ID: 1151853560

View in Genome Browser
Species Human (GRCh38)
Location 17:76706328-76706350
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 2, 1: 9, 2: 10, 3: 22, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151853560_1151853566 16 Left 1151853560 17:76706328-76706350 CCACGCTGCCATCACAGAGGCCC 0: 2
1: 9
2: 10
3: 22
4: 248
Right 1151853566 17:76706367-76706389 GGCCCACGCTGCCGTCACAGAGG 0: 5
1: 2
2: 9
3: 15
4: 130
1151853560_1151853562 -5 Left 1151853560 17:76706328-76706350 CCACGCTGCCATCACAGAGGCCC 0: 2
1: 9
2: 10
3: 22
4: 248
Right 1151853562 17:76706346-76706368 GGCCCACTCTGCCATCACAGAGG 0: 2
1: 3
2: 14
3: 20
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151853560 Original CRISPR GGGCCTCTGTGATGGCAGCG TGG (reversed) Intronic
900095952 1:940222-940244 GGGCCGCTCTGCTGGCCGCGCGG + Intronic
900099561 1:955782-955804 GGGACCCTGAGAAGGCAGCGGGG - Intronic
900109402 1:999223-999245 GGGCCTCTGCGGGGGCAGCCGGG + Exonic
900192800 1:1358592-1358614 AGGCCTCCGTGATGTCACCGCGG - Intronic
900673498 1:3870048-3870070 GGTCATCTGTTATGGCAGCCGGG - Intronic
901078616 1:6571167-6571189 GGGCGGCTGTGGTGGCAGCACGG - Exonic
901636949 1:10674914-10674936 GGCCCTCTGTCGTGGCAGCAGGG + Intronic
901808125 1:11750456-11750478 GGGCCTCTGTGGTGCCACCATGG - Exonic
902115143 1:14115038-14115060 GGGACTTTGTTATGGCAGCCTGG - Intergenic
902610641 1:17595369-17595391 GGGCCCCTGAGATGTCAGGGAGG + Intronic
902759587 1:18572457-18572479 GGGCCTCTGTGAAGGAGGCCAGG + Intergenic
903835568 1:26201238-26201260 GGGTCTCTGTCAGGGCTGCGTGG + Intronic
904162255 1:28530634-28530656 CGCCCTCTGTGCTGCCAGCGCGG + Intronic
905452000 1:38062937-38062959 GGGGCTCTGTGTTGGCTGTGGGG + Intergenic
910245403 1:85133288-85133310 GGGCCTCTGTGTGGACAGCAAGG - Intergenic
910476959 1:87617514-87617536 GAGGCTCTGTAATGGCAGTGAGG + Intergenic
912521159 1:110245651-110245673 GGGCGTGTGTTATGGGAGCGGGG - Intronic
912553421 1:110499096-110499118 GGCCTTCTGTCATGGCAGCCTGG + Intergenic
913475904 1:119237497-119237519 TAGCCTCTATGATGGAAGCGAGG - Intergenic
915264651 1:154708086-154708108 GGGCCTCGATGATGGCAGACAGG + Exonic
916173351 1:162018610-162018632 GGGCCTCTGTACTGGCAGGCAGG - Intronic
917494817 1:175530789-175530811 CGGCCCCTGTGTTGGCAGCATGG + Intronic
918232479 1:182548732-182548754 AGCCCTCTGTGATGGCAGCAAGG - Exonic
919208781 1:194453182-194453204 GGGACTCTGTCATGTCAGAGGGG - Intergenic
922472994 1:225888095-225888117 GGGCCACTGAGCTGGCAGCCAGG + Intronic
922480996 1:225940065-225940087 GGGCCACTGAGCTGGCAGCCAGG + Intronic
922539411 1:226407783-226407805 GGGCCGCTGTGCGGGCGGCGGGG - Intronic
