAGGAGAGCAGAAGGGGCTGG - Intergenic
927148782 2:20184057-20184079 GCCAGGAAAGCTGAACAGGCTGG + Intergenic
928333745 2:30377847-30377869 GGCAGGAGAACTGTGGAGGCAGG - Intergenic
932073500 2:68643563-68643585 GCCAGCTGGGCTGCAGAGGCCGG - Intergenic
933275475 2:80279247-80279269 GCCTGGAGTGCTGGAAAGGTGGG - Intronic
936032132 2:109080921-109080943 TCCAGGAGGGCTGGAGAGCCAGG + Intergenic
937373560 2:121319573-121319595 CCCAGGAGTGCAGGGGAGGCTGG + Intergenic
937379428 2:121363133-121363155 GCCAGGGGTGCTGAACAGACGGG - Intronic
942868085 2:180699780-180699802 GCCATGGGTGCTGTGGGGGCGGG - Intergenic
943049905 2:182901854-182901876 CCTAGGTGTGCTGCAGAGGCAGG - Intergenic
943812808 2:192210627-192210649 GCCAGGATTTATGCAGAGGCTGG + Intergenic
946263639 2:218519679-218519701 GGCTGGAGTGCAGTAGTGGCGGG + Intronic
947788162 2:232843412-232843434 GCCAGGCGTGGTGTGGTGGCAGG + Intronic
948807169 2:240457986-240458008 ACCAGGAGGGCCTTAGAGGCGGG + Intronic
948954178 2:241273782-241273804 GCCACGGGTGCTGTTGAGGATGG + Intronic
1169164285 20:3408359-3408381 GCCAGGAGTCCTGTATATACAGG + Intergenic
1171378636 20:24714818-24714840 GCCATGGCTGCTGTAGAGGATGG + Intergenic
1172068333 20:32237528-32237550 GCCAGCATGGCTGGAGAGGCAGG + Exonic
1172585414 20:36080088-36080110 GCCAGGAGTGCTGAATGGTCAGG + Intergenic
1173934855 20:46852328-46852350 GTCAGGAAGGCTGTAGAGCCAGG - Intergenic
1174157642 20:48527027-48527049 GCCAGGATTGCTACAGAGGGAGG - Intergenic
1174859104 20:54073274-54073296 GTCAGGAGTGGTGATGAGGCAGG + Intergenic
1174918441 20:54677351-54677373 GCCAGGGTGGCTGTAGAGGAAGG + Intergenic
1175049560 20:56142060-56142082 GCTAGGAGTCCTGTAGCTGCAGG - Intergenic
1175731183 20:61354824-61354846 GCCAGGGGTGCAGGAGCGGCTGG + Intronic
1175885531 20:62288358-62288380 GCCCTGAGGGCTGCAGAGGCCGG + Intronic
1175929587 20:62487439-62487461 ACCAGGAGATCTGTGGAGGCCGG - Intergenic
1176029829 20:63006595-63006617 GCCCGGAGTGCCGTAGCCGCGGG + Exonic
1177215794 21:18126897-18126919 TCCAGGATTTCTGTAGAGTCTGG - Intronic
1178581620 21:33843252-33843274 GCCACCAGTTCTGTGGAGGCAGG - Intronic
1178952549 21:36997011-36997033 GCCAGGCTTGCTGCAGAGTCTGG - Intergenic
1179358159 21:40681420-40681442 GCCAGGAGTGCTGGTGTGCCAGG - Intronic
1180705825 22:17809190-17809212 CCCAGGAGTGTTGCAGAGACAGG + Intronic
1180722316 22:17918689-17918711 GCCAGCAGGGATGGAGAGGCTGG - Intronic
1180946232 22:19695299-19695321 GCGAGCAGTGCAGAAGAGGCGGG + Intergenic
1181495880 22:23287295-23287317 GCCAGGAGAGCAGGAGGGGCCGG - Intronic
1182903668 22:33919835-33919857 GCCGGGAGCCCTGGAGAGGCTGG - Intronic
1183602850 22:38850129-38850151 GCCAAGGATGCTGTAGGGGCGGG + Intergenic
1184294675 22:43515843-43515865 GGCAGGAGTGCAGTGGAGGGTGG + Intergenic
1184903843 22:47465362-47465384 GCCAAGGGTGCAGTGGAGGCAGG - Intronic
954394909 3:50288336-50288358 GCCTGGAATTCTGTAGAGGCCGG - Intronic
955496140 3:59534768-59534790 CCCAGGATGGCTGTAGAAGCAGG + Intergenic
956334321 3:68146263-68146285 CCCAGGGGTTCTGTTGAGGCTGG + Intronic
956384474 3:68702200-68702222 GCCAGAACTGCTGTGGATGCTGG - Intergenic
958004248 3:87792622-87792644 GCTAGGCGTGCTGGAGAGCCTGG + Intergenic
958641495 3:96813381-96813403 GCCCGGAGCGCTGCAGAGCCCGG - Intergenic
