ID: 1151858260

View in Genome Browser
Species Human (GRCh38)
Location 17:76737923-76737945
Sequence CCCGGGACTACGTTTCCCAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151858253_1151858260 5 Left 1151858253 17:76737895-76737917 CCGCGGAGCGCTTGCGCGTGCCA 0: 1
1: 0
2: 0
3: 3
4: 21
Right 1151858260 17:76737923-76737945 CCCGGGACTACGTTTCCCAGCGG 0: 1
1: 0
2: 2
3: 21
4: 70
1151858252_1151858260 6 Left 1151858252 17:76737894-76737916 CCCGCGGAGCGCTTGCGCGTGCC 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1151858260 17:76737923-76737945 CCCGGGACTACGTTTCCCAGCGG 0: 1
1: 0
2: 2
3: 21
4: 70
1151858251_1151858260 7 Left 1151858251 17:76737893-76737915 CCCCGCGGAGCGCTTGCGCGTGC 0: 1
1: 0
2: 1
3: 3
4: 24
Right 1151858260 17:76737923-76737945 CCCGGGACTACGTTTCCCAGCGG 0: 1
1: 0
2: 2
3: 21
4: 70
1151858249_1151858260 23 Left 1151858249 17:76737877-76737899 CCTGGCGGTGGGGACTCCCCGCG 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1151858260 17:76737923-76737945 CCCGGGACTACGTTTCCCAGCGG 0: 1
1: 0
2: 2
3: 21
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151858260 Original CRISPR CCCGGGACTACGTTTCCCAG CGG Exonic