ID: 1151863060

View in Genome Browser
Species Human (GRCh38)
Location 17:76780458-76780480
Sequence TGAGCTCTTCCTAGGCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151863060_1151863063 0 Left 1151863060 17:76780458-76780480 CCACCGTGCCTAGGAAGAGCTCA 0: 1
1: 0
2: 0
3: 15
4: 150
Right 1151863063 17:76780481-76780503 CTTTTGTTGTTGTTGTCTTTTGG 0: 1
1: 8
2: 73
3: 549
4: 2247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151863060 Original CRISPR TGAGCTCTTCCTAGGCACGG TGG (reversed) Intronic
900355287 1:2258832-2258854 TGAGCTCCCGCCAGGCACGGTGG - Intronic
900998273 1:6134461-6134483 TGAGCCCTGCCTGGGAACGGGGG - Intronic
907385274 1:54121809-54121831 TGAGCCCTTCCCAGACTCGGGGG + Intergenic
908556960 1:65265804-65265826 TGCGCCCTTCCTGGGCACGCGGG - Intronic
910839150 1:91545538-91545560 TGAGACCTTCCTAGGCACTGTGG + Intergenic
912254464 1:108045084-108045106 TGAGCTGTCCCTAGACAAGGTGG - Intergenic
914803367 1:150975429-150975451 TTTGCTCTTCCTTGCCACGGGGG - Intergenic
915434621 1:155894701-155894723 TGAAATCTTGCCAGGCACGGTGG - Intergenic
919688895 1:200510983-200511005 TGAGTCCTGCCCAGGCACGGTGG + Intergenic
920417904 1:205811014-205811036 TTAGCTCTTCCCAGGAAGGGAGG - Exonic
921971089 1:221149943-221149965 TGATCTCTTCCCAGGTATGGAGG + Intergenic
1067918225 10:50423610-50423632 TGAACTCTTCTTAGACAAGGTGG + Intronic
1069996740 10:72346746-72346768 TGAACTCTAGCAAGGCACGGTGG - Intronic
1070725218 10:78783042-78783064 TGTGCTCTTGCTATGCACGGTGG - Intergenic
1070817690 10:79335661-79335683 TGACCTCTTCCTAGGGGCAGTGG + Intergenic
1073416456 10:103386948-103386970 TGAGGTCTTGCCAGGCATGGGGG - Intronic
1073632087 10:105159222-105159244 TGGCCTCTTCCTAAGCACAGGGG - Intronic
1076306240 10:129467333-129467355 GGAGCTCTCCCTCGGGACGGTGG + Intronic
1077809901 11:5626590-5626612 TGAGTTCTTACCAGGCGCGGTGG + Exonic
1078419980 11:11202688-11202710 TGAGCACTGGCTGGGCACGGTGG + Intergenic
1079508432 11:21182144-21182166 TGAGCTCCAGCTGGGCACGGTGG + Intronic
1079959609 11:26906842-26906864 TGAGCTCTTCCTAGGGAAAGCGG - Intergenic
1081527964 11:43939892-43939914 TGACCTCTGTCCAGGCACGGTGG - Intronic
1082067499 11:47912596-47912618 TGTGCTCTGGCCAGGCACGGTGG - Intergenic
1083399091 11:62411578-62411600 TGAGCTGTGCCCAGGCACAGAGG - Intronic
1083716746 11:64581795-64581817 GGAGCTCTTCCTGGGCTCTGAGG + Intergenic
1085687038 11:78632954-78632976 TGAGCTGATCCTAGTCACGCTGG - Intergenic
1087315740 11:96600250-96600272 TGTGCTCTGACTAGGCATGGTGG + Intergenic
1089144355 11:116313575-116313597 TGAGCTCCTGCCAGGCATGGTGG + Intergenic
1089218003 11:116847381-116847403 TGAGCTCTTCCTACGAAGAGAGG + Intronic
1089682943 11:120129647-120129669 TTAGCACTTCCTTGGCCCGGTGG - Intronic
1091722757 12:2825302-2825324 TCAGCTCTTGATAGGCAGGGAGG + Intronic
1091820970 12:3474968-3474990 TCTGCTCTTCTCAGGCACGGTGG + Intronic
1092083247 12:5735445-5735467 TGAGCTCTTTCCAGGCACTGAGG + Intronic
1094697111 12:32830617-32830639 TTAGCTCTGGCCAGGCACGGTGG + Intronic
1094757199 12:33485285-33485307 ACAGCTCTTTCCAGGCACGGTGG + Intergenic
