ID: 1151858270

View in Genome Browser
Species Human (GRCh38)
Location 17:76737955-76737977
Sequence CCTGACCGCAGCCGCGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 129}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151858270_1151858274 -7 Left 1151858270 17:76737955-76737977 CCGGCGCCGCGGCTGCGGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 129
Right 1151858274 17:76737971-76737993 GGTCAGGTGACCCGGTCGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 59
1151858270_1151858283 17 Left 1151858270 17:76737955-76737977 CCGGCGCCGCGGCTGCGGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 129
Right 1151858283 17:76737995-76738017 CGCAGTGAGTCAGGCTGGGAGGG 0: 1
1: 0
2: 2
3: 19
4: 249
1151858270_1151858277 8 Left 1151858270 17:76737955-76737977 CCGGCGCCGCGGCTGCGGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 129
Right 1151858277 17:76737986-76738008 TCGCCTGGCCGCAGTGAGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 80
1151858270_1151858282 16 Left 1151858270 17:76737955-76737977 CCGGCGCCGCGGCTGCGGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 129
Right 1151858282 17:76737994-76738016 CCGCAGTGAGTCAGGCTGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 189
1151858270_1151858280 13 Left 1151858270 17:76737955-76737977 CCGGCGCCGCGGCTGCGGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 129
Right 1151858280 17:76737991-76738013 TGGCCGCAGTGAGTCAGGCTGGG 0: 1
1: 0
2: 0
3: 19
4: 219
1151858270_1151858284 20 Left 1151858270 17:76737955-76737977 CCGGCGCCGCGGCTGCGGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 129
Right 1151858284 17:76737998-76738020 AGTGAGTCAGGCTGGGAGGGCGG 0: 1
1: 0
2: 4
3: 108
4: 1039
1151858270_1151858285 21 Left 1151858270 17:76737955-76737977 CCGGCGCCGCGGCTGCGGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 129
Right 1151858285 17:76737999-76738021 GTGAGTCAGGCTGGGAGGGCGGG 0: 1
1: 0
2: 10
3: 53
4: 617
1151858270_1151858286 22 Left 1151858270 17:76737955-76737977 CCGGCGCCGCGGCTGCGGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 129
Right 1151858286 17:76738000-76738022 TGAGTCAGGCTGGGAGGGCGGGG 0: 1
1: 0
2: 5
3: 44
4: 537
1151858270_1151858279 12 Left 1151858270 17:76737955-76737977 CCGGCGCCGCGGCTGCGGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 129
Right 1151858279 17:76737990-76738012 CTGGCCGCAGTGAGTCAGGCTGG 0: 1
1: 0
2: 2
3: 22
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151858270 Original CRISPR CCTGACCGCAGCCGCGGCGC CGG (reversed) Exonic
900364792 1:2306716-2306738 GCTGCCCGCAGCCTCGGGGCGGG - Exonic
900981878 1:6050339-6050361 CCTGACTGCAGCCTCGGCCATGG - Intronic
901483209 1:9539947-9539969 CCTGACCGCAGCCCCGAGGGCGG + Intronic
902044272 1:13513552-13513574 CCCGAGCGCCGCGGCGGCGCAGG + Exonic
903514744 1:23902869-23902891 TAGGACCGCGGCCGCGGCGCTGG + Intronic
904034475 1:27551447-27551469 CGTGGCCGCAGCCGTGGCTCCGG + Exonic
906107720 1:43304840-43304862 CCTGGCCCCAGGCGCGGCGGTGG + Exonic
915362481 1:155294553-155294575 CCTGACGGCAGCCACGTCGCTGG + Exonic
915558923 1:156675405-156675427 CCTGCCCGCTGCCGCTGCCCGGG + Intronic
922440895 1:225653774-225653796 GCTGGGCGCAGCCGCGGCGAGGG - Intergenic
