ID: 1151851664

View in Genome Browser
Species Human (GRCh38)
Location 17:76694213-76694235
Sequence CTCAGGACAAGCACATGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151851664 Original CRISPR CTCAGGACAAGCACATGGTA GGG (reversed) Intronic
902230123 1:15022463-15022485 GTCACAACAAGCAAATGGTAGGG + Intronic
902289248 1:15426044-15426066 CTCAGGTGAAGCCCCTGGTAGGG - Intronic
903170322 1:21548327-21548349 CTCAGGACAAGGAGAGGGTGGGG - Intronic
904752414 1:32749227-32749249 CTCAGGCAAAGCACGTGCTAGGG + Intronic
905298042 1:36966909-36966931 CTCAAAACAAGCACATTGTCTGG - Intronic
906254003 1:44333453-44333475 ACCAGGACAAGCACATGGGAAGG + Intronic
912806100 1:112758291-112758313 CTAAGGTCACTCACATGGTACGG + Intergenic
915098843 1:153484156-153484178 CTCAGGAGAACCAAATGGAAGGG + Intergenic
916114512 1:161475568-161475590 AGCAGGCCAATCACATGGTAGGG + Intergenic
917732337 1:177887652-177887674 CTAAGGATAAGCACATACTATGG - Intergenic
918400944 1:184162411-184162433 CTAAGGACATGCAACTGGTAAGG + Intergenic
920765622 1:208830824-208830846 CTTAGGACAAGCAGCTGGTATGG - Intergenic
1063108403 10:3013809-3013831 ATCAGGTCAAGCACAGGGCATGG + Intergenic
1064092517 10:12396834-12396856 CTCAGGAAGAGCAGAAGGTAGGG - Intronic
1064258356 10:13764833-13764855 CTCAGTAAAAGCACAGGGTCAGG - Intronic
1065114339 10:22469953-22469975 CTCAGGAGACGCACAGAGTAAGG + Intergenic
1065636660 10:27742198-27742220 CTCAGGAAAAGCACATTCAAAGG + Intronic
1066465792 10:35648926-35648948 CTCAGGACATGGAGATGGTAGGG + Intergenic
1071458777 10:85872014-85872036 CTCAGGACTACCAGATGGAATGG + Intronic
1071819030 10:89261839-89261861 CTCAGGAATAGCACATTGCAGGG - Intronic
1073280499 10:102350536-102350558 CTCAGAACAAGAACCAGGTAGGG - Intronic
1073285504 10:102385132-102385154 CTCAGCACATGCACATGGCTGGG + Intergenic
1075001088 10:118798421-118798443 CTCAGCACAAGCCCAAGGCAGGG - Intergenic
1076892052 10:133289710-133289732 CTCAGGGCAACCACAGGGTGAGG + Intronic
1078019932 11:7648521-7648543 CTCAGGACATGGAAAAGGTAAGG + Exonic
1078267870 11:9768342-9768364 CTCAGAACAAGCAAATTGGATGG - Intergenic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1085537587 11:77232788-77232810 CGCATGTCAAGCACATTGTAAGG + Intronic
1085909077 11:80799731-80799753 CTCCAGACAAGCAAATGCTAAGG + Intergenic
1086940207 11:92789445-92789467 ATCAGGACAACCACAGGGCATGG + Intronic
1087861381 11:103161917-103161939 GTATGGACATGCACATGGTAAGG - Intronic
1090964198 11:131584179-131584201 CTTAGGAAAAGCACAGGGCAGGG - Intronic
1091650313 12:2304443-2304465 CTCAGAACAAGCTGGTGGTAGGG - Intronic
1093522698 12:20068707-20068729 TTCCGGACAAGCAAATGGTGAGG + Intergenic
1094113643 12:26886621-26886643 GTCAGCACCAGCACAAGGTATGG - Intergenic
1096571227 12:52524464-52524486 GTCAGGACCAACACATGGTCTGG - Intergenic
1097710554 12:62913001-62913023 CTCATGCAAAGCATATGGTATGG + Intronic
1101067525 12:101038342-101038364 CTCAGCCCCAGCTCATGGTATGG + Intronic
