ID: 1151866380

View in Genome Browser
Species Human (GRCh38)
Location 17:76806099-76806121
Sequence CAGCTCCCTCAGCTTGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151866376_1151866380 -10 Left 1151866376 17:76806086-76806108 CCAAGGCTGAAGCCAGCTCCCTC No data
Right 1151866380 17:76806099-76806121 CAGCTCCCTCAGCTTGCGGGAGG No data
1151866366_1151866380 27 Left 1151866366 17:76806049-76806071 CCCACCGCTGCACTGTGGGAGCC 0: 396
1: 752
2: 687
3: 329
4: 344
Right 1151866380 17:76806099-76806121 CAGCTCCCTCAGCTTGCGGGAGG No data
1151866373_1151866380 6 Left 1151866373 17:76806070-76806092 CCCCTTTCTGGGCTGGCCAAGGC 0: 904
1: 507
2: 305
3: 311
4: 429
Right 1151866380 17:76806099-76806121 CAGCTCCCTCAGCTTGCGGGAGG No data
1151866375_1151866380 4 Left 1151866375 17:76806072-76806094 CCTTTCTGGGCTGGCCAAGGCTG 0: 229
1: 528
2: 627
3: 366
4: 470
Right 1151866380 17:76806099-76806121 CAGCTCCCTCAGCTTGCGGGAGG No data
1151866368_1151866380 23 Left 1151866368 17:76806053-76806075 CCGCTGCACTGTGGGAGCCCCTT 0: 916
1: 548
2: 276
3: 193
4: 337
Right 1151866380 17:76806099-76806121 CAGCTCCCTCAGCTTGCGGGAGG No data
1151866374_1151866380 5 Left 1151866374 17:76806071-76806093 CCCTTTCTGGGCTGGCCAAGGCT 0: 250
1: 794
2: 496
3: 377
4: 460
Right 1151866380 17:76806099-76806121 CAGCTCCCTCAGCTTGCGGGAGG No data
1151866367_1151866380 26 Left 1151866367 17:76806050-76806072 CCACCGCTGCACTGTGGGAGCCC 0: 628
1: 843
2: 387
3: 192
4: 285
Right 1151866380 17:76806099-76806121 CAGCTCCCTCAGCTTGCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151866380 Original CRISPR CAGCTCCCTCAGCTTGCGGG AGG Intergenic
No off target data available for this crispr