1095780014 12:46048973-46048995 TGATCTCTTCATAGGAAGGGTGG - Intergenic
1096125309 12:49114945-49114967 TGAGCTCTGGCTGGGTACGGTGG - Intergenic
1096848421 12:54420149-54420171 GGAGCTCTGGCCAGGCACGGTGG + Intergenic
1096936446 12:55284910-55284932 AGAGCTATTTCTAGGCACAGAGG - Intergenic
1100490514 12:95073562-95073584 TGACCTCTTTCTCGGCTCGGCGG + Exonic
1102216127 12:111162509-111162531 TGAGTTCTTCCTGGACAGGGTGG - Intronic
1102493368 12:113302643-113302665 TGGGCTGTTTCTAGGCACCGTGG + Intronic
1102950546 12:117028014-117028036 TGTGCTCTTTCTAGACACCGGGG + Exonic
1103990585 12:124796733-124796755 TGAGCTCTTCTTTGCCACAGGGG - Intronic
1104038286 12:125113621-125113643 GGAGCTCTTCCTTGGCATGCCGG - Intronic
1114166596 14:20225027-20225049 TGAGATCTGGCTGGGCACGGTGG + Intergenic
1117677000 14:58165525-58165547 TGAGCCCATCCCAGGCACAGAGG - Intronic
1117974469 14:61283557-61283579 TGAGGTCTTGCTGGGCATGGTGG + Intronic
1120974331 14:90235469-90235491 AGAGCACTTCTTAGGCAGGGAGG + Intergenic
1121685040 14:95829539-95829561 TGTGCTCTGCCTAGCCACGCAGG + Intergenic
1121787128 14:96670556-96670578 TGAGCTTATCCTAGGCAAGTGGG - Intergenic
1121840318 14:97128814-97128836 TGAACTCTTTCTAAGCACGAGGG + Intergenic
1123770551 15:23524323-23524345 TGTGTTCTGCCTGGGCACGGTGG + Intergenic
1125648160 15:41290898-41290920 TGAAATCTGGCTAGGCACGGTGG + Intergenic
1125716761 15:41823821-41823843 TGAGCTTTTCCTAGGCCCACCGG - Exonic
1127263419 15:57342569-57342591 TGAGCTCTGGCCAAGCACGGTGG - Intergenic
1127615138 15:60677168-60677190 TGAGCTCGTCCCTGGCCCGGAGG - Intronic
1129356281 15:74994338-74994360 TCAGCCCTTCCCAGGCACCGAGG + Intronic
1131101184 15:89691069-89691091 TGAGCTCTTGCTTGGGACGGTGG + Intronic
1133326513 16:4945313-4945335 TGGGCTTTTCATAGTCACGGTGG - Intronic
1133793922 16:9030948-9030970 TGAGCTACTGCCAGGCACGGTGG - Intergenic
1141876221 16:86826376-86826398 TAAACTCTTCCTAGACACCGTGG - Intergenic
1142522967 17:518056-518078 TGATATCTTGCCAGGCACGGCGG - Exonic
1143001264 17:3796679-3796701 TGAGCTGTCCCCAGCCACGGAGG + Intronic
1144579395 17:16449902-16449924 TGAGCTCAGCCTGGGCGCGGTGG - Intronic
1148119795 17:45201708-45201730 TGAGCTCTTTTTAGGCAGGTTGG + Intergenic
1148127728 17:45245533-45245555 TGAGCTCCTCCCAGGCAGGGTGG - Intronic
1150648513 17:66994846-66994868 AGAGGTCTTCCCAGGCAGGGTGG + Intronic
1151863060 17:76780458-76780480 TGAGCTCTTCCTAGGCACGGTGG - Intronic
1152642945 17:81456772-81456794 TGAGCTCTGCCTGGGGATGGGGG - Intronic
1152727731 17:81955921-81955943 TGAGCTCTGCCTGGGGTCGGGGG - Intronic
1158538684 18:58332358-58332380 TGAGCTTTGGCTGGGCACGGTGG + Intronic
1162075200 19:8182033-8182055 TGAGCTCTTGCTGGGCACAGTGG + Intronic
1164535708 19:29085150-29085172 TGGGCATGTCCTAGGCACGGAGG + Intergenic
1166997989 19:46728835-46728857 TTACCTGTTCCTAGGCACGGAGG - Intronic
1167658287 19:50780519-50780541 TGGGCGCATCCCAGGCACGGGGG - Intergenic
1168552218 19:57305786-57305808 TGAGCTCTGGCCAGGCACAGTGG - Intergenic
929962950 2:46510182-46510204 TGAGATCTGGCCAGGCACGGTGG + Intronic
