ID: 1151851472

View in Genome Browser
Species Human (GRCh38)
Location 17:76692892-76692914
Sequence TTCACCAGGTTCCAAAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151851472 Original CRISPR TTCACCAGGTTCCAAAGAAC TGG Intronic
905047047 1:35013301-35013323 TTCATCAGGCTCCAAAGTTCAGG + Intronic
906874601 1:49523500-49523522 TTCACTTGATTCCAAAAAACTGG + Intronic
910727447 1:90353758-90353780 ATCATCAGGATCCAAATAACTGG + Intergenic
912267198 1:108170340-108170362 TTCAACACATTTCAAAGAACTGG - Intronic
919843114 1:201623441-201623463 CTCATCAGGCTCCAAAGACCTGG - Intronic
919993784 1:202729169-202729191 TCCACCTGGTTACAAAGAGCAGG + Exonic
923807594 1:237275803-237275825 TTCAGTAAGTTCCAAAGAATAGG + Intronic
1065917247 10:30364434-30364456 TTTACCAGGCTGCCAAGAACAGG - Intronic
1068647390 10:59482595-59482617 TTAACCAGATTTCAAAGAATGGG - Intergenic
1069073500 10:64014299-64014321 TTCACAAAGTTCCAAAGATTAGG + Intergenic
1070373014 10:75803400-75803422 TTCACCCTGTTACCAAGAACAGG - Intronic
1075161985 10:120032402-120032424 TTCCCCAGCTCCCAAAGTACTGG - Intergenic
1076894416 10:133302834-133302856 TTGACCTGCTTCAAAAGAACAGG - Exonic
1078475901 11:11629724-11629746 TTCAGCAGGTGCCAATGAATAGG + Intergenic
1080371650 11:31653305-31653327 GTCACCAGTTTTCAAAGAATTGG - Intronic
1083811455 11:65108977-65108999 TTCCCCAGTTTCCCAAGCACTGG - Intronic
1085303254 11:75471137-75471159 TTCACCAAGTTCCAAATGAGGGG + Intronic
1085603248 11:77874560-77874582 TGCACCAGGTTCCAAAGTAGGGG - Intronic
1085973905 11:81628425-81628447 ATCACCAATTTCCAAGGAACAGG + Intergenic
1086859817 11:91912401-91912423 CTCACCAGGTTCCCAGGAATAGG - Intergenic
1088113794 11:106293804-106293826 TTCACTAGTTTCCTAAGAAATGG + Intergenic
1088897012 11:114086091-114086113 TTCAGCAGGCTCCACAGAGCAGG - Intronic
1091075720 11:132614197-132614219 TCCAGCAGGTACCAAAGCACAGG - Intronic
1092184623 12:6469979-6470001 CTCACCTGGTGCCAGAGAACTGG + Intronic
1093078851 12:14786777-14786799 ATCACAAATTTCCAAAGAACTGG + Exonic
1093956338 12:25223432-25223454 ATTTCCAGGTTCCAAAGACCAGG - Intronic
1095743020 12:45627325-45627347 TTAGCCAGGCTCCAGAGAACGGG + Intergenic
1095747830 12:45679080-45679102 TTCATCACGTTACCAAGAACTGG + Intergenic
1096551185 12:52372829-52372851 GTCTCCAGCTTCCAAAGATCTGG - Intergenic
1096878687 12:54649705-54649727 TTCACCAAGGTCCCAGGAACAGG - Intergenic
1097155791 12:57011381-57011403 TTCACTAGCTTCCAAAGAATTGG - Intronic
1098156348 12:67603010-67603032 TTCACCAAGTTTACAAGAACTGG + Intergenic
1100614749 12:96222306-96222328 TTCACCAGGCTCCAAAGCTAAGG + Intronic
1101363136 12:104046799-104046821 TTCACCAAGATACATAGAACAGG + Intronic
1101901463 12:108794084-108794106 TTAAACAGGGTCCAGAGAACAGG - Intronic