960994243 3:123330613-123330635 TCCAGGAGTGGAGGAGAGGCTGG - Intronic
963947413 3:151161448-151161470 GACAGGAGTGCTTAAGAGTCGGG + Intronic
964293150 3:155204054-155204076 GCCAGGAGTGGAGTAGAGGTGGG - Intergenic
964402001 3:156309733-156309755 GAAAGGAGTGGTGTAAAGGCTGG + Intronic
964514539 3:157493612-157493634 ACCAGGAGTTCTGGAGAGCCAGG - Intronic
964600150 3:158491411-158491433 TCCAGGAGTATTGGAGAGGCAGG + Intronic
965576187 3:170221138-170221160 ACCAGGACTGCTGCAGGGGCTGG + Intergenic
968763856 4:2458066-2458088 GCCGGGAGTGCAGAAGAGGGCGG - Intronic
969601138 4:8177058-8177080 GTCAGGGGAGCTGTAGAGGTTGG + Intergenic
969722118 4:8897922-8897944 GCCAGAAGAGCTGGAGAGGAGGG - Intergenic
971500127 4:27309976-27309998 GCCATGAGTCCTCTGGAGGCAGG + Intergenic
973758106 4:54094647-54094669 GCCAGGAGAACTGGAGAGGGAGG + Intronic
975175952 4:71289097-71289119 GCCAGGATTCCAGTACAGGCAGG + Intronic
977494592 4:97759118-97759140 GCCAGAAGTTTTATAGAGGCAGG + Intronic
978557542 4:109997112-109997134 GCCAGGAGTGCTGATGGGTCAGG + Intronic
980694256 4:136336272-136336294 CCCAGAAGTGGTGTAGAGCCAGG + Intergenic
985634585 5:1029861-1029883 GCAAGGAGTGCTGTACGCGCTGG + Intronic
985805258 5:2038842-2038864 GCCAGGAGTGCAGCACTGGCTGG - Intergenic
987947015 5:24623190-24623212 GCCAGCAGTCCTGCAGATGCAGG + Intronic
988616560 5:32780784-32780806 GCCATGACTGATGTGGAGGCGGG + Exonic
989814587 5:45720967-45720989 GCCAATAGTGATGTGGAGGCCGG + Intergenic
993885894 5:93414574-93414596 TCCAGGATTTCTCTAGAGGCTGG + Intergenic
995134752 5:108669038-108669060 GCCAGGTGTGCTTTAGATACTGG - Intergenic
997183476 5:131857824-131857846 ACCAGCAGTGGTGGAGAGGCAGG - Intronic
997284525 5:132668622-132668644 GTCAGGAGGGCTGGAGGGGCAGG - Intergenic
997415541 5:133725540-133725562 GACAGGAGTGAAATAGAGGCGGG - Intergenic
1000750379 5:165088179-165088201 GCCAGTAGAGCTGGAGAGGAAGG + Intergenic
1002450225 5:179314537-179314559 GCCCGGGGGGCTGCAGAGGCAGG - Intronic
1002451256 5:179320077-179320099 CCCAGGAGAGCTGTAGAGGCTGG + Intronic
1002452380 5:179326254-179326276 CCCAGGAATGCTGTATTGGCGGG + Intronic
1003385262 6:5661527-5661549 GCCAGGAGTGAGGAAGAGCCAGG + Intronic
1004251270 6:14024935-14024957 GACAGGAGTGATGCAGAGGCTGG + Intergenic
1005510346 6:26506862-26506884 GTCAGGAGTGCTTCAGAGGCAGG + Intronic
1006053083 6:31358326-31358348 GACAGAAGGGCTGGAGAGGCAGG - Intergenic
1006309640 6:33248815-33248837 GCGAGGAGGGCTGTGCAGGCAGG - Intergenic
1006641315 6:35491190-35491212 CCCAGGAGAGATGTGGAGGCAGG + Intronic
1007441962 6:41869498-41869520 GCCAGGAGTTCAAGAGAGGCTGG + Intronic
1012765166 6:103357974-103357996 GCCAGCAGTGGTTTAGTGGCAGG - Intergenic
1014282483 6:119457415-119457437 GCCAGGAGTTCATTAGAGGGGGG - Intergenic
1016828166 6:148406983-148407005 GGCAGGAGTGGTATAGAGGAGGG + Intronic
1017007839 6:150040830-150040852 GTCAGGAGAGGTGTAGAGGCAGG - Intergenic
1018395240 6:163373409-163373431 GCCAGGCGTGCAGGAGCGGCAGG + Intergenic
1018573446 6:165233945-165233967 GCCAGGAGGGAAGCAGAGGCAGG - Intergenic
1018574296 6:165243181-165243203 GACAGCAGTCCTGTAGAGGACGG - Intergenic
1019271015 7:149269-149291 CGCAGGCGTCCTGTAGAGGCGGG - Intergenic
1019288645 7:236326-236348 GCCAGCAGTGCTGGACAGCCTGG - Intronic
1019352453 7:561315-561337 CCTGGGAGTGCTTTAGAGGCAGG - Intronic