923690913 1:236192206-236192228 CTGCTTCTGTGCTGGCAGCGAGG + Intronic
924471189 1:244343971-244343993 GGGTCCCTGTGATGGAAGCCGGG - Intergenic
924632276 1:245752313-245752335 GGGCCTCTGTGAGGGCAGGGAGG - Intronic
1062893462 10:1084477-1084499 CGGCATCTGGGATGTCAGCGTGG + Exonic
1063458440 10:6201396-6201418 GGGGCTCTGAGAGGGCGGCGCGG + Intronic
1067946654 10:50693550-50693572 GGGGCTCTGTGCTGTCAGTGAGG - Intergenic
1069643689 10:69974983-69975005 GGGCCTCTGTGAGGTCAGGAGGG - Intergenic
1069677778 10:70260735-70260757 GGGCCTCTGTCATTGCAGGGTGG - Exonic
1069800424 10:71078382-71078404 TGGCCTGTGAGAAGGCAGCGTGG - Intergenic
1070057960 10:72953690-72953712 GGGGCTCTGTGCCGGCAGCCAGG + Intronic
1070777760 10:79119793-79119815 GTGCCTCTGAGGTGGCAGCCAGG + Intronic
1073024138 10:100474020-100474042 AGGCTTGGGTGATGGCAGCGAGG + Intronic
1073083314 10:100873319-100873341 GGGCTTCAGGGATGGCAGCCAGG + Intergenic
1075852570 10:125601356-125601378 GGGCCTCTGAGATGGGAACCTGG - Intronic
1076555747 10:131320433-131320455 GGGGGTCTGGGAGGGCAGCGGGG + Intergenic
1076685060 10:132194828-132194850 GGTCCACTGTGAAGGCAGCATGG - Exonic
1076761663 10:132608851-132608873 GGCCCTCTGTGAGGGCATGGGGG + Intronic
1076805488 10:132856125-132856147 GGACCTCTGTGAAGGCCGAGAGG - Intronic
1076922107 10:133459521-133459543 GAGCCGCTGTGACGGCCGCGTGG + Intergenic
1077200646 11:1305834-1305856 AGGCCTCTCTGACGGCACCGCGG + Intronic
1078175173 11:8964581-8964603 GGGCCTCTGGGGTGGCAGCCTGG + Exonic
1078484401 11:11708095-11708117 GGGCTTCCATGATGGCAGTGTGG + Intergenic
1079317472 11:19421299-19421321 GGTCCTCTGTGATGGATGCTGGG - Intronic
1080635273 11:34118255-34118277 GGGCCTCCATGGTGGCAACGTGG - Exonic
1082793738 11:57365297-57365319 GGGCCTCTGTGCTGGCAGTGAGG + Intronic
1083209555 11:61174617-61174639 GGGCCCCTGTGATAGCACTGGGG - Intergenic
1083399796 11:62415603-62415625 GGGCAGCTGTGATGGCTGCAGGG - Intronic
1085973611 11:81624207-81624229 GGACCTCTGTGTTGGCATCTTGG - Intergenic
1089085225 11:115811470-115811492 GGACCACTGTGATGGAAGTGGGG - Intergenic
1091801537 12:3327766-3327788 GGGCTTCTGTGTTGACAGCTGGG + Intergenic
1092785021 12:12018702-12018724 GGGCCACTAAAATGGCAGCGAGG - Intergenic
1096085332 12:48861781-48861803 GGGCCTCTGGCAAGGCAGCATGG + Intronic
1097018616 12:56004664-56004686 GGGGCTCTGTGATGGCCGACTGG - Exonic
1098187330 12:67911482-67911504 GCCTCTCTGTGATAGCAGCGTGG + Intergenic
1098761867 12:74435029-74435051 GAACCTCTGTGAGGGCAGTGTGG + Intergenic
1101752141 12:107590531-107590553 AGGCCACTGGGCTGGCAGCGAGG + Intronic
1102745445 12:115245042-115245064 AGGCTTCTGGGAGGGCAGCGGGG + Intergenic
1103239899 12:119404443-119404465 GGGTCTCATTGATGGCAGGGTGG - Intronic