1110261823 13:73493338-73493360 TTCTCTGGGTTCCCAAGAACTGG + Intergenic
1113838514 13:113345744-113345766 TTCACCCGGAGCCAAAGCACTGG + Intronic
1114304530 14:21409966-21409988 TTCACCAGGTAGTAAATAACGGG + Exonic
1115415578 14:33129029-33129051 TTCTCCAGGTTACAAAAACCTGG - Intronic
1115756013 14:36526294-36526316 TTGACCAGAGTCCAAAGAAGGGG - Intergenic
1116374644 14:44183488-44183510 TTCAACGAGTTCCAAAGAAAGGG + Intergenic
1117623347 14:57610373-57610395 TTGACCAGTTTCCCAAGAAGTGG - Intronic
1119521064 14:75285473-75285495 CTCACCAGGATCCCCAGAACTGG + Intergenic
1121092002 14:91189388-91189410 TCCACCAGGCTCCAAAGCATGGG + Intronic
1121552677 14:94814195-94814217 TTCACCAGCTTCCAACCCACAGG + Intergenic
1121572378 14:94956703-94956725 TTTACCAGGATCCACAGAATGGG + Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1123000783 14:105293034-105293056 TTCACCCGTTTCCTAAGAGCAGG + Intronic
1123895341 15:24823496-24823518 TACCCCAGGTTCCAAAAACCAGG - Intergenic
1127386237 15:58469515-58469537 ATCACCAGCTTCCCAAAAACAGG + Intronic
1131803524 15:96097681-96097703 TTCACCAGGTTTTAAACAGCAGG - Intergenic
1135281815 16:21159082-21159104 TTCCCCAGGTTCCCCAGAAAGGG - Intronic
1136670735 16:31854799-31854821 TCCACCAGGGTCCTAAAAACAGG + Intergenic
1138263056 16:55639397-55639419 AGCACCAGGTTCAAAAGGACTGG - Intergenic
1139659831 16:68413108-68413130 TTCACCTGGTGTCAAAGAGCAGG - Intronic
1140610411 16:76592107-76592129 TTCACCTGGTTCCAAAAGCCTGG - Intronic
1143795445 17:9332507-9332529 CTCCCAAGGTTCCAAGGAACTGG + Intronic
1144255437 17:13462813-13462835 TTCCCCAGGTCCCCAAGGACTGG - Intergenic
1147726923 17:42571604-42571626 TTCTCCAGGTTTCCAAGAACCGG - Exonic
1150955044 17:69848432-69848454 TGCACCAGGTACTAAAAAACAGG + Intergenic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1153229396 18:2921909-2921931 ACCACCAGGGACCAAAGAACTGG + Intronic
1153325947 18:3820383-3820405 TTCATCAGGAACCAAAGAACTGG + Intronic
1157186143 18:45541424-45541446 TTCATCTGTCTCCAAAGAACAGG + Intronic
1158536984 18:58317124-58317146 GTCGCAAGGTTCCAAAGGACTGG + Intronic
1159036216 18:63279617-63279639 TGCACAAGGCACCAAAGAACAGG + Intronic
1159536806 18:69725375-69725397 TTCTTCATGTTCAAAAGAACAGG + Intronic
1160072825 18:75643381-75643403 TTCACCAGGCCTCCAAGAACTGG + Intergenic
1160818371 19:1046664-1046686 TGGATCAGGTTCCAAGGAACAGG + Intronic
1161349114 19:3782817-3782839 TTGGCCAGGTTCCCAAGACCTGG - Intronic
1161896910 19:7089406-7089428 TTCTCCAGCTTCCAAACAAATGG + Intergenic
1163192069 19:15684583-15684605 GTCACCAGGGTCCAAAGAGGAGG + Intronic
1163241465 19:16066539-16066561 CTCCCCAGTTCCCAAAGAACAGG - Intergenic
