ID: 1151866461

View in Genome Browser
Species Human (GRCh38)
Location 17:76806387-76806409
Sequence GAGCCTCCCCGCCCCCGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 3, 2: 14, 3: 58, 4: 365}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151866454_1151866461 21 Left 1151866454 17:76806343-76806365 CCTCCCTGCGGGGCAGGGCTCCG No data
Right 1151866461 17:76806387-76806409 GAGCCTCCCCGCCCCCGCCGTGG 0: 1
1: 3
2: 14
3: 58
4: 365
1151866451_1151866461 30 Left 1151866451 17:76806334-76806356 CCTTAGCTGCCTCCCTGCGGGGC 0: 35
1: 228
2: 682
3: 657
4: 576
Right 1151866461 17:76806387-76806409 GAGCCTCCCCGCCCCCGCCGTGG 0: 1
1: 3
2: 14
3: 58
4: 365
1151866459_1151866461 -4 Left 1151866459 17:76806368-76806390 CCTGCAGCCTGCTATGTCTGAGC 0: 1
1: 6
2: 173
3: 913
4: 794
Right 1151866461 17:76806387-76806409 GAGCCTCCCCGCCCCCGCCGTGG 0: 1
1: 3
2: 14
3: 58
4: 365
1151866457_1151866461 17 Left 1151866457 17:76806347-76806369 CCTGCGGGGCAGGGCTCCGGACC 0: 25
1: 403
2: 715
3: 634
4: 487
Right 1151866461 17:76806387-76806409 GAGCCTCCCCGCCCCCGCCGTGG 0: 1
1: 3
2: 14
3: 58
4: 365
1151866456_1151866461 18 Left 1151866456 17:76806346-76806368 CCCTGCGGGGCAGGGCTCCGGAC No data
Right 1151866461 17:76806387-76806409 GAGCCTCCCCGCCCCCGCCGTGG 0: 1
1: 3
2: 14
3: 58
4: 365
1151866458_1151866461 1 Left 1151866458 17:76806363-76806385 CCGGACCTGCAGCCTGCTATGTC 0: 1
1: 1
2: 14
3: 64
4: 205
Right 1151866461 17:76806387-76806409 GAGCCTCCCCGCCCCCGCCGTGG 0: 1
1: 3
2: 14
3: 58
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151866461 Original CRISPR GAGCCTCCCCGCCCCCGCCG TGG Intergenic
900113613 1:1019782-1019804 CAGGCGCCCCTCCCCCGCCGCGG - Intergenic
900139275 1:1132706-1132728 GACCTTCCCCTCCCCCTCCGAGG - Intergenic
900171340 1:1270619-1270641 GAGCCTCCCAACTCCCCCCGTGG + Intronic
900623687 1:3598713-3598735 GAGCCCCCCCCCCCCCCCCGGGG + Intronic
900651032 1:3730173-3730195 GGGCCTCCCCGCCCTGCCCGTGG - Intronic
902148121 1:14420590-14420612 GAGCCTCCCCACTCCTGCCGTGG - Intergenic
902213348 1:14919459-14919481 GAGCCACCGCGCCCCTCCCGAGG + Intronic
902387819 1:16085803-16085825 GAGCCTCCCAGGCCCTGCCAAGG + Intergenic
902585729 1:17437951-17437973 CGGCCGCCCCTCCCCCGCCGCGG + Intronic
903260360 1:22128564-22128586 GAGCATCCCAGCCCCAGCCAGGG + Intronic
903413738 1:23167943-23167965 GGGCCTCCCCCCGCCCGCCGCGG - Intronic
903435106 1:23343826-23343848 GAGCCGCTTCGCTCCCGCCGCGG - Intronic
903986830 1:27234831-27234853 GAGCCCCCCAGCCCCCTCCCCGG + Exonic
904467800 1:30718531-30718553 GCTCCTCCCCGGCCCCGCCCCGG + Intronic
904769141 1:32871120-32871142 GGTTCTCCGCGCCCCCGCCGCGG + Intronic
905066840 1:35192081-35192103 AGGCCGCCCCGCCCCCGCAGCGG + Intronic
906379982 1:45326703-45326725 GAGCCTCCCTTCCCCAGCCCAGG - Intergenic
906650392 1:47508615-47508637 TTCGCTCCCCGCCCCCGCCGGGG + Intergenic
907922911 1:58929897-58929919 CAGCCTCCCCGCCCTCCCCGTGG + Intergenic
908128186 1:61050658-61050680 GAGCCGCCGCGGCCCCGCCCGGG + Intronic
914044260 1:144077800-144077822 TTGCATCCCCGCCGCCGCCGTGG + Intergenic
914834909 1:151198865-151198887 CCACCTCCCCGCCCCCTCCGGGG - Exonic
914871005 1:151473613-151473635 GAGCCTCGCCGCTCCCTCCCGGG - Intergenic
915458232 1:156054116-156054138 AAGCCTCCCCGCCCCCTCCGCGG + Intergenic