922729358 1:227941868-227941890 CCTGATCCCAGCTGCGGCACGGG - Intronic
924770836 1:247078395-247078417 CCTGGCCGAAGCGGCGGGGCAGG + Intronic
1064035917 10:11913269-11913291 CCTGCCCGCAGCCCTGGCGGAGG - Intergenic
1064552955 10:16521074-16521096 CCTGATCGCCGCCGGGGCGCTGG - Exonic
1064981956 10:21174165-21174187 CCTCGCCGCCGCCGCCGCGCAGG + Intronic
1070327579 10:75398760-75398782 ACTGACCACCGCCTCGGCGCTGG - Exonic
1070819833 10:79348171-79348193 CCCGACCGCAGGGGCGGGGCCGG - Intronic
1071997700 10:91163392-91163414 CCTGGCCGCGGCCCCGCCGCGGG + Intronic
1076372368 10:129963868-129963890 CCGGACCGCAGGCGCCGAGCAGG - Intergenic
1076480776 10:130783978-130784000 CCAGACCGCAGCCCTGGCGAAGG - Intergenic
1076749882 10:132537409-132537431 TCTGTGCGCAGCCGCGGCGCGGG + Intergenic
1078233318 11:9461514-9461536 CCAGGCCGCAGCGGGGGCGCCGG + Intronic
1078579058 11:12524931-12524953 CCTGACCCCCGCCTGGGCGCAGG - Intronic
1083921079 11:65781539-65781561 GCTGGCCGCAACCGCGGCGCCGG - Intergenic
1083940021 11:65890736-65890758 CCCGCCCGCCGCCGCGGCCCAGG - Exonic
1085332858 11:75667863-75667885 CCTGGCCGCTGCCGCGCCGCGGG - Exonic
1087021977 11:93612071-93612093 CCAGACCTCAGCTGCAGCGCTGG + Intergenic
1090832320 11:130428178-130428200 CCGGCCCGCAGCCGGGGGGCAGG - Exonic
1100494637 12:95113059-95113081 CCTGACCTCAGCCACCACGCTGG + Intronic
1100869445 12:98894982-98895004 CCTGGCGGCAGCGGCGGCGGCGG + Intronic
1101682904 12:106986906-106986928 CCTGACCGCTGCGGCGCCGCTGG + Exonic
1106087645 13:26557779-26557801 TCAGAGCGCAGCCCCGGCGCCGG + Exonic
1106340262 13:28820305-28820327 GCGGAGCGCAGCCGCGGCGCGGG + Intergenic
1107549117 13:41458274-41458296 CCTGCCCGCAGCCCCGGCCCTGG + Exonic
1108363831 13:49691316-49691338 CCTGCCCGCGGCCCAGGCGCAGG + Exonic
1112320430 13:98402129-98402151 CATGACCGCACTGGCGGCGCCGG - Intronic
1112506994 13:99981408-99981430 CCTGACCGCGGCGGGGGCGCCGG - Intergenic
1113874403 13:113585162-113585184 CCTGGCCCCAGCCCCGGCCCCGG - Intronic
1114190219 14:20435247-20435269 GCTGGCCGCAGCAGAGGCGCTGG - Intronic
1119779900 14:77270735-77270757 ACTGGCCGCTGCCGGGGCGCTGG - Intronic
1123083955 14:105708934-105708956 CCTGACCGCAGCCCCTGCTCTGG + Intergenic
1123697946 15:22892464-22892486 CCTGACCGGAGGAGCGGAGCTGG - Intronic
1124109621 15:26773443-26773465 ACTGTCGGCAGCCTCGGCGCCGG + Intronic
1125508787 15:40282026-40282048 CCGGGCCGCAGCGGCGGCGGCGG + Exonic
1125903640 15:43370971-43370993 CCTGACCCCGGCCCCGGCCCCGG + Intronic
1130520580 15:84658160-84658182 CCCGAACGAAGCCGCGGCCCGGG - Exonic
1133219735 16:4315056-4315078 CCTGGCCGCGGGCGCCGCGCAGG + Exonic
1134036751 16:11037014-11037036 CCTGACAGCAGTCGTGGGGCGGG + Intronic
1134084593 16:11347678-11347700 CCTGCCCTCAGCCGCAGCGTTGG + Intronic
1136111042 16:28063712-28063734 CCTGGCAGCGGCCACGGCGCAGG + Intergenic
1139966387 16:70747802-70747824 CCTGGCCCCAGCCGCCCCGCTGG - Intronic
1142268057 16:89073850-89073872 CCTCACAGCAGCCGTGTCGCAGG + Intergenic
1142625909 17:1191781-1191803 CCTGACGGCAGCCTGGGCGCAGG - Intronic
1143030311 17:3963985-3964007 CCAGCCCCCAGCCCCGGCGCCGG + Intronic
1144586871 17:16492321-16492343 CCAGCCCGGAGCCGCGGGGCGGG - Intergenic
1145863764 17:28227493-28227515 CGTGAGCGCAGGCGCGGGGCGGG + Intergenic
