ID: 1151856661

View in Genome Browser
Species Human (GRCh38)
Location 17:76726690-76726712
Sequence CGCCTCTCGCGGTTTTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151856649_1151856661 22 Left 1151856649 17:76726645-76726667 CCGAGCCTCGGGTTGGGCAAGCG 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1151856661 17:76726690-76726712 CGCCTCTCGCGGTTTTCCATTGG 0: 1
1: 0
2: 0
3: 1
4: 37
1151856651_1151856661 17 Left 1151856651 17:76726650-76726672 CCTCGGGTTGGGCAAGCGGCCGC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1151856661 17:76726690-76726712 CGCCTCTCGCGGTTTTCCATTGG 0: 1
1: 0
2: 0
3: 1
4: 37
1151856644_1151856661 29 Left 1151856644 17:76726638-76726660 CCACCTCCCGAGCCTCGGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1151856661 17:76726690-76726712 CGCCTCTCGCGGTTTTCCATTGG 0: 1
1: 0
2: 0
3: 1
4: 37
1151856648_1151856661 23 Left 1151856648 17:76726644-76726666 CCCGAGCCTCGGGTTGGGCAAGC 0: 1
1: 0
2: 2
3: 29
4: 185
Right 1151856661 17:76726690-76726712 CGCCTCTCGCGGTTTTCCATTGG 0: 1
1: 0
2: 0
3: 1
4: 37
1151856647_1151856661 26 Left 1151856647 17:76726641-76726663 CCTCCCGAGCCTCGGGTTGGGCA 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1151856661 17:76726690-76726712 CGCCTCTCGCGGTTTTCCATTGG 0: 1
1: 0
2: 0
3: 1
4: 37
1151856653_1151856661 -5 Left 1151856653 17:76726672-76726694 CCGTCTTCCCCGCCCCGACGCCT 0: 1
1: 0
2: 1
3: 22
4: 331
Right 1151856661 17:76726690-76726712 CGCCTCTCGCGGTTTTCCATTGG 0: 1
1: 0
2: 0
3: 1
4: 37
1151856652_1151856661 -2 Left 1151856652 17:76726669-76726691 CCGCCGTCTTCCCCGCCCCGACG 0: 1
1: 0
2: 3
3: 13
4: 201
Right 1151856661 17:76726690-76726712 CGCCTCTCGCGGTTTTCCATTGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151856661 Original CRISPR CGCCTCTCGCGGTTTTCCAT TGG Intronic
911734707 1:101324327-101324349 AGCCTCTAGAGGTTTCCCATTGG - Intergenic
920899219 1:210089933-210089955 AACCTCTAGCGGTTTCCCATTGG + Intronic
1064377784 10:14812577-14812599 ACCCTCTAGAGGTTTTCCATTGG - Intergenic
1073286785 10:102394429-102394451 CGCCTCGCGCCCTTTTTCATTGG - Intronic
1088325038 11:108592946-108592968 CGCCTAACGCAGTTTTCCCTCGG - Intronic
1088462025 11:110092758-110092780 CGCCTCTCGGGTTTTCCCCTTGG + Intergenic
1089138219 11:116266264-116266286 CGCCTCTCTCCTTTTTCCAAAGG - Intergenic
1094278800 12:28711018-28711040 TGCCTCTTGCCTTTTTCCATGGG + Intergenic
1094555435 12:31494809-31494831 ACCCTCTAGAGGTTTTCCATTGG - Intronic
1097687563 12:62704983-62705005 TGCCTCTTGCTATTTTCCATAGG - Intronic
1108356789 13:49635576-49635598 ACCCTCTAGAGGTTTTCCATTGG + Intergenic
1111332863 13:86782701-86782723 ACCCTCTAGAGGTTTTCCATTGG + Intergenic
1112448282 13:99487071-99487093 ACCCTCTTGAGGTTTTCCATTGG + Intergenic
1116894117 14:50298817-50298839 CGGCTTTCGCTGTTTCCCATAGG - Intronic
1123706084 15:22951879-22951901 CGCATCTGGCGTTTTTCCGTGGG - Intronic
1123706092 15:22951950-22951972 CGCATCTGGCGTTTTTCCATGGG - Intronic
1129116758 15:73368924-73368946 CGCAGCTCGCGGGTTGCCATAGG + Exonic
1141789463 16:86224537-86224559 CCCCTCTCACGGTTCTCCTTCGG + Intergenic
1151856661 17:76726690-76726712 CGCCTCTCGCGGTTTTCCATTGG + Intronic
1155842077 18:30658755-30658777 GCCCTCTAGAGGTTTTCCATTGG + Intergenic
935309251 2:101766977-101766999 ACCCTCTAGAGGTTTTCCATTGG + Intronic
945063808 2:205931462-205931484 ACCCTCTAGAGGTTTTCCATTGG + Intergenic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1184958911 22:47914588-47914610 AGCCTCTAGAGGTTTCCCATTGG + Intergenic
951465016 3:22991407-22991429 CCACTCTCCCGGTTTTCCCTGGG + Intergenic
959464988 3:106674759-106674781 ACCCTCTAGAGGTTTTCCATTGG - Intergenic
981358047 4:143814454-143814476 TCCCTCTCCCGGTTTTTCATAGG + Intergenic
981379036 4:144050504-144050526 TCCCTCTCCCGGTTTTTCATAGG + Intergenic
985897218 5:2755941-2755963 GGCCTCTCGAGGTTTTCAAATGG + Intergenic
1013534676 6:111052988-111053010 ATCCTCTAGAGGTTTTCCATTGG + Intergenic
1013618457 6:111866808-111866830 GGACTCTTGCGGTTTTTCATGGG - Intronic
1019030748 6:169008796-169008818 GCCCTCTAGAGGTTTTCCATTGG + Intergenic
1022007513 7:26279709-26279731 ATCCTCTAGAGGTTTTCCATTGG - Intergenic
1026253237 7:68689149-68689171 CCCCTCTAGAGGTTTCCCATTGG + Intergenic
1031402672 7:121344492-121344514 CACCTCTAGTGGTTTTCCTTTGG - Intergenic
1036732760 8:11280834-11280856 AGCCTCTAGAGGTTTCCCATTGG + Intergenic
1041615181 8:59898829-59898851 TGCTTTTCTCGGTTTTCCATGGG - Intergenic
1046074097 8:109296540-109296562 CACCTCTCGTGGTTTTCCTAAGG + Exonic
1062484143 9:136765917-136765939 ATCCTCTAGCGGTTTACCATTGG - Intronic