ID: 1151855469

View in Genome Browser
Species Human (GRCh38)
Location 17:76718445-76718467
Sequence ATTGAATCCATTTTCTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 351}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151855469_1151855470 -2 Left 1151855469 17:76718445-76718467 CCAAGATAGAAAATGGATTCAAT 0: 1
1: 0
2: 0
3: 19
4: 351
Right 1151855470 17:76718466-76718488 ATTTTTATTAAATAATGTAAAGG 0: 1
1: 1
2: 13
3: 143
4: 1378
1151855469_1151855471 8 Left 1151855469 17:76718445-76718467 CCAAGATAGAAAATGGATTCAAT 0: 1
1: 0
2: 0
3: 19
4: 351
Right 1151855471 17:76718476-76718498 AATAATGTAAAGGATTTTCTTGG 0: 1
1: 0
2: 3
3: 46
4: 506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151855469 Original CRISPR ATTGAATCCATTTTCTATCT TGG (reversed) Intronic
901749976 1:11400148-11400170 ATGGAATCCAATTTCTCTCCAGG + Intergenic
902168830 1:14594558-14594580 AGTGGACCCATTTTCTGTCTTGG + Intergenic
903953787 1:27011542-27011564 ATTGTACCCATTTTATAGCTGGG - Intronic
904609259 1:31715965-31715987 AATGACTCCCCTTTCTATCTGGG - Intergenic
905327414 1:37165485-37165507 CTTTAATCCATTTTTTATTTAGG + Intergenic
906265097 1:44422727-44422749 ATTGAATCCATCTTTGATCGTGG + Intronic
906635413 1:47406463-47406485 ATTGGAGCCATCTTCTAGCTGGG + Intergenic
906935239 1:50208867-50208889 ATTGGATTCATTTCCCATCTTGG - Intergenic
908432099 1:64069405-64069427 TTTGAATCAATTTTCTGTTTAGG + Intronic
908685274 1:66711393-66711415 ATTGAATTAATTTTGAATCTGGG - Intronic
909037954 1:70616044-70616066 ATTTAAGCCATTATCAATCTAGG + Intergenic
909494392 1:76262219-76262241 ATTGTCTCCATATTCTATTTGGG + Intronic
909824787 1:80114324-80114346 ATTGAATTCATTTGGAATCTAGG + Intergenic
911026722 1:93444183-93444205 ATTGAATGCATTTTCTTTTCAGG - Intergenic
911246895 1:95528143-95528165 TTTGAATACCTTTTCTATATAGG - Intergenic
911404622 1:97421145-97421167 ATTGCATCCATTTTATAGCTAGG - Intronic
911800370 1:102130117-102130139 TTTGAAGCCATTTTCTTTCATGG + Intergenic
912949967 1:114113818-114113840 GTACAATCCATTTTCCATCTGGG - Intronic
913380342 1:118203456-118203478 ATAGAATTCATTTGCTTTCTAGG + Intergenic
916741121 1:167648210-167648232 ATTTAATCATTTTTCTATTTTGG + Intronic
916949582 1:169765877-169765899 AATCTATCCATTTTCTCTCTTGG - Intronic
917880968 1:179335508-179335530 ATTGAAGCCATTTTTTATGAAGG + Exonic
919077121 1:192826961-192826983 TCTGAATCCATTTTATTTCTAGG - Intergenic
919431787 1:197503015-197503037 AATTTATCCTTTTTCTATCTTGG + Intergenic
919798133 1:201333605-201333627 ATTGAATGCCTATTCTACCTGGG + Intergenic
921531545 1:216288383-216288405 TTTGAATCCATATTTTGTCTTGG + Intronic
922285737 1:224169014-224169036 ATCGAGTCCATCTTCTATTTGGG + Intergenic
922556504 1:226536677-226536699 ATTAATTCCATTCACTATCTGGG - Intergenic
923967084 1:239154158-239154180 AATGAATGTATTTTGTATCTAGG + Intergenic
924137974 1:240990917-240990939 GTTGATTACATTTTCTTTCTAGG + Intronic
924497796 1:244607024-244607046 ATTGTATCCATCTTCTCCCTTGG + Intronic
1062888983 10:1042201-1042223 ATTGAAATCATTTTTTTTCTTGG - Intronic
1064342888 10:14502232-14502254 AATGAATCAATTTTCTGTCTTGG - Intergenic
1064427569 10:15243677-15243699 ATTGGATTTTTTTTCTATCTTGG - Intronic
1064890624 10:20167956-20167978 ATTGAAATCATTTACTATTTGGG - Intronic
1066620251 10:37341909-37341931 ATTTAATCCATTTACAATCAAGG + Intronic
1066622544 10:37373808-37373830 ATTTAATCCATTTACAATCAAGG + Intronic
