ID: 1151854452

View in Genome Browser
Species Human (GRCh38)
Location 17:76710957-76710979
Sequence CCCAGCTGGCCCGCACTCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151854452_1151854464 16 Left 1151854452 17:76710957-76710979 CCGCCGAGTGCGGGCCAGCTGGG 0: 1
1: 0
2: 1
3: 4
4: 111
Right 1151854464 17:76710996-76711018 CCGCGCCCCGTCGCCGCGCCCGG 0: 1
1: 0
2: 5
3: 33
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151854452 Original CRISPR CCCAGCTGGCCCGCACTCGG CGG (reversed) Intronic
900637855 1:3674666-3674688 CCCTCCTGGCCCTCACTCCGGGG + Intronic
902798370 1:18814435-18814457 GCCAGCTGGCCCTCCCTAGGAGG - Intergenic
903332143 1:22601701-22601723 CCCAGCTGACCAGCACCCAGGGG + Exonic
912936507 1:114007811-114007833 CCCATCTGGCCTGCACGCCGTGG + Intergenic
916606061 1:166343320-166343342 CTCAGCGGCCCCGCACTCGGAGG - Intergenic
918073722 1:181153163-181153185 CCCAGCTGGCAGGCGCTCTGAGG + Intergenic
918384925 1:183996167-183996189 CACAGCTGGCCCGCATGCTGGGG + Intronic
920215576 1:204359757-204359779 CCCAGCTGGCCTGAGCTGGGGGG - Exonic
921781729 1:219173758-219173780 CGCTGCTGGCCCGCTCTCTGAGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1068096684 10:52499779-52499801 GCCTTCTGGCCAGCACTCGGGGG - Intergenic
1070574402 10:77666658-77666680 TCCAGGTGGCCCACACTGGGGGG + Intergenic
1070999132 10:80814263-80814285 CTCAGTGGGCCCGCACTCAGCGG + Intergenic
1073057840 10:100713617-100713639 CCAGGCTGGCCCGCACCCGTCGG - Intergenic
1074772452 10:116742662-116742684 CCCGGCCGGCCCGAGCTCGGAGG - Intergenic
1075660042 10:124187109-124187131 CACAGCTGGCCCTGACTCGCCGG + Intergenic
1077350250 11:2089963-2089985 CCCAGCTGGCCAGGCCTAGGGGG - Intergenic
1077630564 11:3808590-3808612 CCCAGGTGGCCCGGGGTCGGGGG - Exonic
1081503930 11:43695253-43695275 CCCATCTGGGCCGGACACGGTGG - Intronic
1081710581 11:45213044-45213066 CCCAGCTAGTCTGCACTAGGAGG + Intronic
1083271052 11:61572807-61572829 CCCATCTGACCCCCACTCAGGGG + Intronic
1086724631 11:90167261-90167283 CTCAGCGGGCCCGCCCTCGGAGG + Intronic
1091460917 12:642981-643003 CCCAGCTGGCCCGGCCGCCGCGG + Intronic
1097249899 12:57626732-57626754 CCCAGCGGGCCATCACTGGGAGG + Exonic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1098595829 12:72272583-72272605 CCCGGGTGGCCCGCCCGCGGGGG + Intronic
1103701192 12:122849512-122849534 CCCAGCTGGCCCGGCCGCAGGGG + Intronic
1105017172 12:132793086-132793108 CCCACGGGACCCGCACTCGGAGG + Intronic
1108446333 13:50512484-50512506 CCAAGCTGGCCCGCAGCAGGAGG - Intronic
1110876566 13:80517560-80517582 GTCAGCTGGCCCCCACTGGGAGG - Intergenic
1113395400 13:109942813-109942835 TACAGCTGGCCAGCACTCAGGGG + Intergenic
1114486708 14:23067093-23067115 CCTAGCTGGGCCGCTCTCGATGG + Intronic