1167476925 19:49706563-49706585 GTCTCCAGGTCCCAAAGCACTGG - Intronic
926393047 2:12413666-12413688 TTCTCCAGGTTTCTAGGAACAGG + Intergenic
927031233 2:19122660-19122682 TTCACAAGGTTCTCAAGAAGTGG + Intergenic
927559906 2:24062737-24062759 TTCACCCTCTTCCAAAGAATAGG - Intronic
931393183 2:61862351-61862373 ATGACCAGGTTTGAAAGAACAGG - Intergenic
931639781 2:64371569-64371591 ATCACCAAGTTCCAAAGCAGAGG + Intergenic
934759379 2:96845013-96845035 CTCCCCAGCTCCCAAAGAACTGG + Intronic
935107580 2:100059887-100059909 CACAGCAGGATCCAAAGAACAGG + Intronic
935896149 2:107739779-107739801 TTCACCAACTACCACAGAACTGG + Intergenic
937936603 2:127250353-127250375 ATCACAAATTTCCAAAGAACTGG - Intergenic
941078567 2:161033984-161034006 TTCATCAGTTTCCAAAAAACAGG + Intergenic
943013474 2:182480957-182480979 CTCTCCAGGTTCCAAGGATCTGG + Intronic
945691986 2:213047577-213047599 TTCTCCAGGTTTCAGAGATCTGG + Intronic
947453345 2:230229187-230229209 TTCACAATGTTAAAAAGAACAGG - Intronic
1170612601 20:17926804-17926826 ATCTCCAAGTTCCAAAGAACTGG + Intergenic
1172216169 20:33237396-33237418 TCCACCACATTCCAAAGAAGAGG - Intronic
1173132371 20:40406555-40406577 TTCACCAGGTATCAAAGACCTGG + Intergenic
1182807872 22:33090876-33090898 ATCACCAGGTGTCCAAGAACAGG - Intergenic
951791129 3:26485929-26485951 TTCAACAGGTTGCAGAGAATGGG - Intergenic
952684804 3:36135237-36135259 TTCTCCAGGACCCAAAGAATGGG + Intergenic
953604831 3:44405111-44405133 ATCACCAGCCTCCAAAGGACTGG - Intronic
963345664 3:144094321-144094343 TTCTCTATGTTCCAAACAACAGG + Intergenic
963925222 3:150944201-150944223 TTCACCAGGCTCCACTGCACTGG - Intronic
964858235 3:161170747-161170769 TTCACCATCTTCTAGAGAACTGG - Intronic
964936978 3:162101830-162101852 TTCACCAGGATGCATAGAAAAGG + Intergenic
972433698 4:39011256-39011278 TTCACAAGGTTGCAAAGAAAAGG + Intronic
973148596 4:46860549-46860571 TTCACCAGATGTCAAAGAAGGGG - Intronic
973730530 4:53818132-53818154 TTCACCAGCTTCCTTTGAACTGG - Intronic
973838120 4:54831524-54831546 TTAACCAGTTTACAAAGAATTGG + Intergenic
974596969 4:64026641-64026663 TTCACCAGGCTGCAGAGAATAGG + Intergenic
976651089 4:87435628-87435650 TTCTCCAGGTTACTAAGAACAGG + Intronic
977059990 4:92246037-92246059 TACACCAGATTTCAAAGAATTGG + Intergenic
977827196 4:101547224-101547246 TGAACCAGTTTTCAAAGAACTGG + Intronic
979696484 4:123618656-123618678 TTTGCCAGGGTCCCAAGAACAGG + Intergenic
982328236 4:154152006-154152028 TTAACCAGGTGCCAAAAATCTGG - Intergenic
982954795 4:161750365-161750387 TACACCAGGTTTCAAAGACTTGG + Intronic
985478528 5:92644-92666 TTCACGAGGTTACAAGGAAAAGG - Intergenic
985763117 5:1761896-1761918 ATCACCAGGTTCCCCAGAAGTGG + Intergenic
989234599 5:39131804-39131826 TATACCAATTTCCAAAGAACAGG + Intronic