1066630538 10:37455410-37455432 ATTGATTCCAGTTTCTGTCAAGG - Intergenic
1066972783 10:42329443-42329465 ATTGAATATTTTTTCTGTCTTGG - Intergenic
1067961719 10:50860723-50860745 ATTGTCTACATTTTCTATTTTGG + Intronic
1070943232 10:80365927-80365949 ATTATGTCCATTTTCTACCTTGG + Intronic
1071720877 10:88145151-88145173 CTAGAAGCCATTTTCTTTCTGGG + Intergenic
1071904787 10:90160973-90160995 TATGCATCCATTCTCTATCTTGG + Intergenic
1072557689 10:96535533-96535555 CTTGTATCTGTTTTCTATCTGGG + Intronic
1074321940 10:112411374-112411396 ATTGAATCTAGTTTCTTTCAAGG + Intronic
1074479927 10:113809980-113810002 AATTAACCCATTTTCCATCTGGG + Intergenic
1075230956 10:120677342-120677364 CTTGCATCCATATTCTTTCTAGG + Intergenic
1078733349 11:13996761-13996783 ATTGGAACCATTCTCTATATAGG + Intronic
1080009602 11:27444597-27444619 ATTGATTTCTTTTTCTATCTTGG + Intronic
1080174255 11:29343016-29343038 GTTGCATTCATTTTCTATCTAGG - Intergenic
1080853105 11:36088383-36088405 CTTGAATCAATTTTCTATCGTGG - Intronic
1082633717 11:55571019-55571041 ATTCAATTTATTTTCTATCATGG - Intergenic
1084290211 11:68159969-68159991 ATTGTAACCCTTTTCTATCCTGG - Intronic
1087567500 11:99880172-99880194 ATTGAAAACATTTTATATCATGG + Intronic
1087888955 11:103514696-103514718 ATTGAAAACATTTTCTGCCTTGG - Intergenic
1088136343 11:106560285-106560307 ATTGTTTTCTTTTTCTATCTTGG - Intergenic
1088217250 11:107524805-107524827 ATAAAATCCTTTTTATATCTTGG - Intronic
1088319670 11:108542598-108542620 GTTGAATCCATTGCCTACCTGGG - Intronic
1089487115 11:118855055-118855077 AGTTAATCCATTTTCATTCTAGG - Intergenic
1091151830 11:133336051-133336073 ATTGATTCCATTTCCTAACCTGG - Intronic
1092436852 12:8454985-8455007 CTTGAAGCCATTTGCTATGTAGG - Intergenic
1093275563 12:17120920-17120942 ATTGAATCCATAATTTACCTTGG - Intergenic
1093358124 12:18195037-18195059 ATTGATTTCATTTTCCATTTTGG - Intronic
1093429982 12:19073360-19073382 TTTTAATCCATTTTATACCTTGG - Intergenic
1093484371 12:19637574-19637596 ATTTAATTTATTTTCTTTCTGGG + Intronic
1094718698 12:33039062-33039084 AGTGAAACTATTTTCTATGTGGG - Intergenic
1095160818 12:38912952-38912974 ATTGTAACCCTTTTCTATATTGG - Intergenic
1095475485 12:42583218-42583240 ATTAAAACCTTTTTCTATGTTGG - Intronic
1095671371 12:44864225-44864247 ATTTAATCCATTTGCTTTCAGGG - Intronic
1097788280 12:63785371-63785393 ATTGAAAACATTCTGTATCTTGG + Intronic
1097926894 12:65138938-65138960 ATTGCATGCATTTTCCAGCTAGG + Intergenic
1098270382 12:68764188-68764210 ATTGTATCCCTTTTCTTTTTTGG + Intronic
1099384013 12:81992107-81992129 ATTAAAAACATTTTATATCTTGG - Intergenic
1099691214 12:85954323-85954345 TTTTATTCCATTTTCTTTCTTGG - Intergenic
1100784128 12:98061184-98061206 ATTGAAGGCATTCTCTACCTAGG - Intergenic
1102880338 12:116480273-116480295 TTTGAATCCTTCTTCTCTCTAGG + Intergenic
1105485763 13:20830019-20830041 ATGAATTCCATTTTATATCTGGG - Intronic
1106644739 13:31620232-31620254 AATTTATCAATTTTCTATCTAGG + Intergenic
1108905436 13:55465404-55465426 ATTGAATTCATATGCTAACTGGG + Intergenic
1109243405 13:59921474-59921496 ATTTTATCCATTTTTTTTCTAGG - Intronic
1110821948 13:79926673-79926695 GTAGAAACTATTTTCTATCTAGG + Intergenic
1111405975 13:87806713-87806735 ATTGATTACATTTTCTTTTTAGG + Intergenic
1111454914 13:88468152-88468174 ATTGAATCCATATTCTGATTTGG + Intergenic
1112941914 13:104873609-104873631 TTTAAATCCCTTTTCTAGCTAGG - Intergenic