932146458 2:69323204-69323226 TGAGCCCTTTTTAGGCAGGGAGG - Exonic
933584218 2:84162162-84162184 TTAGCTCTTCCAAGGCAGCGAGG + Intergenic
934523764 2:95035954-95035976 AGAGCTGTTGCTGGGCACGGTGG - Intronic
937267457 2:120625437-120625459 TGACATCTGCCAAGGCACGGAGG - Intergenic
937341779 2:121095872-121095894 TGAGCTCTGTCTGGGCACAGTGG + Intergenic
937908425 2:127064003-127064025 TGAGCTCCTCCTCGGCCTGGGGG + Exonic
942876178 2:180801446-180801468 TAAGCTCTTGCTAGGCATGTAGG - Intergenic
943188578 2:184646770-184646792 AGAGGTTTGCCTAGGCACGGAGG - Intronic
943615190 2:190084378-190084400 TGAGCTCTAGCTGGGCAAGGTGG - Intronic
946098621 2:217299260-217299282 TCAAGTCTTCCTAGACACGGAGG - Intronic
947683913 2:232063439-232063461 TGAGCTCATCCTTGCCAAGGAGG - Intronic
947716302 2:232340588-232340610 TGAGCGCTGCCTGGGCACGAGGG - Intronic
948688039 2:239683523-239683545 TAAGCTTTTCCTAGGCAGAGGGG - Intergenic
1169360598 20:4945569-4945591 TGAGCGCTGGCTAGGCATGGTGG - Intronic
1172831225 20:37836708-37836730 TCAGCACTTGCTAGGCACAGAGG + Intronic
1173627515 20:44484080-44484102 TGAGCTCTGGCTGGGCACAGTGG - Intronic
1176268702 20:64224141-64224163 GGAGCTCCTCCTGGGCACCGGGG + Intronic
1179595619 21:42441382-42441404 TGAGCTCTTCACAGGCTTGGGGG + Intronic
1180983397 22:19890234-19890256 GGAGCTCTTCCTATGAGCGGTGG - Intronic
1181539721 22:23566719-23566741 TGAGCTCTGCCAAGGGCCGGGGG + Intergenic
1181548087 22:23616056-23616078 AGAGCTCTTCCTGGGCATGGAGG - Intronic
1181597949 22:23929527-23929549 CCAGCTCTTCCTAGGCACAGTGG - Intergenic
1181997408 22:26893658-26893680 TGAGTTCTTCCCAGGCCCTGGGG + Intergenic
1182993151 22:34787416-34787438 TGAGCTAATCCTAGTCACTGGGG - Intergenic
1184210064 22:43030245-43030267 TAATCTCTTGCTGGGCACGGTGG - Intergenic
951462946 3:22970434-22970456 TGAGTTCTGGCCAGGCACGGTGG - Intergenic
952061519 3:29516593-29516615 TGAGACCTTCTTAGGCATGGTGG - Intronic
952772753 3:37017194-37017216 TGTGCTCTTTCTGGGCACAGTGG - Intronic
953665169 3:44920661-44920683 TGAGCTCAGCCTGGGCACAGTGG - Intronic
953773650 3:45797483-45797505 TGAGCTCTTCCTTGCCAGGCAGG - Intergenic
962956810 3:140274286-140274308 AGAGCTCTTCCCAGGCACTCAGG - Intronic
963239137 3:142985552-142985574 TGGGCTCTGCCAAGGCACTGGGG + Intronic
964107355 3:153053457-153053479 TGGGCTCTGGCTTGGCACGGTGG - Intergenic
964226052 3:154403623-154403645 TGATCTCTTCCAAGGCTGGGAGG - Intronic
967450640 3:189618937-189618959 TGAGCTTGCCCTATGCACGGTGG + Intergenic
969568201 4:7992617-7992639 TGAGCTCTCCCTGGGGTCGGGGG + Intronic
969663090 4:8541746-8541768 TGAGCTCTGGCCAGGCACAGTGG - Intergenic
972053041 4:34764592-34764614 TGAGCTCTTACTGGGCACCCAGG - Intergenic
972443606 4:39121016-39121038 CCAGCTCTTCCTAGGCACAGTGG - Exonic
972676309 4:41262893-41262915 TGAGATCTGGCTAGGCACGGTGG - Intronic
974973764 4:68864595-68864617 TGAGCTCCGCCTACACACGGTGG + Intergenic
975002325 4:69239996-69240018 TGAGCTCTGCCTATACACGATGG - Intergenic
975191970 4:71474947-71474969 GGAGCTCTTCCTAGGAAAGAAGG + Intronic