1103716402 12:122947761-122947783 GGCCCGCTGTGATGCCATCGCGG - Intronic
1103927035 12:124429004-124429026 GGGCCCCAGTGACGGCAGCCAGG + Intronic
1105241218 13:18610693-18610715 GGGCCTCAGTGGTGGCTGCCAGG - Intergenic
1105889965 13:24675684-24675706 GGGCCTGTGTGATAGGAGCATGG - Intergenic
1108454289 13:50597496-50597518 GGGCCTCTCCAATGGGAGCGTGG + Intronic
1112787771 13:102970231-102970253 GGGCCTCTGTGAGGAAACCGAGG + Intergenic
1113404749 13:110027898-110027920 GGGGCACTGAGATGGCAGCCTGG + Intergenic
1116387600 14:44350580-44350602 GGTCCTCTGGGATTGCAGAGAGG - Intergenic
1118497798 14:66325974-66325996 GGGCATCTGTGAAGGCTGGGTGG - Intergenic
1119141555 14:72271958-72271980 AGGACTCTGTGATGGCACTGGGG + Intronic
1119263187 14:73250264-73250286 GGGCATCTGTGATGCCTGCAAGG - Intronic
1121123369 14:91390446-91390468 GCGCCTCTGAGATGCCAGCTTGG - Intronic
1121521392 14:94588393-94588415 TGGCCTCTATGAGGGCAGAGGGG - Intronic
1122100634 14:99406883-99406905 GGGCCTCCCTGGTGGCAGTGAGG + Intronic
1122140555 14:99660512-99660534 GGGCCCCTGTCAGAGCAGCGAGG - Intronic
1123465488 15:20511734-20511756 GGGTCTCTGTGAAGGGAGCTTGG - Intergenic
1123490138 15:20774454-20774476 GGGCCTCAGTGGTGGCTGCCAGG + Intergenic
1123546639 15:21343541-21343563 GGGCCTCAGTGGTGGCTGCCAGG + Intergenic
1123652628 15:22489303-22489325 GGGTCTCTGTGAAGGGAGCTTGG + Intergenic
1123743052 15:23298162-23298184 GGGTCTCTGTGAAGGGAGCTTGG + Intergenic
1123977943 15:25570489-25570511 TGGCCAGTGTGATGGAAGCGGGG - Intergenic
1124098457 15:26670558-26670580 GGGCTCCTGTGACGGCCGCGCGG - Intronic
1124276210 15:28327713-28327735 GGGTCTCTGTGAAGGGAGCTTGG - Intergenic
1124306488 15:28583894-28583916 GGGTCTCTGTGAAGGGAGCTTGG + Intergenic
1124925465 15:34066218-34066240 GGGCCTCCGTGATGCCAACTGGG + Exonic
1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG + Intronic
1127454280 15:59143320-59143342 GGGACTGTCTGATGGCAGCCGGG + Intronic
1127817642 15:62625762-62625784 GGGCTTCTGTGTTGCCAGCCTGG + Intronic
1127834162 15:62776775-62776797 CGGCCTCTGTGATGGCGTCATGG - Exonic
1128342918 15:66835184-66835206 GGGCCTGTTTGATGGCAGGCGGG - Intergenic
1128876326 15:71204399-71204421 GAGCCTCTTTGCTGGCAGTGGGG + Intronic
1202954969 15_KI270727v1_random:70756-70778 GGGCCTCAGTGGTGGCTGCCAGG + Intergenic
1132730050 16:1356687-1356709 AGGACTGTGTGAGGGCAGCGGGG - Intronic
1132900468 16:2251424-2251446 GGGCCCCTGCGAAGGCAGCGTGG + Exonic
1135423676 16:22321840-22321862 GGGCCCCTGACATGGCAGCATGG - Intronic
1138117266 16:54370471-54370493 CCGCATCTGTGATGGCAGAGCGG + Intergenic
1138298915 16:55910257-55910279 TGGCTTCTTTGATGGCAGAGTGG - Intronic
