ID: 1151858780

View in Genome Browser
Species Human (GRCh38)
Location 17:76742900-76742922
Sequence CTTGTCAAGGCCAAAATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151858780 Original CRISPR CTTGTCAAGGCCAAAATTTT AGG (reversed) Intronic
902986843 1:20159926-20159948 CTGTACAAGTCCAAAATTTTAGG - Intergenic
904424510 1:30414826-30414848 CTTGTGATGGCCAATATTGTGGG + Intergenic
906901341 1:49839899-49839921 CTGGTCAGGACAAAAATTTTGGG + Intronic
908461281 1:64350446-64350468 GTTGGCACGGCGAAAATTTTTGG + Intergenic
909437622 1:75661439-75661461 TTTGTCCAGGCAAAGATTTTTGG + Intergenic
910092887 1:83486543-83486565 CTTGACAAGGCACAAATTATTGG - Intergenic
910230781 1:84984444-84984466 CTTTTCAAGGCCATAACTTTGGG + Intronic
913564753 1:120061974-120061996 CTAGTAAAGGCCAAACTATTGGG + Intronic
913633378 1:120731589-120731611 CTAGTAAAGGCCAAACTATTGGG - Intergenic
914285340 1:146221324-146221346 CTAGTAAAGGCCAAACTATTGGG + Intronic
914546371 1:148672079-148672101 CTAGTAAAGGCCAAACTATTGGG + Intronic
915874131 1:159594499-159594521 CTTATAAAGACCAAAATATTTGG + Intergenic
916155252 1:161839112-161839134 CTTGTCAAGATCTACATTTTAGG - Intronic
921596580 1:217060675-217060697 CTTGAAAAGGCAAAAATCTTAGG - Intronic
924395920 1:243620557-243620579 CTTATCAAGCTCTAAATTTTGGG + Intronic
1063348258 10:5331499-5331521 CTTGTCTAGGCTAAAACTTTTGG - Intergenic
1064156193 10:12905362-12905384 CTTGTAAAGGGCCAGATTTTAGG - Intronic
1068010236 10:51439663-51439685 ATTTGCAAGGTCAAAATTTTAGG - Intronic
1068033706 10:51734531-51734553 CTTCTCAAGGCCTACATTTGGGG - Intronic
1070091747 10:73293389-73293411 CTTGTCAATGTCAAGATGTTAGG + Intronic
1071261203 10:83920642-83920664 CCCCTCAAGGCCAGAATTTTGGG + Intergenic
1072135457 10:92541543-92541565 CTTGTTAAAGTTAAAATTTTAGG + Intronic
1072135620 10:92542834-92542856 CATGTAAAGGCCTAAATTTCAGG + Intronic
1072793080 10:98332976-98332998 CATGCCAAGGCCAAAAGTATCGG - Intergenic
1075775868 10:124987111-124987133 CTGTTAAAGGCCAAAAATTTTGG + Exonic
1077909732 11:6563616-6563638 CTTGGCAAGGCTAAACTGTTGGG + Intronic
1079875245 11:25848223-25848245 TTTCTCAAGGCAAAAATCTTGGG - Intergenic
1081046185 11:38277071-38277093 ATCTTCAAAGCCAAAATTTTTGG + Intergenic
1082116475 11:48335198-48335220 CTGGTCAAAGCCCCAATTTTGGG - Intergenic
1082257315 11:50045120-50045142 CTTGTCAAAGCCCCAGTTTTGGG + Intergenic
1082738218 11:56881041-56881063 CTTGTCAATGCTAGAAGTTTGGG - Intergenic
1084109343 11:67003367-67003389 TTAGTCAAGGCCAAAAATATGGG + Intergenic
1086629749 11:89003028-89003050 CTTGTCATGAGAAAAATTTTTGG - Intronic
1086747047 11:90441777-90441799 TTTGTCATGGCTAAAATTTTAGG + Intergenic