1113125954 13:106979957-106979979 ATTGCCTCCATTTTCTAACTCGG + Intergenic
1113704407 13:112417127-112417149 AAAGGATCCATTTTGTATCTGGG - Intronic
1114012714 14:18388367-18388389 ATTGAATAATTTTTCTGTCTTGG - Intergenic
1115599946 14:34946362-34946384 AATGAACCCACTTTCTATATAGG + Intergenic
1116042804 14:39706280-39706302 ATTTAATCCATTTTATATATGGG - Intergenic
1116321416 14:43469601-43469623 ATTTAATCTATCTTCTATTTGGG + Intergenic
1116366279 14:44069006-44069028 ATTGAATGCATTTTCCCTCATGG + Intergenic
1119206503 14:72798448-72798470 ATTTTAACCATTTCCTATCTTGG - Intronic
1119497706 14:75094860-75094882 ATTGAATCTATTTTCCTTTTTGG - Intronic
1120095098 14:80379554-80379576 TTTAAATCCATTTTCTCTGTAGG - Intronic
1120770521 14:88374449-88374471 ATTGAATCCATAAACTATTTTGG - Intergenic
1120938504 14:89921971-89921993 ATTGATTCCTTTTTCTATAAAGG + Intronic
1121488716 14:94342560-94342582 ATAGAATCCATGTTCTTGCTGGG - Intergenic
1122311551 14:100799243-100799265 ATGAAATGCATTTTCTATGTCGG - Intergenic
1122760187 14:104018885-104018907 ATTAAGTCCATTTTCAATTTGGG + Intronic
1125083320 15:35700799-35700821 ATGGAATCCTTTTGGTATCTAGG + Intergenic
1126141136 15:45439770-45439792 CTTGAAGCCATTTGCTATGTGGG - Intronic
1127852936 15:62930171-62930193 ATTTAATCCATTTTTTCTATTGG + Intergenic
1127940397 15:63689468-63689490 ATTTATTCCATTTCCTCTCTTGG - Intronic
1129361792 15:75029035-75029057 CTTGGATCTATTTTCTATATTGG + Intronic
1133515302 16:6502841-6502863 ATTGAATCCAAATACTAACTGGG + Intronic
1134159216 16:11872570-11872592 ATTGAATACATTTTATTACTTGG - Exonic
1135106615 16:19655341-19655363 ATTGAATGCATTATTTATTTTGG - Intronic
1135340675 16:21644989-21645011 ATTGAATCCATTTTCACATTCGG + Intronic
1136066967 16:27765949-27765971 ATTGAATACATTTTCCTTCTGGG + Intronic
1138593526 16:58016646-58016668 CTTGAAACCCTTTTCTCTCTTGG - Intronic
1139081416 16:63525982-63526004 ATTGAATACATTTTCTTGGTAGG - Intergenic
1139236976 16:65350019-65350041 ATTAAATTCATTTTCTCCCTTGG - Intergenic
1143420229 17:6784441-6784463 TTTGACTTCATTTTCTATTTGGG - Intronic
1143929520 17:10407331-10407353 ATAAAATCCATTTTTTCTCTGGG + Intronic
1144885805 17:18460086-18460108 ATTGAATTCATTTTATAGGTGGG + Intergenic
1145146407 17:20484286-20484308 ATTGAATTCATTTTATAGGTGGG - Intergenic
1146729112 17:35179121-35179143 ATTGAATCCATAAACTATCTTGG + Intronic
1147529052 17:41256475-41256497 ATTGCCTCCATTTTCCAACTGGG + Intergenic
1149115106 17:53084465-53084487 GTTAAATCCATTTTTCATCTGGG - Intergenic
1151587548 17:75019442-75019464 ATTAAATCCACTTTCTGACTAGG - Intronic
1151855469 17:76718445-76718467 ATTGAATCCATTTTCTATCTTGG - Intronic
1152011412 17:77721005-77721027 ATTAAATCTATTTTCTATCCAGG - Intergenic
1153284675 18:3447379-3447401 ATTGAATCCGTTTTATAGCAAGG + Intronic
1154293618 18:13131375-13131397 ATTGCATCCATTTTCTCACAAGG - Intergenic
1155501931 18:26495096-26495118 ATTGAATGCATTTTTTTTTTTGG + Intronic
1155879988 18:31133752-31133774 ATTGTATCTATTTTATGTCTTGG - Intronic
1157102501 18:44743362-44743384 ATTGAATCCAATTTCCCCCTTGG - Intronic
1158761107 18:60388103-60388125 AATAAGTTCATTTTCTATCTTGG + Intergenic
1159779704 18:72646636-72646658 ATTGAGTCAATTCTCTCTCTTGG - Intergenic
1163247321 19:16104778-16104800 ATTGAAACCTTTTCCTAACTGGG - Intergenic
1163923859 19:20320087-20320109 AGTGAATCCCTTTTTTATATCGG + Intergenic