1138388020 16:56649353-56649375 AGGCCTCTGTCAGGGCAGAGAGG + Intronic
1141712012 16:85705183-85705205 GGGCCTCTGGGGAGGCAGTGTGG - Intronic
1142564402 17:830408-830430 GGGAAGCTGGGATGGCAGCGTGG + Intronic
1143106599 17:4533425-4533447 GAGCCTATGTGAGTGCAGCGGGG + Exonic
1143513694 17:7408810-7408832 GGGCCTTTGTGGGGGCAGTGAGG + Intronic
1147632735 17:41942627-41942649 GGGCCTCAGGGAAGGCAGCAGGG + Intronic
1150651820 17:67015396-67015418 GGGGCTGTGCGAGGGCAGCGTGG + Intronic
1151698734 17:75731371-75731393 ACGCCTCTGTGGGGGCAGCGGGG + Intronic
1151853498 17:76705971-76705993 GGGCCTTTGTGATGGCAGTGTGG - Intronic
1151853502 17:76705992-76706014 GGTCCTCTGTGATGGCAGTGTGG - Intronic
1151853505 17:76706013-76706035 GGGCCTTCGTGATGGCAGTGTGG - Intronic
1151853509 17:76706034-76706056 GGTCCTTTGTGATAGCAGAGTGG - Intronic
1151853511 17:76706055-76706077 GGTCCTCTGTGATGGCAGTGTGG - Intronic
1151853514 17:76706076-76706098 GGGCCTTTGTGATGGCAGTGTGG - Intronic
1151853518 17:76706097-76706119 GGGCCTTTGTGATGGCAGCGTGG - Intronic
1151853522 17:76706118-76706140 GGTCCTTTGTGATGGCAGCGTGG - Intronic
1151853525 17:76706139-76706161 GGGCCTCTGTGACGGCAGTGTGG - Intronic
1151853529 17:76706160-76706182 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853533 17:76706181-76706203 GGGCCTCTGTGATGGCAGCGTGG - Intronic
1151853537 17:76706202-76706224 GGGCCTTTGTGATGGCAGCGTGG - Intronic
1151853541 17:76706223-76706245 GGGCCTCTGTGACGGCAGAGTGG - Intronic
1151853545 17:76706244-76706266 GGGCCTCTGTGATGGCAGAGTGG - Intronic
1151853549 17:76706265-76706287 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853553 17:76706286-76706308 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853557 17:76706307-76706329 GGTCCTTTGTGATGGCAGCGTGG - Intronic
1151853560 17:76706328-76706350 GGGCCTCTGTGATGGCAGCGTGG - Intronic
1151853564 17:76706349-76706371 GGGCCTCTGTGATGGCAGAGTGG - Intronic
1151853568 17:76706370-76706392 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853572 17:76706391-76706413 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853576 17:76706412-76706434 GGTCCTTTGTGATGGCAGTGTGG - Intronic
1151853579 17:76706433-76706455 GGTCCTTTTTGATGGCAGTGTGG - Intronic
1151853582 17:76706454-76706476 GGTCCTTTTTGATGGCAGTGTGG - Intronic
1151853585 17:76706475-76706497 GGTCCTTTTTGATGGCAGTGTGG - Intronic
1151853588 17:76706496-76706518 CTGCCTTTGTGATGGCAGTGTGG - Intronic
1151916248 17:77120348-77120370 GTCCCTCTGTGATGGCACTGTGG - Intronic
1152422964 17:80203934-80203956 GGGGCTCGGTGCTGGCAGGGTGG + Intronic
1152473236 17:80501849-80501871 GGGCCTGGGGGAGGGCAGCGGGG - Intergenic