1086909433 11:92455327-92455349 CTTGTCAGAGCCACAATTTCTGG - Intronic
1087551513 11:99656496-99656518 CTTGAGAAGGGCAAAATTTCTGG + Intronic
1093253640 12:16839201-16839223 ATTTTCAAGGCTATAATTTTAGG - Intergenic
1094400038 12:30052715-30052737 CTTGTCCAGGCCAAAATACCTGG - Intergenic
1096165503 12:49420096-49420118 CTTCTCAGTTCCAAAATTTTAGG - Intronic
1096659693 12:53116486-53116508 CTTGTCATTCCAAAAATTTTAGG - Intronic
1100372780 12:93983809-93983831 CTGGTCAAGGCCAAAAGTGTAGG - Intergenic
1102336668 12:112086662-112086684 CTTCTGAAGGCAAAATTTTTTGG - Intronic
1105715236 13:23056406-23056428 CTTCTCAAGGCTAAAATCTCTGG - Intergenic
1105982991 13:25537835-25537857 CTTGTCAAGGAAAATAATTTGGG + Intronic
1108803422 13:54127867-54127889 GTTGTGACGGCAAAAATTTTTGG + Intergenic
1110998550 13:82145966-82145988 CTTCTCGAGGCCAAAATAATTGG + Intergenic
1111747468 13:92288819-92288841 GTTATCAAGGGCCAAATTTTAGG - Intronic
1112308928 13:98300799-98300821 CCTGACCAGGCCAACATTTTTGG - Intronic
1112829960 13:103437253-103437275 CTTGTCCAGGCCATCATTTAGGG - Intergenic
1113308259 13:109102016-109102038 CTCATCAATGCCAAAATTCTAGG - Intronic
1116558245 14:46341171-46341193 CTCCTCAAGTGCAAAATTTTGGG + Intergenic
1117139342 14:52771365-52771387 CTTTGCAAGTCCAAAATTCTTGG - Exonic
1117160280 14:52982879-52982901 CTTCTCAAGGCCAAAATGTGAGG + Intergenic
1118018862 14:61690177-61690199 CTTTTCAAGGCCAAAATGGAAGG - Intergenic
1118173306 14:63411008-63411030 CTTGTCTCTGGCAAAATTTTAGG + Intronic
1120316644 14:82902737-82902759 CTTGTCATGGGACAAATTTTGGG + Intergenic
1125365189 15:38905913-38905935 ATTGTCAAGGACATACTTTTAGG + Intergenic
1126930380 15:53642354-53642376 TTTGTCAAGTCAAAAATATTTGG - Intronic
1127712178 15:61610369-61610391 CTTCTCAATGTTAAAATTTTTGG - Intergenic
1128896774 15:71381029-71381051 CTTGTCAAGCCCATAATCCTAGG - Intronic
1131521020 15:93115377-93115399 CTTGTCGATGCCAGTATTTTGGG + Intergenic
1134774352 16:16838847-16838869 CTTGGCACTGCCAACATTTTGGG + Intergenic
1149121330 17:53169713-53169735 CTGGGCAATGCCAAAATATTTGG - Intergenic
1151858780 17:76742900-76742922 CTTGTCAAGGCCAAAATTTTAGG - Intronic
1152451621 17:80385069-80385091 CTTTGCAAGGCCAAAATCTCAGG - Exonic
1155849760 18:30757505-30757527 TTTGTCTAGGCAAAAATCTTTGG + Intergenic
1156683143 18:39615495-39615517 CTTGTTAAGGCCTAAATATATGG - Intergenic
1157632605 18:49113687-49113709 CTTGTTTAAGCCAAAATTTCAGG + Intronic
1158088109 18:53677893-53677915 CTTATTAAGGACTAAATTTTTGG - Intergenic
1159584926 18:70274821-70274843 CTTGTCAAGAACAGAATTTAGGG - Intergenic