1115027359 14:28760342-28760364 CCCACCTGGCCCTCACTCTCCGG - Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1122795120 14:104202168-104202190 CACAGCTGGCCCTCACCCAGCGG + Intergenic
1129457952 15:75685628-75685650 ACCAGGTAGCCGGCACTCGGTGG + Exonic
1130273854 15:82466439-82466461 ACCAGGTAGCCGGCACTCGGTGG - Intergenic
1130466202 15:84193813-84193835 ACCAGGTAGCCGGCACTCGGTGG - Intergenic
1130498061 15:84479723-84479745 ACCAGGTAGCCGGCACTCGGTGG + Intergenic
1130588496 15:85198406-85198428 ACCAGGTAGCCGGCACTCGGTGG - Intergenic
1132006672 15:98233592-98233614 CCCAGCTGGGCCGGGCACGGTGG - Intergenic
1132271964 15:100534106-100534128 CCCATCTGGCCAGCCCTCAGAGG - Intronic
1133285518 16:4688843-4688865 CCCACCTGGCCTCCACTTGGTGG + Exonic
1140188202 16:72793153-72793175 CCCATCTGCCCAGCACTCAGAGG + Intronic
1141620537 16:85234831-85234853 CCCAGCTGGGCCGTATTCGCTGG - Intergenic
1142151071 16:88512794-88512816 CCCACCTGGCCAGGCCTCGGGGG - Intronic
1146077422 17:29744177-29744199 CGCAGCTGGCCCGCTGCCGGGGG + Intronic
1148632061 17:49118690-49118712 CGCAGCTGGCCAGCAGTCTGTGG - Intergenic
1151310286 17:73288596-73288618 CCCTGCTGGACCAGACTCGGTGG - Intronic
1151854452 17:76710957-76710979 CCCAGCTGGCCCGCACTCGGCGG - Intronic
1152718029 17:81909174-81909196 CCCAGTTGGCCAGCACTAGTGGG - Intronic
1155982519 18:32196092-32196114 CCCCGCTGGCTCGGGCTCGGTGG + Intronic
1163713544 19:18861104-18861126 ACCAGCTGGCCCACCCTCTGGGG + Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929857560 2:45650085-45650107 CCCAGCTGGGCCGCGCCCCGGGG + Intergenic
932499784 2:72173615-72173637 CCCAGCCGGCCCCCACCCTGAGG + Intergenic
935112263 2:100104619-100104641 CCCGGCCGGCCCGGAGTCGGGGG - Intronic
935590529 2:104843178-104843200 CCCTGCAGGCCGGCACTTGGAGG - Intergenic
936122719 2:109760540-109760562 CCCGGCCGGCCCGGAGTCGGGGG + Intergenic
936221974 2:110610933-110610955 CCCGGCCGGCCCGGAGTCGGGGG - Intergenic
941104958 2:161341337-161341359 CGCAGCTGGCCGGCACTCGGCGG - Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
945134901 2:206616641-206616663 TCCAGCTGGCCCTCAGTCGGTGG + Intronic
946747597 2:222861309-222861331 CCCAGCCGAACCGCACGCGGAGG - Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1170808328 20:19653713-19653735 CCTAGCTGGCACGCAGTCTGAGG - Intronic
1172464582 20:35146754-35146776 CCCAGCTGACCCGCCCGCCGAGG + Intronic
1172771361 20:37384379-37384401 GCCAGCGGGCCCGCCCTCTGCGG - Exonic
1174446095 20:50592407-50592429 TCCAGCTGGACGGCACTCCGAGG - Exonic
1176178748 20:63740119-63740141 CCCCGCTGCCCCGCCCCCGGGGG - Intronic
1176985708 21:15433255-15433277 CCCAGCTGGCACAAACACGGGGG - Intergenic
1178624236 21:34202169-34202191 CCCAGCTGGTGGCCACTCGGCGG - Intergenic
1180174796 21:46082333-46082355 CCCACCTGGCCTGGCCTCGGGGG - Intergenic
1182622076 22:31623816-31623838 CCCAGCTGGCCCTGAGGCGGAGG - Exonic