1165618687 19:37225648-37225670 AGTGAATCCCCTTTCTATCTTGG - Intronic
1166241013 19:41493840-41493862 GTTGAAACCATTCTCTTTCTGGG + Intergenic
1168012240 19:53542490-53542512 ATCTAATTCTTTTTCTATCTTGG - Intronic
925660730 2:6199365-6199387 ATTGAATACATTTTTAACCTAGG - Intergenic
926433227 2:12811355-12811377 ATTGAATCCATATTTTGTCTAGG - Intergenic
926607294 2:14910165-14910187 AATCAAGCCATTTTCTCTCTTGG - Intergenic
927390311 2:22587591-22587613 TTTGACTCCATTTTTTACCTGGG - Intergenic
927413136 2:22849314-22849336 ATTAAAGCCCATTTCTATCTTGG + Intergenic
928719046 2:34098027-34098049 ACTGTATCCACTTTCTCTCTGGG + Intergenic
929249905 2:39741812-39741834 ATCCCTTCCATTTTCTATCTAGG + Intronic
931043407 2:58323447-58323469 ATTGAACCGATTTTCTCCCTAGG - Intergenic
931423493 2:62149767-62149789 ACCAAAGCCATTTTCTATCTTGG - Intergenic
931553906 2:63478323-63478345 GTTAAATCCATTTTTTTTCTAGG - Intronic
934124676 2:88876311-88876333 GTTGAAGACAATTTCTATCTTGG + Intergenic
934902964 2:98175709-98175731 ATGGAATCCATTTTGCTTCTTGG - Intronic
935741807 2:106155382-106155404 CTGGAATCCATTTACTATTTGGG - Intronic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
936651067 2:114426379-114426401 ATTGTCTCCATTTTCTCTCATGG - Intergenic
937669924 2:124527613-124527635 ATTTAAACCATTTTTTCTCTGGG - Intronic
938524218 2:132110933-132110955 ATTGAATAATTTTTCTGTCTTGG + Intergenic
939267249 2:139890060-139890082 ATTGAGGTCATCTTCTATCTGGG - Intergenic
939347541 2:140986435-140986457 TGTGAATTGATTTTCTATCTTGG - Intronic
939863214 2:147443462-147443484 ATTGAATGCTTTTTGTAACTTGG - Intergenic
940635070 2:156289479-156289501 ATTGCACCCATTTTTTATTTGGG + Intergenic
941245099 2:163086340-163086362 CTTTAACCCATTTTCTATCAAGG + Intergenic
941464209 2:165806410-165806432 ATTCACTCTATTTTCAATCTTGG + Intergenic
941572065 2:167182960-167182982 ATTCACTCCCTTTTCTATTTTGG - Intronic
942955750 2:181771376-181771398 ATTGATTCTTTTTTCTTTCTGGG + Intergenic
943248355 2:185484833-185484855 CTTGAAACCATTTACTCTCTAGG - Intergenic
943251860 2:185532671-185532693 ATTTAAGCCAGATTCTATCTTGG - Intergenic
943612378 2:190048329-190048351 CTTGAAGCCATTTGCTATGTAGG + Intronic
944782918 2:203039102-203039124 ACTGAATCACTTTTCTACCTGGG - Intronic
945571612 2:211474603-211474625 ATTGAATACATTGTCTTTCCAGG - Intronic
945643335 2:212459039-212459061 CTTAAATCCCTTTTCTATTTTGG - Intronic
945926350 2:215809354-215809376 ATTGAATCCATTCTCCATTATGG - Intergenic
946683021 2:222237639-222237661 CTTAAATCCATTTAATATCTTGG - Intronic
946978423 2:225178800-225178822 ATAAAATGCATTTTCTATCAGGG - Intergenic
947184153 2:227439852-227439874 ATTGAAACCTTTTTCTGGCTGGG - Intergenic
947291532 2:228580967-228580989 ACTGAAACCAGTTTTTATCTTGG - Intergenic
947658775 2:231850948-231850970 ATTGAATGCCTTTTCTGTTTAGG + Intergenic
1169875453 20:10292421-10292443 ATAGAATCCATTTTCTTCTTTGG - Intronic
1170247858 20:14244140-14244162 ATTGTCTCCATTTTGTAGCTGGG + Intronic
1171235060 20:23517983-23518005 AAGGAATCCATTTCCTCTCTTGG - Intergenic
1173214946 20:41072480-41072502 ATTGACTCCATTTTATATGCTGG + Intronic
1173430098 20:42980148-42980170 AATGAATACATTTTCTGCCTTGG + Intronic
1173443637 20:43098642-43098664 ATTGCATCGATTTTTTATCCTGG - Intronic
1175508436 20:59504184-59504206 ATTGATTCTATTTTATAGCTTGG + Intergenic
1176772407 21:13089673-13089695 ATTGAATAATTTTTCTGTCTTGG - Intergenic