975743565 4:77453816-77453838 CTAGCTCTTCCTAGGGAAGGTGG + Intergenic
979978006 4:127220740-127220762 TGGGCTCTGGCTAGGCACAGTGG - Intergenic
980271524 4:130590406-130590428 TCAGCTCCTGCCAGGCACGGTGG - Intergenic
982511065 4:156284062-156284084 TGAGCCCAACCTAGGCACTGTGG + Intergenic
984925228 4:184800631-184800653 GAAGCTCTTCCTTGGCACGCAGG + Intronic
987524008 5:19024557-19024579 TGGGCTCTGGCCAGGCACGGTGG + Intergenic
989663771 5:43827076-43827098 AAAGCTCATCCTGGGCACGGTGG - Intergenic
991470329 5:66962143-66962165 TGTGCTCTTCATTGGCACAGAGG - Intronic
993370072 5:87082129-87082151 TGAGTTCTTCCTATGAAAGGAGG - Intergenic
993504798 5:88695483-88695505 TGAGCTTGTCCCAGGCACTGAGG + Intergenic
993824505 5:92665854-92665876 AGAGCTCCTCCTAAGCAAGGAGG + Intergenic
998414044 5:141932635-141932657 TGTGTTCTTCCTAACCACGGAGG - Intronic
999693909 5:154171594-154171616 TGGACTCTTCCTAGGCAGGTAGG + Intronic
1000532571 5:162442010-162442032 TGATCTTTTCCTTGGCACTGTGG - Intergenic
1001481264 5:172090647-172090669 TGCGTTCTTGCCAGGCACGGTGG + Intronic
1002008244 5:176253499-176253521 TGAGCTATTTCCAGGCACAGTGG - Intronic
1002619058 5:180474029-180474051 AGAGCTCTGGCTGGGCACGGTGG + Intergenic
1004482175 6:16031399-16031421 TGTGCTCTGCCTACACACGGTGG + Intergenic
1006776714 6:36598667-36598689 TGAGCTTTGGCCAGGCACGGTGG - Intronic
1008904246 6:56658770-56658792 TGAGCTCTCCATATGCACAGTGG - Intronic
1010739245 6:79480434-79480456 TCAGTTCTTGCCAGGCACGGTGG - Intergenic
1011070641 6:83378109-83378131 TGAGTTCCTCCTAGGCTCAGTGG - Intronic
1011416180 6:87122476-87122498 TGAGGCCTTCCTGGGCAAGGAGG - Intergenic
1011802793 6:91036676-91036698 TGAGAGCTTACTAGGCACTGTGG - Intergenic
1012237084 6:96831617-96831639 TGAGCTATAGCCAGGCACGGTGG + Intronic
1018169890 6:161136427-161136449 TGAGCCCCTGCTGGGCACGGCGG - Exonic
1023321230 7:38999873-38999895 TGAGATGTTCCTAGGCACGATGG + Intronic
1027825611 7:83111420-83111442 TGAGCTCTTCAAAGGACCGGAGG + Intronic
1032244102 7:130193256-130193278 TGAGCTATTGCTGGGCACGGTGG + Intronic
1032474704 7:132203921-132203943 TGATCACTTCCCAGGCAGGGCGG + Intronic
1032948445 7:136879120-136879142 GGAGCTCTTTCTAGGCACAGAGG + Intronic
1036164877 8:6423106-6423128 TGTGCTTTTGCCAGGCACGGTGG - Intronic
1047246344 8:123148452-123148474 TCAGCTCTGGCTGGGCACGGTGG + Intronic
1053356519 9:37450589-37450611 TTAGCTCCTGCCAGGCACGGTGG + Intronic
1059476149 9:114549555-114549577 GGAGCTCTTCCCAGCCACTGCGG - Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1061011895 9:127960828-127960850 TGAGCTCTTCCTGTGGAGGGGGG - Intronic
1061275881 9:129569183-129569205 TGAGCTCTGCCAAGGGCCGGGGG + Intergenic
1061789982 9:133054229-133054251 TCAGCACTTCCCAGGCAGGGCGG - Intronic
1185547137 X:954596-954618 TGAGCTCTTCTTGGGCAGAGGGG - Intergenic
1187195373 X:17078345-17078367 TGAGCTCTGCCCAGACACAGAGG - Intronic
1187543944 X:20228683-20228705 TGAGCTCTTCTGAGGCTCTGGGG + Intronic
1190244815 X:48684121-48684143 TGAGATCTTCCTGGGAAGGGTGG - Intronic
1201747448 Y:17393886-17393908 TGAGATCTGCCTAGGCAACGTGG - Intergenic