1150692763 17:67378917-67378939 CCAGCCGGCAGCCGCGGCCCCGG - Intronic
1151858270 17:76737955-76737977 CCTGACCGCAGCCGCGGCGCCGG - Exonic
1154303978 18:13217734-13217756 CCGGTCCGCAGCCTCAGCGCGGG - Intronic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1159798459 18:72869088-72869110 CCAAGCCCCAGCCGCGGCGCGGG - Intergenic
1160673176 19:375911-375933 CCTGCCCGCAGCCTCAGAGCTGG + Exonic
1160701126 19:507916-507938 CCTACCCGCAGCGCCGGCGCAGG + Intronic
1160921800 19:1524146-1524168 CCCGGCCGCGGCGGCGGCGCAGG + Intronic
1161364190 19:3868814-3868836 CCTGAGGGAAGCCGCGGCGCCGG - Intronic
1162802350 19:13118433-13118455 CCGGAGCGCGGCCACGGCGCAGG + Exonic
1162909382 19:13841196-13841218 GCAGACCGCAGCTGCGGGGCAGG - Intergenic
1162914209 19:13865545-13865567 CCTGCTCGCAGCCCCGGGGCGGG + Intronic
1163027046 19:14518478-14518500 CCCGCCCGCCCCCGCGGCGCCGG + Intronic
1163443691 19:17334416-17334438 CCGGGCCGCAGCCGCAGTGCCGG + Intronic
1164595054 19:29526873-29526895 CCTTTCCGCAGCCGGGGCCCCGG - Intronic
925928241 2:8685570-8685592 CCTGTCGCCAGCCGCGGCCCCGG + Intergenic
926679803 2:15654542-15654564 CCTGCCCTCAGCCACGACGCTGG + Intergenic
927125895 2:20012408-20012430 CCTGGCCGCGCCCGCGGTGCAGG - Exonic
927520002 2:23692955-23692977 CCTGACCCCAGCCCAGGCCCAGG + Intronic
928904372 2:36355468-36355490 CCGCAGCGCACCCGCGGCGCCGG + Intergenic
934296834 2:91749089-91749111 CCGGGGCGCCGCCGCGGCGCTGG - Intergenic
934500537 2:94857447-94857469 CCTGGCAGCAACCGCGGTGCAGG - Intergenic
934927764 2:98393582-98393604 CATGACTGCAGCAGCGGGGCAGG - Intronic
948190628 2:236055569-236055591 CCTGGCCCCAGCCGCAGAGCGGG + Intronic
1169006072 20:2207889-2207911 CCTGCCCGCAGCCACGCAGCTGG + Intergenic
1169113157 20:3046036-3046058 CCTCACTGCGGCCGCGGTGCCGG - Exonic
1169135419 20:3194348-3194370 TCTGTCCGCAGCCACTGCGCAGG - Intronic
1173139659 20:40470942-40470964 GCTGACCGCAGGCCCGGCTCAGG + Intergenic
1175859781 20:62143895-62143917 CCGGGCCGGAGCGGCGGCGCTGG + Intronic
1176548601 21:8212241-8212263 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176556495 21:8256449-8256471 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176567532 21:8395276-8395298 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176575434 21:8439491-8439513 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1179833319 21:44012106-44012128 CCTGGCCTCAGCTCCGGCGCAGG + Intergenic
1184640510 22:45867704-45867726 CCTGCACGCATCCGCGGCCCCGG + Intergenic
1184737342 22:46406989-46407011 CCTGACCGCAGGAGCGGGGAGGG + Intronic
1185024051 22:48397423-48397445 GCTGAGCACAGCCGCGGTGCGGG + Intergenic
1203253485 22_KI270733v1_random:128546-128568 CCCGACGGCCGCCGCGGCGTCGG - Intergenic
1203261539 22_KI270733v1_random:173624-173646 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
951551516 3:23879669-23879691 CCTGTCCTCCGCCGCGGCCCAGG - Intronic
951907891 3:27721902-27721924 AGTGGCCGCAGCCGCGGCGGCGG + Exonic
952076376 3:29701952-29701974 TCTGCCCGCGGCCGTGGCGCGGG + Intronic
954558815 3:51538891-51538913 GCGGCCCGGAGCCGCGGCGCAGG + Intergenic
955182165 3:56682840-56682862 GCTGAGCCCAGCGGCGGCGCTGG - Exonic
961551418 3:127672476-127672498 TGTGAGCGCAGCCGAGGCGCAGG + Exonic