1176851651 21:13922496-13922518 ATTGAATCCATTTTTCCTTTGGG - Intergenic
1177465896 21:21479789-21479811 ATTCTATCCATTTTCTTTCCAGG - Intronic
1177480492 21:21680498-21680520 ATTTCTTCCCTTTTCTATCTTGG + Intergenic
1178379850 21:32098832-32098854 ATTGAGTCCCTTGTGTATCTGGG + Intergenic
1180437208 22:15319181-15319203 ATTGAATAATTTTTCTGTCTTGG - Intergenic
1181691677 22:24565990-24566012 GTTGTATCCAGTTTCTGTCTTGG + Intronic
1183584273 22:38743078-38743100 ATTTATTCCATTTTCTCTGTGGG - Intronic
1183887484 22:40896769-40896791 ATTGAGTACAATTTCTATTTGGG - Intronic
1184500345 22:44867841-44867863 GCTGAATCCATTTTCCTTCTAGG + Intergenic
1184892541 22:47388835-47388857 AATGAAACCATTCTCTAACTTGG - Intergenic
949293735 3:2496047-2496069 ATATAAACCATTTTCTACCTGGG + Intronic
951598274 3:24342181-24342203 TTTTAAACCATTTTCTATGTAGG - Intronic
952180463 3:30911360-30911382 ACAGAATCCCTTTTCTACCTGGG - Intergenic
952850879 3:37728382-37728404 ATTGAATCCATTTTAAACATGGG + Intronic
955170384 3:56557968-56557990 ATTGAAGCTCTTTTCTTTCTTGG + Intronic
956036712 3:65101082-65101104 ACTGAATTGGTTTTCTATCTAGG - Intergenic
956283981 3:67589478-67589500 ATGGAATCCAACTTGTATCTTGG + Intronic
956303754 3:67802039-67802061 ATTTAATCCATTTACTTTCAAGG + Intergenic
956971597 3:74532627-74532649 ATTGAATCCTTTCTTTATCCAGG - Intergenic
961343288 3:126244762-126244784 ATTAAATCCATGGTCTATCATGG + Intergenic
962743675 3:138381844-138381866 CTTGAATCCACATTCTTTCTGGG + Intronic
962778933 3:138692802-138692824 AGTTTATCCATTTTCTTTCTAGG - Intronic
964061855 3:152534788-152534810 AATGAATCCATATTATAACTAGG - Intergenic
964061880 3:152535273-152535295 AATGAATCCATATTATAACTAGG + Intergenic
964245944 3:154653701-154653723 ATTGAATGCATTTATAATCTAGG - Intergenic
965113395 3:164456341-164456363 ATAGAATACATTTTGTATTTGGG - Intergenic
965341532 3:167497714-167497736 TCTGAATCCATTTTCTGTCTTGG + Intronic
966457318 3:180132522-180132544 AATGAATCTATTGTCTATCTTGG + Intergenic
966929954 3:184669943-184669965 ATTGAATCCATTTTACAGGTAGG - Intronic
970200806 4:13602649-13602671 ATTTAAGTCATTTTCTTTCTTGG + Exonic
970315764 4:14827153-14827175 TTTGAATCCTTGTTCTATGTGGG - Intergenic
970490352 4:16566811-16566833 ACTTAATCCATTTTTTAACTGGG - Intronic
970496898 4:16635344-16635366 CTGGAATCCATTTACTATCTTGG - Intronic
970681227 4:18510668-18510690 GTTATATCTATTTTCTATCTTGG + Intergenic
970869748 4:20801843-20801865 ATTGAATCTATTTACATTCTAGG - Intronic
972032717 4:34481873-34481895 ATGGAATACATTTTGTATATAGG + Intergenic
972233378 4:37101028-37101050 ATTGATTCCATTTTCCAGATAGG + Intergenic
972649273 4:41000813-41000835 ATAGAGTCCATTCTCTAACTTGG + Intronic
974279236 4:59769881-59769903 AGTGAGTTCATTTTCTATTTTGG - Intergenic
974579995 4:63785332-63785354 AATGAATCCATATTCCATGTAGG + Intergenic
974774826 4:66465919-66465941 GTTGAATCTATTTTCAAACTAGG + Intergenic
974970455 4:68818956-68818978 ATTTAATCCATTGAATATCTTGG - Intronic
974985334 4:69017439-69017461 ATTTAATCCATTGAATATCTTGG + Intronic
974999965 4:69211771-69211793 ATTTAATCCATTGAATATCTTGG + Intronic
975005803 4:69283436-69283458 ATTTAATCCATTGAATATCTTGG - Intronic
975014212 4:69392393-69392415 ATTTAATCCATTGAATATCTTGG - Intronic
975015469 4:69411779-69411801 ATTTAATCCATTGAATATCTTGG - Intronic
975116136 4:70683245-70683267 ATTTAATCTAGTGTCTATCTTGG + Intronic
977148869 4:93482851-93482873 ATTGAACCCATTTGCAAGCTAGG - Intronic