1103841323 12:123867643-123867665 CTAAAGACAAGCTCACGGTAGGG + Intronic
1103966777 12:124645082-124645104 CTCAGCACCTGCACATAGTAAGG - Intergenic
1104719218 12:131035333-131035355 GTCAGGACAAGCACAACGCATGG - Intronic
1104738455 12:131154517-131154539 GTCAGGAAATGCACATGCTATGG - Intergenic
1106799141 13:33238310-33238332 CTTAGGACAAGCAGATGTTTAGG - Intronic
1109057080 13:57564397-57564419 CTCTGAACAAGCATTTGGTAAGG + Intergenic
1114617897 14:24077879-24077901 GTCAGGACAGGCACCTGGGAGGG - Exonic
1114961985 14:27902886-27902908 CTCAGGATAAACACATGAGAGGG - Intergenic
1115565911 14:34625301-34625323 ATCAGGACAAACACAATGTAAGG + Intronic
1116047739 14:39764790-39764812 GTCAGGGCAAACACATGGTCTGG + Intergenic
1118277011 14:64394308-64394330 CCAATGACAAGCCCATGGTAGGG - Intronic
1120298918 14:82680709-82680731 GTCAAGAAAAGGACATGGTATGG - Intergenic
1123827519 15:24097956-24097978 CTGAGGACAACCACATCATACGG - Intergenic
1124805319 15:32875849-32875871 CCCAATACAAGCTCATGGTATGG + Intronic
1134757261 16:16678825-16678847 CTTAGGCCAAACACATTGTAAGG + Intergenic
1134988807 16:18680341-18680363 CTTAGGCCAAACACATTGTAAGG - Intergenic
1136718342 16:32302050-32302072 GCCAGGACAAGCACCTGGCAGGG + Intergenic
1136836716 16:33508320-33508342 GCCAGGACAAGCACCTGGCAGGG + Intergenic
1137643918 16:50058258-50058280 CTGAGCACAAGTACATGGTGTGG - Intergenic
1138370716 16:56524423-56524445 GTGAGGACAAGCAGATGGAATGG - Intergenic
1138541306 16:57689319-57689341 CCCAGGCCAAGCACAGGGTCTGG + Exonic
1142218027 16:88839359-88839381 CTCAGGGGAAGCACATGGGCAGG + Intronic
1142362985 16:89636051-89636073 CACAGGGCAAGCACAAGGCAGGG - Intronic
1142375275 16:89703404-89703426 CTCAAGACAAGGCCAGGGTATGG - Intergenic
1203008086 16_KI270728v1_random:215715-215737 GCCAGGACAAGCACCTGGCAGGG - Intergenic
1144635046 17:16900743-16900765 CTGACCACAGGCACATGGTATGG - Intergenic
1147461253 17:40570749-40570771 TTCAGGACAAGCAAATGTTGAGG + Intergenic
1147977578 17:44256589-44256611 TTGAGGACAAGCACAGGGGAGGG + Intronic
1148865315 17:50625281-50625303 CTCAGGACACACACATGGCATGG - Intronic
1150705836 17:67486628-67486650 CCAAGGACAAGCAAATGGCAGGG + Intronic
1151851664 17:76694213-76694235 CTCAGGACAAGCACATGGTAGGG - Intronic
1159860068 18:73637684-73637706 CTCAGGAACAGCAGATGGTACGG + Intergenic
1162426577 19:10600437-10600459 CTAAGGAGAATCCCATGGTATGG + Intergenic
1165824174 19:38696289-38696311 CTCTGGACAAGCATATGCTGGGG - Intronic
1166130225 19:40741693-40741715 CACATGACTAGCACATGGCAAGG - Exonic
932360356 2:71100319-71100341 CCCAGGACACACACATGGGATGG + Intergenic
932766650 2:74474789-74474811 CTCCTGACAAGCACCTGGTAAGG + Exonic
935870602 2:107444370-107444392 CTCAGTAGAAGCTCTTGGTAGGG + Intergenic
939179951 2:138793083-138793105 TTTCAGACAAGCACATGGTAAGG - Intergenic
946441646 2:219701929-219701951 TTCAGGACAAGCAAAGGGAAGGG + Intergenic
948372573 2:237498950-237498972 CCCAGGACAAGCAGAGGGTCAGG - Intronic
948704498 2:239780407-239780429 CACTGGACAAGCACATGGGGTGG + Exonic