961698870 3:128726343-128726365 GCTTACCGCGGCCGCTGCGCTGG - Exonic
962498634 3:135966499-135966521 CCTGGCCGCCGCCGCCGCGGAGG + Intronic
962606409 3:137036048-137036070 CCTGACAGCAGCTGAGGCGCAGG - Intergenic
967596296 3:191329585-191329607 CCCGAGCGCAGCAGCAGCGCCGG - Exonic
968372685 4:10668-10690 CCTGGCCGGAGGCGCGACGCAGG + Intergenic
968508933 4:986980-987002 TGTGACCGCCGCCGCGGGGCGGG - Exonic
968815171 4:2818234-2818256 CCGGGCCGCGGCCGCGGAGCTGG + Exonic
968965230 4:3766192-3766214 CCGGAGCCCAGCCGGGGCGCAGG - Intergenic
975689587 4:76950308-76950330 CCTGAGCGCCCCCTCGGCGCGGG - Intronic
977693776 4:99946254-99946276 CCTGGCCCCAGCCCCGGCTCCGG - Intronic
978443976 4:108763122-108763144 CCTGCCCGCGGCCCCGGCGGGGG - Intergenic
979785645 4:124712701-124712723 CCTGACGGCGGCGGCGGCGGCGG - Exonic
984992556 4:185395996-185396018 CCCGACAGCACCCGCGGGGCCGG + Intergenic
985895571 5:2748627-2748649 GCTGCCCGCGGCCGCCGCGCCGG - Exonic
992957150 5:81921892-81921914 CCGGACCCCAGCCGCAGCTCAGG - Intergenic
994167073 5:96618874-96618896 TCTGCCCGCAGCCCCGGCACAGG + Intronic
1001653191 5:173329568-173329590 CCTGTCCCCGGCCCCGGCGCGGG - Intergenic
1005288772 6:24357817-24357839 CCTCACCGCACCCAGGGCGCGGG + Exonic
1007032328 6:38639744-38639766 CCTGGCCGCACCTGCGGCGCGGG - Intronic
1018279100 6:162165617-162165639 CCTGACAGCATCCGAGGCGGCGG + Intronic
1018366718 6:163128376-163128398 CCAGACTGCAGCAGCGGCCCTGG - Intronic
1020105656 7:5421182-5421204 CCGGACAGCAGCGGCGGCGGGGG + Exonic
1021600221 7:22356985-22357007 CCTGGCCGCCGCGGCGGCGGTGG - Intronic
1028476858 7:91263581-91263603 CCAGACCGCAGAGGTGGCGCCGG - Intergenic
1029413829 7:100430914-100430936 CCTCACAGCAGCCGCGGCACAGG + Exonic
1029569973 7:101362945-101362967 CCGGACCGAACCCGCGGCACCGG - Exonic
1032306121 7:130733804-130733826 CCCGCCCCCAGCCCCGGCGCGGG - Exonic
1034418017 7:150975264-150975286 CGTGTCAGCAGCCGCGGCGGAGG + Intronic
1035212336 7:157337345-157337367 CCAGACCCCAGCCCCGGCCCCGG - Intronic
1037262720 8:17026884-17026906 CCCGCCCGTAGCAGCGGCGCGGG + Intergenic
1039949012 8:42153267-42153289 TCCGCCCGCAGCCGCGGCGCCGG - Intronic
1041673675 8:60517077-60517099 GCTGACAGCAGCAGCGGCGGCGG + Exonic
1042155732 8:65842143-65842165 CCTGGGCGCTGCGGCGGCGCGGG - Intronic
1043578460 8:81685870-81685892 GCTGCCCGCAGTCGCGGTGCTGG - Exonic
1044698941 8:94949285-94949307 CCAGACGGCAGGCGCGGGGCCGG + Exonic
1057432245 9:95004975-95004997 CATCACCTCAGGCGCGGCGCGGG - Intronic
1060896864 9:127224353-127224375 CCTGCCCGCAGGCTCCGCGCTGG - Intronic
1061196665 9:129110574-129110596 ACCGACCCCAGCCGCGGCGGCGG - Exonic
1062621157 9:137423165-137423187 CCCGACCGCAGCCGCTGGCCCGG + Exonic
1062658372 9:137615507-137615529 CCTGGGCGGAGCCGCGGGGCTGG + Exonic
1203469885 Un_GL000220v1:111693-111715 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1203477706 Un_GL000220v1:155665-155687 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1187826284 X:23335257-23335279 CCCGACCGCGGCCGCGGCGCTGG - Intronic
1190302725 X:49065808-49065830 CCTGTCCTCACCCGGGGCGCTGG + Exonic
1192274595 X:69616341-69616363 CCTGCCTGCAGCAGCGCCGCGGG + Exonic
1192584144 X:72306731-72306753 CCCGCCCGCAGCTTCGGCGCCGG + Intronic