977165572 4:93692075-93692097 TTTGAATACATGTTCTATGTAGG - Intronic
977956897 4:103038508-103038530 AATGACTCCATTTTCTTTATAGG - Intronic
978013513 4:103716753-103716775 ATTGAATATATTTTCCATTTAGG + Intronic
980742261 4:136967401-136967423 ATTGAATTCAATTTGAATCTAGG + Intergenic
981803173 4:148681654-148681676 ATTGAATACACTCTGTATCTAGG - Intergenic
981992257 4:150935609-150935631 AGTGATTCTAATTTCTATCTGGG + Intronic
982135432 4:152270466-152270488 AGTGAAGCCATCTACTATCTGGG - Intergenic
982952026 4:161710929-161710951 CTTGAATGCATTATCTATTTAGG - Intronic
982975645 4:162056266-162056288 ATTGATTCTAGTTTCTTTCTTGG - Intronic
983457302 4:167981329-167981351 ATTGAATCCATTTACATTCAAGG + Intergenic
983608925 4:169620711-169620733 ACTGAATCCATGCTCTAACTCGG - Exonic
983913869 4:173269647-173269669 ATTGAATCTATTTAATATCCTGG + Intronic
984004479 4:174292771-174292793 TTTTATTTCATTTTCTATCTGGG + Intronic
984307397 4:178011982-178012004 ATTAAATGTATTTTTTATCTGGG - Intergenic
984644410 4:182203954-182203976 CTCGAATCCATGTTATATCTTGG - Intronic
985839413 5:2294972-2294994 AGTAAATCCATTTTCAATCAGGG + Intergenic
986936209 5:12890757-12890779 ATTGAATCTATTTTACATATTGG + Intergenic
987174040 5:15288969-15288991 CTTGAATACATTTTCTCACTTGG + Intergenic
988303668 5:29466934-29466956 ATTGTATTTCTTTTCTATCTGGG + Intergenic
988502190 5:31792718-31792740 TTTGATTCCATTATTTATCTGGG + Intronic
988773578 5:34455103-34455125 ATTAAATCCAATTCCTGTCTGGG - Intergenic
989326474 5:40202087-40202109 ATTGACCCCATTGTCTATATAGG - Intergenic
991546482 5:67787581-67787603 ATTGAAAACATTACCTATCTAGG + Intergenic
992248763 5:74856710-74856732 ATTAAATAAATTTTCCATCTAGG + Intronic
992705130 5:79382893-79382915 ATGTAATCCATTTTCATTCTAGG - Intronic
993227452 5:85184968-85184990 AGTGAATGCATTTTGTATATGGG + Intergenic
993278479 5:85893617-85893639 ATCTTATCCATTTTCTGTCTTGG - Intergenic
993341800 5:86733327-86733349 ATTAAATGCATTTTCTTTATTGG + Intergenic
993840571 5:92873687-92873709 ATTGAATCCATTTACATTCAAGG + Intergenic
993947590 5:94134029-94134051 ATTGAATCTATAAACTATCTTGG + Intergenic
993981839 5:94551938-94551960 ATTGAATCCATTTTCATTCAAGG - Intronic
994650127 5:102516922-102516944 ATTGAATCCTCTTTTTCTCTTGG + Intergenic
994810712 5:104515542-104515564 TTTGAATCCTTTCTATATCTAGG - Intergenic
995175634 5:109173372-109173394 ATTGAGTCCATTTACTATATTGG - Intronic
995260612 5:110099970-110099992 ATTGACTTCATTTTCTCACTGGG - Intergenic
996114567 5:119603880-119603902 ATTGAATCTATAATCTACCTTGG - Intronic
996343651 5:122466576-122466598 ATTGAATCTAGTTTGTATCAAGG - Intergenic
997028563 5:130095527-130095549 ATTGATTCAATTTTTTATATTGG - Intronic
997651158 5:135522171-135522193 ATCAAATACATTTTTTATCTTGG + Intergenic
997961742 5:138327289-138327311 ATGGATTTCATTATCTATCTGGG + Intronic
998553317 5:143098769-143098791 ATTAAATTCATTTTCTATGAGGG - Intronic
998617858 5:143760678-143760700 ATTGAATGCATTTGATATGTTGG - Intergenic
999586690 5:153096914-153096936 AATGATTTCATTTTCTATTTTGG + Intergenic
999760839 5:154699809-154699831 TTTTAATCCATTTTCTATACTGG + Intergenic
1000635117 5:163635209-163635231 ATTGAAACAATTTTCTGACTAGG - Intergenic
1002635684 5:180607215-180607237 ATGGAGTTCACTTTCTATCTGGG + Intronic
1003470882 6:6430690-6430712 CTTGAATCAATTTTGTATTTTGG - Intergenic
1004069178 6:12281870-12281892 ATTTCTTTCATTTTCTATCTAGG + Intergenic