1171946945 20:31387346-31387368 CTCAGGACCTGCAAATGTTAGGG - Intronic
1175638218 20:60603179-60603201 CACAGGAGAACCACATGGTGTGG + Intergenic
1175837830 20:62007548-62007570 TTCAGGAAAGGCACAAGGTAAGG + Exonic
1176376235 21:6088141-6088163 CCGAGGACAAGCACATGGAACGG + Intergenic
1178421913 21:32450097-32450119 CTCAGAATAAGAATATGGTAAGG + Intronic
1179375664 21:40848059-40848081 CACAGGAGAAGCAAATGGTGAGG + Intergenic
1179747240 21:43450103-43450125 CCGAGGACAAGCACATGGAACGG - Intergenic
1183032107 22:35113988-35114010 CTGAGGACAAGAACATGGACAGG + Intergenic
1183625630 22:38999735-38999757 CTCAGGACGTCCACATGGAAAGG + Intergenic
1183976617 22:41515945-41515967 ATCAGGCCCAGCACAGGGTAGGG - Intronic
1184896436 22:47409771-47409793 CTCAGGACCAGCACAGGGCCTGG + Intergenic
951455528 3:22888177-22888199 CTATTGGCAAGCACATGGTATGG + Intergenic
954177876 3:48858699-48858721 GTCAGGACTAGCACAGGGAAAGG + Intronic
955443891 3:58986626-58986648 CTCAGGTCATGTACATGGTTTGG - Intronic
955952066 3:64252351-64252373 CTCAGGTCAACCACATGCTATGG + Intronic
958107540 3:89096176-89096198 CTCAGGACAAGCACATAACAGGG - Intergenic
960404909 3:117247933-117247955 CTAAGGAGCAGCACAGGGTAAGG - Intergenic
961456898 3:127028877-127028899 CTCAGCACCAGCACAGGGCAGGG - Intronic
962075731 3:132080178-132080200 TTAAGAACAAGCAAATGGTAAGG + Intronic
964416567 3:156454216-156454238 CTCAGGATCAGCACAGGGCAGGG + Intronic
967417973 3:189240043-189240065 ATTAGGACTAGCACATAGTAGGG + Intronic
967782598 3:193456445-193456467 CTCAGGAAAAGCACAGGATGAGG + Intronic
968835607 4:2962567-2962589 CTAAGGTCACGCACCTGGTAAGG - Intronic
969135157 4:5023391-5023413 CTCTGGACAAGCACTTGACAGGG - Intergenic
970056798 4:11983059-11983081 CTCAGGAGAATCAGATGGAAGGG - Intergenic
975842731 4:78492718-78492740 TTCAGGACAAGGACAAGGCAAGG + Intronic
976836003 4:89374655-89374677 CTGAGGACAAGAACATTATAGGG - Intergenic
980347103 4:131635503-131635525 CTCAGGACAAGGACTTGCCAAGG - Intergenic
982188004 4:152821898-152821920 CTCAAGACAAGCAAATGCCAAGG + Intronic
982402045 4:154978815-154978837 CTCAGGACCAGCACCTGTGAGGG - Intergenic
983932728 4:173471211-173471233 ATAATGGCAAGCACATGGTAGGG + Intergenic
985399143 4:189576482-189576504 CTCAAGGGAAGCACATGGTAGGG + Intergenic
991106500 5:62849906-62849928 CTCCAGACAAGCAAATGCTAAGG - Intergenic
995352709 5:111199182-111199204 GTCAGGCAAAGCACATAGTAGGG + Intergenic
998044652 5:138976642-138976664 CTCAGAGGAAGCACATAGTAGGG + Intronic
998137199 5:139680388-139680410 CTCAGGGCAGGCACATGGTCAGG - Exonic
1000740989 5:164969604-164969626 CTCAGAAGAAACAAATGGTATGG - Intergenic
1002044955 5:176536638-176536660 CTCACGCCGAGCACATGGTCCGG - Intronic
1002391478 5:178916068-178916090 CTCAGGACAATAACATAGTGAGG + Intronic
1002548242 5:179967109-179967131 CACAGGAAAAGAACCTGGTAAGG - Intronic
1005838035 6:29722927-29722949 CTCAGGACAAGTTCATTGTCTGG + Intronic
1006082093 6:31573502-31573524 CTGAGGAGAGGCACATGGAAGGG - Exonic