1161903837 19:7140151-7140173 ATTGTCAAAGCCAAAATCTTTGG + Intronic
927591550 2:24361354-24361376 CTTGTCAAGGGCAAACCTTTGGG - Intergenic
931311590 2:61086285-61086307 CTTGTTAATTCCAAAACTTTGGG - Intronic
932088676 2:68785470-68785492 ATTGTTTAGGCCAAAACTTTTGG - Intronic
936111449 2:109669258-109669280 CTGGTCTAGGCAAAAGTTTTTGG + Intergenic
937019878 2:118640530-118640552 CTGGTCAAGGCCTAATTTGTGGG + Intergenic
939592988 2:144088902-144088924 CTGGCCAAGGCAAAAATTTATGG + Intronic
942801749 2:179883630-179883652 ATTGAAAAGGCCAAACTTTTGGG - Intergenic
942942544 2:181636311-181636333 ATTGTCAAAGACAAAATTTGGGG - Intronic
942960475 2:181824478-181824500 CTGGTCTAGGCCAAGAATTTAGG - Intergenic
943990533 2:194684543-194684565 CTTGACAATTACAAAATTTTTGG - Intergenic
944515061 2:200504577-200504599 TTTTTTAAGGCCAAAATTCTTGG - Intronic
945263668 2:207868983-207869005 TTTGCCAAGGCCAAAATGCTAGG + Intronic
945944283 2:215980068-215980090 CTTGTGATGGTCAAAATTTCTGG - Intronic
946093110 2:217248374-217248396 CCTGTCAGGGCCAGAATTGTCGG - Intergenic
1169336769 20:4763203-4763225 CTTAACAAGGCCAATAATTTTGG - Intergenic
1169508315 20:6237233-6237255 CTTGACACTGCTAAAATTTTGGG - Intergenic
1169825060 20:9758653-9758675 CTTGCCAAGGCTAAAATTCAAGG + Intronic
1172495232 20:35377430-35377452 CCTGTCAAGGCCAAATTATTAGG - Intronic
1173037392 20:39425640-39425662 CTTGTTAAAGCAAAAATTTCCGG - Intergenic
1174950274 20:55034846-55034868 CCTGTCAAGGCCAAATCTGTTGG + Intergenic
1179837472 21:44046414-44046436 CTTGTCAAGGCTACAATTGCTGG - Intronic
949925675 3:9039075-9039097 CTTGTCAAGGTCAACACTTAAGG + Intronic
950112920 3:10431983-10432005 CTTTTCAGGGACAAAATTTCAGG + Intronic
950838099 3:15939955-15939977 CTTGTCCAGGCCCAAGTCTTGGG + Intergenic
952767389 3:36966307-36966329 CATGTCAAGGCAATAATATTTGG - Intergenic
953809083 3:46096569-46096591 CTTGCCAAGGCCACAAGTTTGGG - Intergenic
954925611 3:54231760-54231782 CTTGTCAAGGCCAAGGTTATTGG + Intronic
955561261 3:60193586-60193608 CTTGTCAAGGCCATGGTTATAGG - Intronic
956723386 3:72137634-72137656 CTTTTCAAGTCCTAAATTTGGGG - Intergenic
957598049 3:82293369-82293391 CTTGAGAAGAACAAAATTTTAGG - Intergenic
959234724 3:103705495-103705517 CTTGTCCAGTTCAATATTTTAGG - Intergenic
959247860 3:103898246-103898268 CTTGTCAATGCCAAATTGATGGG - Intergenic
959312044 3:104751026-104751048 CTTTTCAAGGACATATTTTTAGG - Intergenic
961612141 3:128148462-128148484 CATGTCAAGGTCAGAATTTCTGG - Intronic
963979064 3:151515805-151515827 TTTGTCAAGCCCAAAATCCTGGG + Intergenic
964217906 3:154308810-154308832 TTTGTCAAGTCCAAAATTTTGGG - Intronic
964575747 3:158165930-158165952 CTACTCAAGGACAACATTTTAGG + Intronic