1005102208 6:22184083-22184105 ATTTAATCCATTTTCATTCAAGG + Intergenic
1007537021 6:42601214-42601236 TTTGATTCCACTTTCTATTTTGG + Intronic
1008080585 6:47190554-47190576 ATTGAATCCATAAATTATCTTGG - Intergenic
1010693963 6:78947183-78947205 TTTGAACCTGTTTTCTATCTAGG + Intronic
1010849254 6:80751227-80751249 ATTGAAACTATTTTCTCTTTTGG + Intergenic
1011781074 6:90790053-90790075 AGTGAGTCCACTTTCTCTCTGGG + Intergenic
1012211918 6:96530093-96530115 ATTGGATCCTTTTTCTATAAAGG - Intronic
1012295481 6:97516700-97516722 ATTGAATCCATTTACCTTCAAGG - Intergenic
1012482680 6:99684872-99684894 AATGAATACATTTTGTATCATGG + Intergenic
1012545381 6:100413174-100413196 ATTGAATCCATAAGCTCTCTGGG + Intronic
1013008613 6:106099168-106099190 ATTGGATTCTTTTTCTAACTAGG + Intronic
1013732182 6:113181395-113181417 ATTCATTCCCTTTTCTTTCTGGG + Intergenic
1015887716 6:137935887-137935909 ATTGAGTTCATTTTGTATTTTGG + Intergenic
1016511137 6:144844594-144844616 AATGATTACATTTTCTAGCTGGG + Intronic
1017381216 6:153832498-153832520 ATGTAATTCAGTTTCTATCTTGG - Intergenic
1018531675 6:164770867-164770889 ATGAAATCTATTTTCAATCTGGG + Intergenic
1019195228 6:170277440-170277462 ATTAATTCCATTTTCCATTTCGG + Intergenic
1019855766 7:3605551-3605573 ATTGATTCCATTATATATTTAGG + Intronic
1020879469 7:13741546-13741568 AATTAATCCTTGTTCTATCTTGG - Intergenic
1021077440 7:16322298-16322320 ATTTAATCAATTTACTAACTTGG + Intronic
1021432747 7:20579626-20579648 ATTGCAGCCATTTTCTGTTTTGG - Intergenic
1021979323 7:26039281-26039303 ATTGAATCCTTTCTCATTCTCGG - Intergenic
1022399328 7:30022148-30022170 ATTGAATGCATTTTAGATGTGGG - Intronic
1023305442 7:38821265-38821287 ATACAATCCATTTTCTTTGTAGG - Exonic
1024379203 7:48675236-48675258 ATTGAATCCATAAATTATCTTGG - Intergenic
1025536135 7:61950068-61950090 ATTGTTTCCAGTTTTTATCTGGG + Intergenic
1027553070 7:79623430-79623452 ATAGAATCCATATTTTTTCTTGG - Intergenic
1028549149 7:92037849-92037871 ATTAAATCAATTCTCTATATTGG - Intronic
1028691369 7:93656574-93656596 ATTAAATCAATTTTTTATTTTGG + Intronic
1030279944 7:107763126-107763148 ATTAAATACATTTTCTCTCATGG - Intergenic
1030709562 7:112734187-112734209 ATTTAATCCATTTACTTTCAAGG + Intergenic
1031017606 7:116592814-116592836 AATGAATCCATTGTCATTCTGGG + Intergenic
1031287933 7:119895785-119895807 AATGAATTCATTTTTTATATTGG + Intergenic
1031988850 7:128182597-128182619 ATTGAAATTATTTTCTCTCTGGG - Intergenic
1032774393 7:135095637-135095659 GTTGCTTCCATTTTCTATTTTGG - Intronic
1033120400 7:138662949-138662971 AATGTCTGCATTTTCTATCTTGG + Intronic
1035544755 8:471412-471434 TTTGAATACAGTTTCTATCAGGG + Intergenic
1035836953 8:2764869-2764891 TTTGCCTCCATGTTCTATCTGGG - Intergenic
1035861195 8:3029688-3029710 ATTGAATGCATTTTACATATGGG - Intronic
1037060611 8:14505010-14505032 ATTTAATAAATTTTATATCTAGG - Intronic
1038629399 8:29226861-29226883 ATTGCTTCCATTTTCCAACTTGG - Intronic
1038741360 8:30219734-30219756 ACTGTATCCATATTCTTTCTAGG + Intergenic
1039155977 8:34557663-34557685 AATGCATGCATTTTCTATATCGG + Intergenic
1040116941 8:43632772-43632794 ATTGTTTCTATTTTTTATCTGGG - Intergenic
1040802101 8:51353049-51353071 ATTGTAGCCATTTTCTTTCTTGG - Intronic
1041444958 8:57941076-57941098 ATTTACTACATTTTCTCTCTTGG + Intergenic
1042055349 8:64758365-64758387 ATAAAATTCATTTGCTATCTTGG + Intronic