1006796704 6:36736832-36736854 CTCATGACAACCCCATGGGATGG - Intergenic
1008302387 6:49857096-49857118 CTGAGGACTAGGACATGGCAGGG - Intronic
1014202302 6:118620426-118620448 AGCAGGACAATCACCTGGTAGGG + Intronic
1016995999 6:149962906-149962928 TTCAGGACAGGGACATGGGATGG - Intergenic
1018788511 6:167127980-167128002 CTCAGGGCAACCACATGGCTCGG + Intronic
1019709231 7:2510777-2510799 CTCAGGACAAGCAGTGGGCATGG + Intergenic
1022334006 7:29405906-29405928 CTCTGTTCAAGCACATTGTAGGG - Intronic
1023890882 7:44391242-44391264 CTCAGGACATGCCCCTGGTGTGG + Intronic
1024942528 7:54777353-54777375 CACAGGACAAGCACGTGGGGAGG - Intergenic
1028676634 7:93471389-93471411 CTCATCACAAGCACAAGCTAAGG - Intronic
1030777785 7:113556660-113556682 CTCAGGAAAAATAAATGGTATGG + Intergenic
1032930085 7:136656188-136656210 CTCTGGGCAAGCACATGCAAAGG - Intergenic
1033134530 7:138773648-138773670 CTCAGGAAGTGCACATGGTCTGG + Intronic
1033539447 7:142343191-142343213 TTCAGCCCAAGCACATGGCAGGG - Intergenic
1039999628 8:42565162-42565184 ATCAGGCCAATCACCTGGTAGGG - Intergenic
1040603551 8:48908221-48908243 CTGATGACAAGCACATGCCATGG - Intergenic
1040817487 8:51524071-51524093 CTGTGGACAAGCCCATCGTATGG - Intronic
1044399041 8:91748846-91748868 TCCAGGACATGCACAGGGTATGG + Intergenic
1044866006 8:96571953-96571975 CTCAGGACAAGTAAATTGAAGGG + Intronic
1048034838 8:130667678-130667700 CATAGGACAAGCACATGGCATGG - Intergenic
1048474345 8:134729848-134729870 GTCAGGACAAGCCCATGGAGTGG - Intergenic
1048496798 8:134942296-134942318 CTCAGGGCCAGCACAGGGCAGGG - Intergenic
1052990491 9:34516668-34516690 CTCTGGGCAAGCACATCATACGG - Intronic
1053039208 9:34855483-34855505 TTCAGGACAAGCAAATGTTAAGG - Intergenic
1053351021 9:37413306-37413328 CACAGGGCAAGGACAGGGTAGGG - Intergenic
1055056675 9:72030269-72030291 CTCAGGCCAAGGCCATGATAAGG + Intergenic
1055647242 9:78372744-78372766 CTCAGGACAGACAGAGGGTAGGG + Intergenic
1056932999 9:90894024-90894046 CTCAGGAAAAACACCTGGTCAGG - Intronic
1057476763 9:95409527-95409549 CTCAGAATAACCCCATGGTATGG + Intergenic
1058119113 9:101119147-101119169 CTGTGGACAAGAACATGGTAAGG - Intronic
1058132323 9:101266792-101266814 CTCAAGACAAACACAAGGAATGG - Intronic
1059633486 9:116150417-116150439 CTCATGACAACTCCATGGTAAGG + Intergenic
1060438054 9:123612888-123612910 CACAGCAGCAGCACATGGTAGGG + Intronic
1186730012 X:12399938-12399960 CCCAGGAGAACCACATGGTCAGG - Intronic
1189142235 X:38618997-38619019 CTCAGGACAAAGACAAGATAGGG - Intronic
1189889279 X:45582155-45582177 CTCAAGAGAAGCACTTGGTGAGG + Intergenic
1191190288 X:57659187-57659209 CTCATGACAATCAGATGCTATGG - Intergenic
1195561147 X:106285297-106285319 CTCAGGAAAAGCAAATAGTGGGG + Intergenic
1197069047 X:122271280-122271302 CTCAGGAGAAGCATTTGCTAAGG - Intergenic
1197551608 X:127899278-127899300 TTCAAGATAAGCACATGCTAAGG + Intergenic
1202583173 Y:26402903-26402925 GTCAGGACAGGGCCATGGTAGGG + Intergenic