965715288 3:171596206-171596228 ATTGGCAAGGCCAAGATTTTAGG + Intergenic
970331792 4:14994024-14994046 ATTGTCAAGGAAAAAATATTGGG + Intergenic
974177442 4:58342631-58342653 CTTGCCAAGCCCAAAATTGCCGG - Intergenic
974753098 4:66167045-66167067 ATAGTCAAGGCCAACATTGTTGG - Intergenic
975272465 4:72451851-72451873 CTTTGAAAGGCCAAAATTTGAGG + Intronic
975799737 4:78047958-78047980 TTTGTGAAGGCCAATATCTTTGG + Intergenic
977229040 4:94429899-94429921 ATGCTCAAGGCCAAAATGTTGGG + Intergenic
979342149 4:119537995-119538017 ATTGCCAAGGTCAAAATATTTGG + Intronic
979925927 4:126563982-126564004 CTTCTCAAGGAATAAATTTTTGG + Intergenic
980553762 4:134375041-134375063 CTTGTCAAATCCAAATTTCTTGG + Intergenic
984780888 4:183524937-183524959 CTTGTTCAGGCCAAAAATCTTGG + Intergenic
985802044 5:2010842-2010864 CTTGGCAAGTCCAAAATCTGTGG - Intergenic
986342227 5:6800559-6800581 TTTGTCAAGGACAAAATTAGCGG - Intergenic
986517605 5:8580618-8580640 CTTGGCGAGTCCAAAATCTTGGG - Intergenic
986907605 5:12514239-12514261 ATGGTGTAGGCCAAAATTTTGGG + Intergenic
987702407 5:21417668-21417690 AATGATAAGGCCAAAATTTTGGG - Intergenic
988150929 5:27378819-27378841 CCTGTGAAGGTAAAAATTTTAGG + Intergenic
990456271 5:55991678-55991700 CACATCAAAGCCAAAATTTTAGG - Intronic
991978969 5:72211946-72211968 GTTGTTCAGGCCAAAAATTTTGG + Intergenic
995008513 5:107230682-107230704 CTTTACAAGACCAAAATTTCAGG + Intergenic
996136255 5:119846046-119846068 GTAGTCTAGGCCAAAATTTTAGG + Intergenic
996444605 5:123531368-123531390 TTTGTCAAGTCCTAAATTATTGG + Intronic
996660067 5:125991882-125991904 CTTGTCAAGGCTTGAATTTTAGG - Intergenic
998714287 5:144864822-144864844 GTTTTAAAGGCCAAAATTTCAGG + Intergenic
998763994 5:145464400-145464422 CTTGTCAAGGCCTAATCTTGTGG - Intergenic
999243738 5:150142192-150142214 CTTGTCTAGGCCAAAACAATGGG - Intronic
999805463 5:155076992-155077014 CTCTTCAAGGGCAAAACTTTGGG + Intergenic
1000964454 5:167639286-167639308 CATTTAAAGGTCAAAATTTTTGG + Intronic
1003344609 6:5255725-5255747 CTTGGCATGACCAAACTTTTGGG + Intronic
1008360197 6:50608235-50608257 CTTTTCAAGGCCGAAATTTTAGG + Intergenic
1012852698 6:104466025-104466047 CTTCCCAAGGCTAAAGTTTTGGG - Intergenic
1012967330 6:105688567-105688589 CTTTTCAAAGCAAAGATTTTAGG - Intergenic
1013704952 6:112821646-112821668 CTTCCCAATTCCAAAATTTTGGG - Intergenic
1021523647 7:21562181-21562203 CTTGTCATGATCAACATTTTGGG + Intronic
1024501423 7:50112343-50112365 CTTGGCATGGTCAGAATTTTGGG + Intronic
1026338562 7:69415673-69415695 CTTGTTTAGGCTAATATTTTTGG - Intergenic
1026368971 7:69679156-69679178 CTGGCCAAGGCCAGAATGTTTGG + Intronic