1019357378 7:587714-587736 GCCAGGAGGGCTGCACAGGAGGG - Intronic
1019455133 7:1123006-1123028 GCCTGGAGTGCTGGGGAGGTGGG - Intronic
1019459477 7:1149323-1149345 GCCAGAGGTGCTGCAGACGCAGG + Intergenic
1021638194 7:22711925-22711947 ACATGGTGTGCTGTAGAGGCTGG + Intergenic
1022532272 7:31074467-31074489 GCGAGGAGGGCTGCAGAGGTCGG - Intronic
1023177426 7:37448082-37448104 GCCAGGAGGGCCGGAGAGGGCGG - Intronic
1024000770 7:45188069-45188091 GCCAGGCCTGATGGAGAGGCAGG - Intergenic
1024211397 7:47208842-47208864 GCCTGGAGTGTTGGAGAGGCTGG - Intergenic
1024977699 7:55129267-55129289 CCCAGGAGGGCTGTGGAGGCGGG + Intronic
1026288010 7:68980658-68980680 GCCAGGAGTGCTGATTAGTCAGG - Intergenic
1026540787 7:71278284-71278306 GCCAGGACTGCTGTACTGGATGG + Intronic
1027363475 7:77433081-77433103 GCCAGGAGTTCTGAAGTGGCGGG + Intergenic
1027455469 7:78386085-78386107 CCCAGGAATGCTGCAGAGGTGGG - Intronic
1032414728 7:131727331-131727353 CCCTGGACTGCTGTAGATGCTGG - Intergenic
1032843592 7:135734149-135734171 GCCAGGGTGGCTGGAGAGGCTGG + Exonic
1035160962 7:156949747-156949769 TCCAGGAGCGCGGGAGAGGCCGG + Exonic
1035717248 8:1763822-1763844 GCCGGGAGTCCTGCAGGGGCGGG + Exonic
1037480131 8:19297259-19297281 GACAGCAAAGCTGTAGAGGCTGG + Intergenic
1038429054 8:27485241-27485263 GCCAGGCGTGCGGTGGGGGCAGG + Intergenic
1039066762 8:33615482-33615504 GGCTGGAGTGCAGTGGAGGCAGG - Intergenic
1042312717 8:67394674-67394696 GCCAGCAGGGATGGAGAGGCTGG + Intergenic
1044657078 8:94559613-94559635 TCCAGGAGGGCTGTATATGCAGG + Intergenic
1045564824 8:103303119-103303141 GCCTGGAGTGCTCTAGAACCAGG - Intronic
1047811307 8:128412165-128412187 GCCAGGAGTGTTCTAGATACAGG + Intergenic
1048992899 8:139771789-139771811 GCCAGGAGAGCTGCAGGAGCAGG - Intronic
1049601788 8:143511249-143511271 TCCAGGAGTCCTGCAGAGCCTGG + Intronic
1053369791 9:37551242-37551264 TCCAGCAATGCTGTGGAGGCAGG - Intronic
1054951550 9:70857645-70857667 GACAGGAGTCCTGAGGAGGCTGG + Intronic
1055152612 9:73020807-73020829 GGCAGGAGTGCTCTACAGGCAGG + Intronic
1056343085 9:85657613-85657635 GCCAGGAGAGCTGTAGACAGAGG - Exonic
1056518155 9:87374355-87374377 GCCAGGAGTGCTGATTAGTCAGG + Intergenic
1057041101 9:91847901-91847923 GCCAGGAGTTCTGCTGAAGCTGG - Intronic
1057526961 9:95811381-95811403 GCCAGGAGTTCTGCAGGGGCAGG + Intergenic
1061585902 9:131568164-131568186 GACAGGTGTGCGGTAGGGGCAGG + Intergenic
1061842309 9:133366420-133366442 CCAAGCAGGGCTGTAGAGGCAGG - Intronic
1185611301 X:1395049-1395071 GCCAGGAGCGCTGTGGGTGCTGG + Intergenic
1186371459 X:8951558-8951580 GGCAGGAGTGCTGGGGAGGCTGG + Intergenic
1187727107 X:22214670-22214692 GCCAAGAGGGCTCTAGTGGCTGG + Intronic
1191840280 X:65508847-65508869 GCCTGGAGTGCGGTGGAGGGTGG - Intergenic
1192264713 X:69530445-69530467 GCAAGGTGTGCTGAAGTGGCAGG - Exonic
1196732891 X:118958884-118958906 GGCTGGAGTGCTGCAGTGGCAGG - Intergenic
1198923398 X:141757048-141757070 GGCTGGAGTGCAGTACAGGCTGG - Intergenic
1199686776 X:150272139-150272161 GCCTGGACTACTGCAGAGGCAGG + Intergenic
1199845627 X:151691003-151691025 GTAAGGAGTGATGTTGAGGCAGG - Intergenic
1199971280 X:152863725-152863747 GCCAGGAGTGCTCCTGAGCCTGG + Intronic
1201291566 Y:12425336-12425358 GCCAGGAGGGCTGGAGAAGGTGG + Intergenic