1152590826 17:81211179-81211201 GGGCCTCTGTGGCCCCAGCGTGG - Intronic
1154214845 18:12408250-12408272 GGGCCTCTGTGCCTGCAGCCAGG - Intronic
1154447739 18:14449208-14449230 GGGCCTCAGTGGTGGCTGCCAGG + Intergenic
1157725057 18:49957902-49957924 GGGCTTCTGTGATGGCAAAGAGG - Intronic
1161129585 19:2580049-2580071 GGTCCTCTGGGATGGCACTGGGG - Intronic
1161811375 19:6473111-6473133 GGGCCTCATGGATGGCAGGGAGG + Intronic
1163303499 19:16462704-16462726 GGGACTCTGAGAAGGCAGAGAGG + Intronic
1163667915 19:18611765-18611787 GGGCCGCTGAGATGAAAGCGCGG + Intronic
1163831812 19:19550612-19550634 GGGCCTCTGAGGTGGGGGCGGGG + Intergenic
1165816904 19:38647991-38648013 GAGCGTCTGTGATGGGAACGGGG + Intronic
1166010294 19:39936265-39936287 GGGCCTCTGGGAGGCCAGAGCGG + Intergenic
1166083316 19:40458490-40458512 GGGCCCCTCTGATGGCAGCCTGG + Exonic
1166291774 19:41868229-41868251 CTGCCACTGTGATGGCACCGGGG - Intronic
1166358090 19:42239275-42239297 GGGCCTCGGTCTTGGCAGGGAGG - Intronic
1167266997 19:48488199-48488221 GGGCCTCTGTGAGGACAGGGTGG - Intronic
1167414252 19:49361991-49362013 GGGCCTCTGGGGTGGCCGAGGGG - Intronic
1167488886 19:49780566-49780588 TGGGCTCTGTGATGCCAGCTGGG - Intronic
1168288652 19:55346697-55346719 GGGCTGCTGGGATGGCAGGGAGG - Intronic
925444909 2:3919319-3919341 GGGCCTGGGTGATGGCACGGTGG + Intergenic
926166857 2:10526464-10526486 GGGCTTGTCAGATGGCAGCGTGG - Intergenic
928098047 2:28417501-28417523 GGGCTTCTGGGAGGGCATCGGGG + Intergenic
930096498 2:47570448-47570470 GGGGCTCTGCGAAGGCGGCGAGG - Exonic
934978648 2:98823000-98823022 GCGCCTCTGAGGTGGCGGCGGGG + Exonic
935128959 2:100247241-100247263 GGGCCTCAGTGGTGGCTGTGGGG + Intergenic
936020127 2:108988454-108988476 TGGCCTCTGTGTTGGTGGCGGGG - Intronic
943190863 2:184679304-184679326 GGGTCATTGCGATGGCAGCGGGG + Intronic
946054581 2:216889571-216889593 CAGGCTCTGTGATGTCAGCGTGG - Intergenic
947180551 2:227407623-227407645 GGGTATGTGTGTTGGCAGCGGGG - Intergenic
948321855 2:237076221-237076243 GGGCCCCAGTGATGGTAGAGTGG - Intergenic
948386391 2:237583680-237583702 GGGTCTCTGTGATGGGGCCGGGG - Intronic
948643466 2:239389576-239389598 GGGCCTCTAGGAGGGCAGGGTGG - Intronic
948675647 2:239595042-239595064 GGGCCTCTGCGATGGCCTCCTGG - Intergenic
1168928048 20:1598976-1598998 GGGCCTCTGGGATGGCATCCTGG - Intronic
1172665040 20:36593335-36593357 GAGCCTCTGTGATGGCTTCAGGG - Exonic
1173556732 20:43971520-43971542 CGGCCTCCGTGAGGGCAGCTGGG + Intronic
1173570164 20:44070841-44070863 GGCACTCTGTTATGGCAGCTGGG - Intergenic
1174160446 20:48546654-48546676 GGTGCTCTGTGATGGAAGAGGGG + Intergenic
1174252583 20:49230728-49230750 GGGCCTCTGTGACTGCAGTGGGG + Intronic