1027309746 7:76943038-76943060 CTTGACAAGGCACAAATTATTGG - Intergenic
1033054956 7:138042995-138043017 CCTGTAAAGGACAAAATATTAGG - Intronic
1034778746 7:153857151-153857173 CTTCACAAGGCCACATTTTTAGG + Intergenic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1038073145 8:24040341-24040363 ATTTTCAAAGCCAAAGTTTTAGG - Intergenic
1038463073 8:27732990-27733012 CTTGCCTTGGCCAAAATTTCAGG + Intergenic
1046618999 8:116507903-116507925 CTTGTTCAGGCGAAAATTCTTGG - Intergenic
1047648256 8:126891721-126891743 CTTGTCTAGGCCAGAAGTCTGGG - Intergenic
1048431635 8:134376604-134376626 GTTGTCAAGTACCAAATTTTTGG + Intergenic
1050566037 9:6884765-6884787 TTTCTCAAGGCTGAAATTTTTGG + Intronic
1051165349 9:14256375-14256397 CTTGTCTAGGTAAAAGTTTTTGG - Intronic
1051306283 9:15713497-15713519 CTTGTGTATGCCAAAATTTATGG + Intronic
1051678919 9:19587079-19587101 TTTGTCAAAGCCCATATTTTGGG + Intronic
1053072398 9:35108983-35109005 CTTGTCAGGGCCACCATTTGAGG + Exonic
1055383314 9:75732875-75732897 CTTGTCAAGGCAAAAACTCCTGG + Intergenic
1058268662 9:102941027-102941049 GTTGTTTAGGCCAAAATCTTAGG - Intergenic
1061510884 9:131060205-131060227 CATGTGAAGGCCAGAATTCTGGG + Intronic
1185715937 X:2342161-2342183 CTTGTCAAGATCAAAATTAAAGG + Intronic
1186469192 X:9807992-9808014 CTTGTCCAGGCCAAAAGCTCGGG - Intronic
1187014957 X:15317663-15317685 CTTTTCATGGCCAACTTTTTTGG - Intergenic
1187118386 X:16377145-16377167 CTTTTCTATGCCAAAATTTTAGG + Intergenic
1191938338 X:66450280-66450302 CTTGGCAAAGCCAAACTTTTAGG - Intergenic
1192005207 X:67204269-67204291 CTTGTAAAGGGTAAAATTCTAGG + Intergenic
1192948258 X:75988769-75988791 CTTGTTCAGTCCAAAATCTTTGG + Intergenic
1195864834 X:109420182-109420204 CTTGTCTAGTCCAAGATTCTGGG - Intronic
1196505431 X:116436177-116436199 CTAGTCAGGGGCAAAACTTTGGG + Intergenic
1198341523 X:135719173-135719195 CTTGTCAAGGTTAACAGTTTCGG + Intronic
1198346475 X:135764190-135764212 CTTGTCAAGGTTAACAGTTTCGG - Intronic
1198348381 X:135781475-135781497 CTTGTCAAGGTTAACAGTTTCGG - Intergenic
1198350285 X:135798739-135798761 CTTGTCAAGGTTAACAGTTTCGG - Intronic
1198352193 X:135816011-135816033 CTTGTCAAGGTTAACAGTTTCGG - Intronic
1198354101 X:135833279-135833301 CTTGTCAAGGTTAACAGTTTCGG - Intronic
1198356011 X:135850529-135850551 CTTGTCAAGGTTAACAGTTTCGG - Intronic
1198357924 X:135867807-135867829 CTTGTCAAGGTTAACAGTTTCGG - Intergenic
1198359838 X:135885090-135885112 CTTGTCAAGGTTAACAGTTTCGG - Intronic
1199267459 X:145845005-145845027 CTTGACACTGCCAAAATTTTGGG - Intergenic
1199338717 X:146650283-146650305 CATGTCAATGTCAAAATTTGAGG - Intergenic