1183299379 22:37051572-37051594 CCCCGCAGGCCCGCAGTCTGGGG - Intergenic
1183455445 22:37920340-37920362 ACCAGCTGCCCCCCACTCAGGGG - Intronic
1184550168 22:45200172-45200194 CCCAGCCGGCCCGTGCTAGGTGG + Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
954635602 3:52069163-52069185 CCCTGCTGGGCTGCAATCGGTGG - Intergenic
956182311 3:66528878-66528900 CCAAGCTGGCTCGGACTCCGGGG - Intergenic
956642217 3:71425956-71425978 CCCAGCTGGCCTGCAGACTGTGG - Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
968517827 4:1022245-1022267 CCCGGCTGGGCCGCACTGTGCGG + Exonic
968949371 4:3682605-3682627 CCCAGCTGGCTCCCGCTCTGTGG + Intergenic
970615778 4:17767094-17767116 CTCGGCGGCCCCGCACTCGGAGG - Intronic
970904849 4:21203629-21203651 CCCTGCTGGCTCTCACTCTGTGG + Intronic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
984095483 4:175428024-175428046 CCCGGCAGGCCCGTACTCCGCGG + Intergenic
985705834 5:1400879-1400901 CCCTGCTGGGCCTCTCTCGGGGG - Intronic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
992484290 5:77180469-77180491 CTCACCTGGCACGCGCTCGGTGG - Intergenic
992700166 5:79334048-79334070 CCCTGCGGCCCAGCACTCGGAGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
996585983 5:125088776-125088798 CTCGGCGGGCCAGCACTCGGAGG + Intergenic
1002634884 5:180602321-180602343 CCCACCTGGCCCAGACTCCGAGG - Exonic
1002784748 6:392513-392535 CCCAGCTAGCGCGCACTAAGTGG - Intronic
1002926799 6:1609767-1609789 CCCTGCCGGCCCGCTCCCGGAGG - Intergenic
1004159441 6:13200658-13200680 GCCAGGTGGCCAGCACTGGGTGG + Intronic
1004720608 6:18264752-18264774 CACAGCCCGCCCGCACTCCGGGG - Exonic
1011552976 6:88546759-88546781 CCCAGCTGACCTGGAGTCGGAGG - Intergenic
1015024768 6:128520090-128520112 CCCACCTGGCACGAACTCTGGGG + Intronic
1018734177 6:166675140-166675162 CCCAGCTTGCCAGCAAGCGGAGG + Intronic
1019701335 7:2476204-2476226 CCCAGCAGGCCAGCTCTGGGGGG + Intronic
1019817321 7:3210782-3210804 CCCAGATGGCCCACACTCAGTGG - Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1034835920 7:154351555-154351577 CCCTGCCTGCCCACACTCGGTGG + Intronic
1035418608 7:158709197-158709219 CACAGCTGCCCTGCACTGGGGGG - Intergenic
1039885676 8:41652903-41652925 CCCAGCTGGCATGCACTGAGGGG - Intergenic
1049573814 8:143381524-143381546 CCCAGCTGGGCCACACACTGAGG - Intronic
1053290764 9:36878429-36878451 CCCAGATGGCCCCCCCTCTGGGG - Intronic
1061017003 9:127987111-127987133 CCCAGCTGGCCCACTCTCTCAGG + Intergenic
1061190649 9:129080910-129080932 CCCAGCTGGCGCCCAATCTGGGG - Intergenic
1062259692 9:135655403-135655425 TCCAGCTGGCCGGGACTCAGCGG + Intergenic
1062585699 9:137248656-137248678 CCCAGCTGGCCTGAACTCCTAGG - Intergenic
1195093466 X:101485477-101485499 CCCCGCTGCCCTGCGCTCGGCGG + Intronic
1195252757 X:103064128-103064150 CCCCGCTGCCCTGCGCTCGGCGG - Exonic