1175249045 20:57597938-57597960 GGACCCCTGTGATGACATCGAGG - Intergenic
1175888245 20:62304225-62304247 GGGCCTTTCAGATGGCAACGGGG - Intronic
1176266590 20:64212437-64212459 GGGCCTTTGTGAGGGCAGAGTGG + Intronic
1176304196 21:5114793-5114815 AGGCCTCTGGGATGGCAGGACGG + Intergenic
1178011320 21:28290095-28290117 GAGCCTCTGTTAGGGCAGTGTGG - Intergenic
1178178563 21:30132845-30132867 GAGCCTCTGTTAGGGCAGTGTGG - Intergenic
1178534867 21:33403267-33403289 GGGCCTCTGCGGCTGCAGCGCGG - Exonic
1178582368 21:33847594-33847616 GGGGGTCAGTGGTGGCAGCGTGG + Intronic
1179717981 21:43299784-43299806 ACGCCACTGTGATGGCAGCTGGG + Intergenic
1179852860 21:44147237-44147259 AGGCCTCTGGGATGGCAGGACGG - Intergenic
1180142189 21:45899397-45899419 GGGCCTCTGTATGGGCAGCCTGG + Intronic
1180167046 21:46035755-46035777 GGGCCTCAGGGATGGAAGCCGGG - Intergenic
1182012915 22:27015427-27015449 GGGCCTCTGTGAGAGCACCTGGG - Intergenic
1183227872 22:36562815-36562837 GGGTCTCTGTGATGGAAAGGTGG - Intergenic
1185082639 22:48718337-48718359 GAGCCTCTGTGGGGGCAGCGGGG + Intronic
950590573 3:13933415-13933437 GGGCCCCTGAGAAGGGAGCGAGG - Intergenic
954201313 3:49025002-49025024 GGGCCTCAGTGGTGGCAGCCAGG + Exonic
956583467 3:70839480-70839502 GGCCCTCTGTGAAGGAAGTGAGG - Intergenic
960710778 3:120525885-120525907 GGGTCTCTGTGAGGGCAGGTGGG - Intergenic
961597258 3:128028317-128028339 GGGCCTTGGTGAGGGCAGCACGG - Intergenic
965535528 3:169820118-169820140 GGGCCTCTGTGATGGATGAGAGG + Intergenic
966426890 3:179789549-179789571 GGTCCACTGTGATGGCTGCCTGG - Intergenic
967185679 3:186942554-186942576 GGTCCTCTGTGCTGGAATCGAGG + Intronic
968434779 4:578842-578864 AAGCCTCTGTGAGGGCAGTGGGG - Intergenic
968460779 4:723757-723779 GGGCCTCTGTGAGGCCAGGAGGG + Intronic
968599730 4:1503276-1503298 GGGCCTCTGCTAGGGCAGGGAGG + Intergenic
968725883 4:2247638-2247660 GGTCCTCTGTGCAGGCAGTGGGG + Exonic
968870419 4:3239231-3239253 GGGCCTGGGTGAGGGGAGCGAGG + Intronic
969627037 4:8310973-8310995 AGGGCTCAGTGATGGCTGCGTGG - Intergenic
969627042 4:8311000-8311022 AGGGCTCAGTGATGGCTGCGTGG - Intergenic
969627047 4:8311027-8311049 GGGGCTCAGTGATGGCTGCGTGG - Intergenic
969715429 4:8866005-8866027 GGCCCTGTGTCATGACAGCGTGG - Intronic
970012398 4:11473520-11473542 GGGCCTCAGTGAAAGCAGAGAGG - Intergenic
970510420 4:16776506-16776528 GGGCCTCTTTGATGGAATGGGGG + Intronic
971631493 4:28998730-28998752 GGACCTCTGTTAAGGCAGTGTGG + Intergenic
978766733 4:112412188-112412210 GGGCCTTTGTGCTGGCAAAGAGG - Intronic
981435701 4:144719172-144719194 GGTGCTCTGTGATGACAGCAAGG - Intronic
982523733 4:156452215-156452237 GGGCCACTGAGGTGGCAGCCAGG - Intergenic