989582705 5:43047927-43047949 TTCACCAGATTCCACAGAGTGGG + Intergenic
994135405 5:96280892-96280914 TTCACCTGGCTTCAAAGTACAGG - Intergenic
996430709 5:123373474-123373496 TTGCCCAGTGTCCAAAGAACAGG + Intronic
996486138 5:124037099-124037121 TACACCAGGTAGCAAAGAAGAGG + Intergenic
997558890 5:134826939-134826961 ATCACTAGGTGCCAATGAACTGG + Exonic
998624325 5:143828418-143828440 CTCAGCAGGTTTCAGAGAACAGG + Intergenic
1000896134 5:166857950-166857972 ATTACCAGGTTTCAAACAACTGG - Intergenic
1001300072 5:170527039-170527061 TGTACCAGGTCCCAAAGGACAGG - Intronic
1003839252 6:10103331-10103353 TTCAGCAGTTTCAAAAGAAAGGG + Intronic
1005653805 6:27911509-27911531 TTCACCCAGCTCCAAAGACCGGG - Exonic
1008391593 6:50958595-50958617 TTCTCTAGTTTCCAAAGTACAGG + Intergenic
1012003083 6:93679081-93679103 TTCACCAGGTTCCATGGCAGAGG - Intergenic
1013652786 6:112212808-112212830 TTCATCAGGTGTCGAAGAACAGG - Intronic
1014001916 6:116373466-116373488 TTCAACAGGTCCCCAAGATCAGG - Intronic
1017024150 6:150166902-150166924 TTCACTCGGTTCCAAATGACTGG - Intronic
1019356231 7:580990-581012 TTGACCAGCTTCCTAAAAACAGG + Intronic
1029309813 7:99652582-99652604 TTCACCATGACCCAAAGTACTGG - Exonic
1029331702 7:99861788-99861810 TTCACCATGACCCAAAGTACTGG + Exonic
1031354034 7:120768366-120768388 ATAACCAAGTTCCAAAGATCTGG + Intergenic
1033920694 7:146387784-146387806 TCCACCAGCTTCCTAAGAAAGGG + Intronic
1034912874 7:155011923-155011945 TTCACCAGGCTCCTCAGAAAAGG + Intergenic
1034995238 7:155572732-155572754 TTTACCAGGGCCCAAAGAATGGG + Intergenic
1035348200 7:158222082-158222104 TTGACAAGGTTGCAGAGAACAGG + Intronic
1036377514 8:8213543-8213565 GTCACCAGGTTCCACTGACCGGG + Intergenic
1037838839 8:22230149-22230171 CTCACCAGGTTCCCAAGAGATGG - Intronic
1039576271 8:38626384-38626406 TTCCCCAAGTCGCAAAGAACTGG + Intergenic
1049915714 9:316208-316230 ATCGCAAGGGTCCAAAGAACAGG - Intronic
1050721134 9:8591252-8591274 ATCACAAGGTTCCAAAGAATAGG + Intronic
1051949095 9:22609105-22609127 TTCACCAGATTCCAAAGTAGAGG + Intergenic
1054881788 9:70151660-70151682 TTCTCCAGGTGCGCAAGAACAGG - Intronic
1056437783 9:86589907-86589929 TTCACAATGTTCCATAGGACTGG - Intergenic
1057804958 9:98213147-98213169 TCCACCAGGTCACAAAGATCTGG - Exonic
1061970776 9:134044080-134044102 TTTACCAGGCTCCAGAGGACTGG + Intronic
1193077705 X:77373061-77373083 ATCACCAGCTTCCAAGGAAGAGG + Intergenic
1195771079 X:108352082-108352104 TTCACCTGACTCCAAAGAAAAGG - Intronic
1198590168 X:138171137-138171159 TTCACCAAGTCCTCAAGAACAGG - Intergenic
1198650340 X:138856567-138856589 TACACCAACTGCCAAAGAACAGG + Intronic
1198741315 X:139846219-139846241 TTCACCAGGTTGGAAACAACTGG - Intronic