917291735 1:173477727-173477749 TGGCCTCCCCGCCTCCGGCGTGG + Intronic
917535626 1:175872364-175872386 TAGACTCCGAGCCCCCGCCGAGG - Intergenic
920881996 1:209889034-209889056 GAGCCTCCCCCAACCCGCCGTGG - Intergenic
922821408 1:228487922-228487944 GCGCCTCTCCGCCCCCGCCCCGG + Intronic
924561150 1:245156796-245156818 GAGCATCCCCAGCGCCGCCGGGG - Intronic
1063300359 10:4845003-4845025 GAGCCTCCCCTGACCCTCCGTGG - Intronic
1063994968 10:11611170-11611192 GGGCCTCCCCGCACCCCGCGCGG + Intronic
1064461057 10:15535208-15535230 GAGCCTCCCCCCACCCTCCGTGG + Intronic
1065020018 10:21495926-21495948 CAGCGTCCCCACCCCCTCCGGGG - Exonic
1065752144 10:28896908-28896930 GAGCCTCCCCGCCCCTCCGTGGG - Intergenic
1065895917 10:30163084-30163106 GAGCCTCCCCGCCCCTCCGTGGG + Intergenic
1067792624 10:49299480-49299502 GAGCCTCCCTGCCCACGCTAAGG - Intronic
1067937595 10:50624580-50624602 GAGCCGCCCCGCCCCGCCTGGGG + Intronic
1069124958 10:64618983-64619005 GAGCCTCCCCTCCCTCACTGTGG + Intergenic
1069470730 10:68687134-68687156 CCGCCCCCCCGCCCCCGCCTTGG + Intronic
1069598306 10:69686930-69686952 GAGCCTCCCTGCTCCCCCCAGGG - Intronic
1069876984 10:71569038-71569060 GAGCTTCCCCGCTCCAGCCCTGG + Intronic
1070309337 10:75261957-75261979 GAGGCTCCCCGCTGCCTCCGTGG - Intergenic
1070781076 10:79137819-79137841 GAGCACCCCCCCCCCAGCCGAGG - Intronic
1072710764 10:97714397-97714419 GAGGCCGCCCGCGCCCGCCGCGG + Exonic
1073051654 10:100671116-100671138 GAGACCCGCCGCCTCCGCCGGGG + Intergenic
1073059431 10:100724549-100724571 GAGCCTGGTCGCCGCCGCCGCGG - Intergenic
1073207424 10:101776285-101776307 CGGCCGCCCCGCCCCCGCCCCGG - Intronic
1073325844 10:102643729-102643751 GAGGCCCGGCGCCCCCGCCGCGG - Intergenic
1075031947 10:119029758-119029780 CCGCCTCCCCGCCGCCGGCGCGG - Exonic
1075736500 10:124667649-124667671 CAGCCTCCCAGCCCCGCCCGGGG + Intronic
1075841800 10:125511240-125511262 GCCCCTCCCCGCCCCCGTCGCGG + Intergenic
1077492805 11:2869948-2869970 GAGCCTCCCCCTCCCGGCCGCGG - Intergenic
1079708653 11:23653276-23653298 GAGCCTCCCCGCCCCCGCCATGG - Intergenic
1081670151 11:44938233-44938255 CATCCTCCCCGCCCACGCCGAGG + Exonic
1081705609 11:45180752-45180774 GAGCCCGCCCGCGCCCGCCCCGG + Intronic
1082272151 11:50183545-50183567 AAGCCTCCCCACCCACTCCGTGG + Intergenic
1082824465 11:57567746-57567768 GGGCCTCCCCGCACCCGCTCCGG + Exonic
1083478204 11:62927231-62927253 GACCCTCCGCGCCCCTGCCGCGG + Intergenic
1083637496 11:64128445-64128467 GAGCCTCCCCAGCCCCACCCAGG - Intronic
1083741531 11:64713893-64713915 GCGGCGCCCCTCCCCCGCCGCGG + Exonic
1083885770 11:65572834-65572856 GAGCCGCGCCGCCCGCGCCCCGG + Exonic
1084000941 11:66295205-66295227 GCGCCAGCTCGCCCCCGCCGGGG + Exonic
1084107131 11:66987499-66987521 GGGCCTCCCCTCCCCCGCCAAGG + Intergenic
1084192782 11:67506329-67506351 GGCCCTCTCCGCCCCAGCCGTGG - Intergenic
1084265616 11:68003872-68003894 GGCCCGCCCCGCCCCCGCCGGGG + Intronic
1086887932 11:92225406-92225428 AAACCTCCCGGCTCCCGCCGCGG - Intergenic
1088481683 11:110301026-110301048 GAGCCTCCCCGCCTTCTCCGTGG - Intergenic
1089062084 11:115633981-115634003 GAGCCTCCCCCCACCCTCTGTGG - Intergenic
1089502423 11:118940381-118940403 GAGCTTCCCCCCACCCCCCGGGG - Intronic