985164027 4:187073967-187073989 TGGCCTCTGTGCAGGCTGCGGGG + Intergenic
985589079 5:755507-755529 AGGCCTCTGTGATGGCCTAGGGG - Intronic
985603758 5:848023-848045 AGGCCTCTGTGATGGCCTAGGGG - Intronic
985800313 5:2001536-2001558 GGCACTCTGTCATGGCAGCCAGG - Intergenic
986394450 5:7314594-7314616 GGGCCTCTGGGTTGGCAGATAGG - Intergenic
986960322 5:13202848-13202870 GGACCTCTGCTAGGGCAGCGTGG - Intergenic
988721231 5:33881177-33881199 GTGCCACTGAGATGGCAGAGGGG + Exonic
992403894 5:76437527-76437549 GGGCCTGTGGGAGGGGAGCGGGG - Intronic
992555790 5:77901769-77901791 GGGCATCTGATATGGCAGAGAGG + Intergenic
997997223 5:138596504-138596526 AGGCATCTGTGAAGGGAGCGGGG + Intergenic
1001446610 5:171790149-171790171 GGCCCTTTGTGATGGAAGCAGGG + Intronic
1001939476 5:175730246-175730268 GGGCTTCTATGATGCCTGCGAGG + Intergenic
1002064019 5:176643312-176643334 CAGCCTCTGTGCTGGCAGCGTGG + Intronic
1002484111 5:179523131-179523153 GTGCCTCTGAGCTGGCAGGGAGG - Intergenic
1002500454 5:179644350-179644372 GTGCCTCTGAGCTGGCAGGGAGG + Intronic
1003305328 6:4922010-4922032 CTGCCTCTGTGGTGGCAGCTGGG + Intronic
1003400250 6:5784931-5784953 GGGGTTCTGTGATGCCAGCCAGG + Intergenic
1003528832 6:6920732-6920754 AGGCCCCTGTGATGGGAGAGAGG + Intergenic
1003797762 6:9624183-9624205 GGGTCTTTTTGATGTCAGCGAGG - Intronic
1006400245 6:33813435-33813457 GGACCTCAGGGATGGCAGCTTGG - Intergenic
1006713849 6:36100868-36100890 GGCCCTCTGTGATGCCAACCTGG - Intronic
1009605091 6:65857290-65857312 GGGCCTCTGCCAGGGCAGTGTGG - Intergenic
1010611886 6:77963184-77963206 GGGCCTCTGCTAGGGCAGTGTGG + Intergenic
1011635829 6:89372204-89372226 GTGCATCTGCGATTGCAGCGAGG - Intronic
1014017238 6:116547279-116547301 GGGCCTGTGTGCTTGCTGCGAGG + Intronic
1018177329 6:161188736-161188758 GTGCCTCTGGGAGGGCAGCTTGG + Intronic
1018204948 6:161428480-161428502 GGGCATCTGCGATGCCAGCCAGG - Intronic
1019712102 7:2522467-2522489 TGGCCGCTGTGGTGGCAGCGCGG - Intronic
1022036536 7:26539873-26539895 GGGCCACTGTGGAGGCAGCAGGG + Intergenic
1022280327 7:28901673-28901695 GGGCTTCTGTGATGACAGATTGG - Intergenic
1025022614 7:55491572-55491594 GGAGCTCTCTGATGACAGCGGGG - Intronic
1025115553 7:56255047-56255069 AGGCCTCTGTAATGGCAGGGAGG + Intergenic
1026199944 7:68205936-68205958 AGGCCTCCGTAATGGCAGGGAGG + Intergenic
1026765493 7:73157061-73157083 GGGCCTGGGTGCTGGAAGCGGGG + Intergenic
1027041967 7:74966755-74966777 GGGCCTGGGTGCTGGAAGCGGGG + Intronic
1027081675 7:75235600-75235622 GGGCCTGGGTGCTGGAAGCGGGG - Intergenic
1029115679 7:98235918-98235940 GGGCCTCTGGGCTGACAGCACGG + Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1030126995 7:106163196-106163218 TGGCAGCTGTGATGGCAGCAGGG - Intergenic
