ID: 1151863835

View in Genome Browser
Species Human (GRCh38)
Location 17:76786461-76786483
Sequence GGGGATTCACTAGGACTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151863828_1151863835 3 Left 1151863828 17:76786435-76786457 CCTGGCTGAGGACCACCTCTTAA No data
Right 1151863835 17:76786461-76786483 GGGGATTCACTAGGACTCACAGG No data
1151863826_1151863835 11 Left 1151863826 17:76786427-76786449 CCACCACACCTGGCTGAGGACCA No data
Right 1151863835 17:76786461-76786483 GGGGATTCACTAGGACTCACAGG No data
1151863832_1151863835 -9 Left 1151863832 17:76786447-76786469 CCACCTCTTAACTTGGGGATTCA No data
Right 1151863835 17:76786461-76786483 GGGGATTCACTAGGACTCACAGG No data
1151863827_1151863835 8 Left 1151863827 17:76786430-76786452 CCACACCTGGCTGAGGACCACCT No data
Right 1151863835 17:76786461-76786483 GGGGATTCACTAGGACTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151863835 Original CRISPR GGGGATTCACTAGGACTCAC AGG Intergenic
No off target data available for this crispr