1044062457 8:87654821-87654843 ATTGAATCTAAACTCTATCTGGG + Intergenic
1044648891 8:94474436-94474458 TTTAAATCCATTTTCCATTTGGG + Intronic
1044811314 8:96065566-96065588 ACTCAATGCATTTTCTGTCTTGG - Intergenic
1046025587 8:108719387-108719409 ATTGGATCGATCTTCTATTTTGG + Intronic
1046889517 8:119406599-119406621 TTTGACTTCTTTTTCTATCTGGG - Intergenic
1046898012 8:119494135-119494157 GTTAAATGCCTTTTCTATCTTGG - Intergenic
1046960332 8:120104928-120104950 ATGCAATCAATTTTCTATATAGG + Intronic
1047281876 8:123452926-123452948 ATTGCATCCATTTATTATCAAGG + Intronic
1047282046 8:123454329-123454351 ATTGCATCCATTTATTATCAAGG - Intronic
1048057616 8:130883292-130883314 ATTAAATACATTTTCTTTCCCGG - Intronic
1048880108 8:138864867-138864889 ACTGAAGACATTTTCTGTCTTGG - Intronic
1050702997 9:8362333-8362355 CTGAAATCCATTTGCTATCTTGG - Intronic
1050706235 9:8401503-8401525 ATTGAAACCATTTTGTAATTAGG + Intronic
1050844600 9:10198741-10198763 ATGGATTCATTTTTCTATCTTGG - Intronic
1050969324 9:11848193-11848215 ATTAAATCAATTTTAAATCTAGG - Intergenic
1051237962 9:15021919-15021941 TTTGTGTCCAATTTCTATCTTGG - Intergenic
1051373998 9:16385909-16385931 TTTTAATCTATTTTCTATATAGG + Intergenic
1052559317 9:30063471-30063493 ATTGGATCAATTTTTTTTCTAGG + Intergenic
1053617827 9:39787812-39787834 ATTTAATCCATTTACATTCTAGG + Intergenic
1053702962 9:40718534-40718556 ATTGAATAATTTTTCTGTCTTGG + Intergenic
1053876010 9:42547181-42547203 ATTTAATCCATTTACATTCTAGG + Intergenic
1053896646 9:42747455-42747477 ATTTAATCCATTTACATTCTAGG - Intergenic
1054235688 9:62554541-62554563 ATTTAATCCATTTACATTCTAGG - Intergenic
1054266333 9:62919619-62919641 ATTTAATCCATTTACATTCTAGG - Intergenic
1054413022 9:64841996-64842018 ATTGAATAATTTTTCTGTCTTGG + Intergenic
1055035596 9:71815041-71815063 ATTGAAGTCATTTTCTACCTCGG - Intronic
1055220924 9:73930361-73930383 TTTAAATCAATTTTCTATCATGG - Intergenic
1055507249 9:76961071-76961093 ATTAAATGCATTTTCTGGCTGGG - Intergenic
1055861268 9:80752175-80752197 AGTAAATCCATTTCCTACCTTGG - Intergenic
1055896600 9:81184132-81184154 ATTGAATTCATGATCTTTCTTGG - Intergenic
1058747579 9:108006998-108007020 ATTGTGTCCCTTTTCCATCTGGG - Intergenic
1059205850 9:112464599-112464621 AGTGAAGCCATTTTGTAGCTGGG + Intronic
1061863711 9:133480965-133480987 AATGAATCCATTTTAAATATAGG + Intergenic
1186551843 X:10514419-10514441 ATTGGATCCTGTTTCTTTCTTGG - Intronic
1188197480 X:27255145-27255167 ATTAAATTCATTCTCTAACTTGG + Intergenic
1188789862 X:34394670-34394692 ATTGAAAATATATTCTATCTGGG - Intergenic
1188998446 X:36915392-36915414 ATTGATCCCATTTTCAATTTTGG - Intergenic
1190593336 X:52027209-52027231 ATTGAATCTATATTCTACTTTGG + Intergenic
1191790511 X:64967507-64967529 ATTTGTTCCATTTTCTATATTGG - Intronic
1193976463 X:88125614-88125636 ATTGACTTAATTTTCTCTCTGGG - Intergenic
1194125444 X:90010903-90010925 ATTGTATTGATTTTATATCTTGG + Intergenic
1194674101 X:96773002-96773024 ATAGAATACATGTTATATCTTGG - Intronic
1194840862 X:98740047-98740069 TTAGATTCCATTTTATATCTTGG + Intergenic
1195005202 X:100678799-100678821 ATTATATTCATTTTCTCTCTAGG - Intronic
1196579992 X:117367644-117367666 ATAGATTCCATTGTCTCTCTAGG - Intergenic
1197661139 X:129173804-129173826 ATTGAACCCATTTTCTACAAAGG - Intergenic
1199974878 X:152888255-152888277 ATTAAATGCATTTTCTACTTAGG + Intergenic
1200242266 X:154503288-154503310 AATGTATCCATTTTATATCAGGG - Intergenic