1030976140 7:116125966-116125988 GGGCCTCTGTGGTATCAGGGTGG - Intronic
1034407548 7:150915230-150915252 CGACCTCTGTCATGGCAGGGAGG + Intergenic
1036890414 8:12592848-12592870 GGGGATCTGTGCTGGCAGCCAGG + Intergenic
1039926747 8:41940913-41940935 GGGCTTCAGTGAGAGCAGCGAGG - Exonic
1040071652 8:43193498-43193520 CAGCCACTGTGATTGCAGCGGGG - Intronic
1040289470 8:46116941-46116963 GGGCTTCTGGGATGGTAGAGTGG + Intergenic
1040300489 8:46185440-46185462 GGGCTTCTGTGATGAAAGAGGGG + Intergenic
1041872089 8:62646939-62646961 GGGCCTTTGTGCTGGGAGCTGGG - Intronic
1042258912 8:66836478-66836500 GGGGCTCTGTGGTGGTAGCTTGG + Intronic
1042930491 8:74008553-74008575 GGGCCTACATGAAGGCAGCGCGG + Intronic
1043310569 8:78854281-78854303 GGGCATCTATGATTGCAGCTGGG - Intergenic
1043609184 8:82041315-82041337 GGGCCTCTGAGGTGGAAGTGTGG + Intergenic
1045247997 8:100460097-100460119 AGGTCTCAGGGATGGCAGCGTGG + Intergenic
1048799390 8:138182084-138182106 GTGCCACTGTGGTGGCAGCGTGG - Intronic
1049210488 8:141384310-141384332 GGGGCTCTGTCATTGCAGAGGGG + Intergenic
1049446725 8:142634698-142634720 TGACCTGTGGGATGGCAGCGGGG - Intergenic
1049582934 8:143420987-143421009 GGGCCACTGTGGGGGCAGCAGGG - Intronic
1049684342 8:143933390-143933412 GGGCCCCTGTGAGGTCAGAGGGG - Intronic
1050075399 9:1857662-1857684 GGGCATCTGTGGTGGCAAAGTGG - Intergenic
1050384351 9:5070682-5070704 GGCCCTCTGTACTGGCAGGGCGG - Intronic
1055623317 9:78148100-78148122 GGGCCTCTTACATGGCAGCTCGG + Intergenic
1057176280 9:93002763-93002785 GGGCCACTGTGATGGCGATGTGG - Intronic
1057895071 9:98902729-98902751 GGCACTCTGTGATAGCAGCCTGG + Intergenic
1058051560 9:100411682-100411704 GGGCCTCTGTGTAAGCTGCGGGG - Intergenic
1058643459 9:107108983-107109005 GGGCATCTGAGATGGCAGCAGGG - Intergenic
1060197998 9:121635627-121635649 GGGGCGCTGAGATGGGAGCGAGG + Intronic
1060224984 9:121785043-121785065 AGGCCTCTGTGCTAGCAGGGAGG - Exonic
1061367017 9:130177390-130177412 GGGGTTGTGTGATGGCTGCGTGG + Intronic
1061371276 9:130198886-130198908 TGGCAGCTGTGATGGCAGCTGGG - Intronic
1061618000 9:131792754-131792776 GGGCCTCTGTGCTTGGAGCCTGG - Intergenic
1062049565 9:134440248-134440270 GGGCTCCTGTGACGGCGGCGAGG + Intronic
1062576856 9:137212826-137212848 AGGCCTGTGTGACGTCAGCGTGG - Intronic
1187548766 X:20280458-20280480 GGGCATCTGGGATGGCAGAAGGG + Intergenic
1190321664 X:49183576-49183598 GCCCCTCTGTGATGGAAGAGTGG - Intronic
1198522063 X:137463050-137463072 GGGACTCTGTGCTGGCAGACGGG - Intergenic
1199696983 X:150349548-150349570 GGGCATCTCTGATGCCAGCATGG - Intergenic
1200157138 X:153982895-153982917 TGGACTCTGAGATGGCAGCGTGG + Exonic