1089666900 11:120026171-120026193 GAGTCTCCCCACCACCACCGTGG + Intergenic
1090003990 11:122984317-122984339 CAGCCGCCCCGCCTCTGCCGGGG + Intergenic
1090013133 11:123062449-123062471 GACGCTCCCCTCCCCCGCCCGGG - Intronic
1092364090 12:7862458-7862480 GAGCCTTCCCACCCCCTCTGTGG + Intronic
1093381454 12:18499678-18499700 GAGCCTCTCCTCCACCTCCGGGG - Intronic
1096116947 12:49060391-49060413 GAGCTGCCCCGCCCCCGGCCTGG + Intergenic
1096178600 12:49538886-49538908 CCACCTCCCCGCCCCCGCCGAGG + Intergenic
1097267756 12:57755616-57755638 CCGCCTCCCCGGCCCCCCCGGGG - Exonic
1097383240 12:58920202-58920224 GAGCCTCCGTGCGCGCGCCGCGG - Exonic
1100734602 12:97512873-97512895 GAGCCTCCCCCTCGCCTCCGTGG - Intergenic
1101640129 12:106581629-106581651 GCGCTTCCCCGCCCCCGCCGCGG + Intronic
1103363701 12:120368438-120368460 GAGCCTCCTGGCGCCCACCGGGG + Intronic
1103534768 12:121626838-121626860 GGGGCTCCCCGTCCCCGCTGCGG - Exonic
1104758771 12:131284685-131284707 GAGCCTCCCTCCCCCACCCGAGG + Intergenic
1104807040 12:131596287-131596309 GAGGCTGTCCGACCCCGCCGTGG - Intergenic
1104821830 12:131681840-131681862 GAGCCTCCCTCCCCCACCCGAGG - Intergenic
1105405239 13:20127869-20127891 GAGCTTCCCGGCACCGGCCGTGG + Intergenic
1106246563 13:27954619-27954641 GAGCCTCCCCGCGCTCCCAGCGG - Intergenic
1106600528 13:31183141-31183163 GAGCCTCCCCGCCCGCTCCATGG - Intergenic
1108996032 13:56735835-56735857 GAGACTCCCCGCCCCTCCCTGGG + Intergenic
1109110983 13:58318624-58318646 GAGCCGCCCCACCCCTGCCATGG - Intergenic
1110735277 13:78928791-78928813 CTGCCTCCCCCCCCCCGCCCCGG + Intergenic
1110892352 13:80707398-80707420 GTGCCTCCCCCCCCCCGCGTTGG - Intergenic
1111570055 13:90072856-90072878 GAGCCACCACGCCCACGCCTTGG - Intergenic
1113655902 13:112067718-112067740 GAACCTCTCGGGCCCCGCCGGGG + Exonic
1113779716 13:112969164-112969186 GAGCCGCCCCCCGCCCCCCGCGG + Intronic
1115339013 14:32272629-32272651 GAACCTCCCTGCCCCAGCCAAGG + Intergenic
1115533211 14:34345895-34345917 GAGCCTCCCTGCCCCTGCCGTGG - Intronic
1115689224 14:35826378-35826400 GCTCCTCCCCGCCCCCGGCCCGG - Exonic
1116905093 14:50396643-50396665 AAGCCTCGCCGCCGCCTCCGCGG - Intronic
1117449841 14:55839738-55839760 GAGCCTCCCCCAGCCCTCCGTGG + Intergenic
1117727310 14:58687363-58687385 GAGCCTCCCCCAGCCGGCCGCGG - Intergenic
1118137412 14:63045215-63045237 CATCCCCCCCTCCCCCGCCGCGG - Exonic
1118220975 14:63853775-63853797 GCGCCCCCCCGCCCCCGCGGAGG - Intronic
1118339149 14:64880002-64880024 CCGCCTCCCCGCCCCCGCCGCGG - Intergenic
1119004157 14:70908422-70908444 GGCACTGCCCGCCCCCGCCGCGG + Intronic
1119519702 14:75277108-75277130 CGGCCTCCCCGGCCCGGCCGCGG - Intergenic
1120209835 14:81623855-81623877 GAGTCTCCCCCGCCCCGCCGTGG - Intergenic
1120789233 14:88563521-88563543 GCTCCTCCCAGCCCCCGCCCGGG + Intronic
1121212008 14:92214178-92214200 GCGCCTCCCCGGCCCCTCCATGG - Intergenic
1122514564 14:102297960-102297982 GAGCCTCCCAACCCCCGCTGTGG + Intronic
1122543320 14:102509555-102509577 GGGCGTCCCCGCCCCTGCCGCGG + Exonic
1122546306 14:102524623-102524645 GCTCCTCCCCGCCTCCGCCCCGG + Intergenic
1122613432 14:103001143-103001165 AAGCCTCCCTGCCACCGCCAAGG + Intronic
1123025066 14:105420323-105420345 GCGCCCCCCCGCCACCCCCGCGG - Intronic
1124128911 15:26967868-26967890 GGGTCCCGCCGCCCCCGCCGAGG + Intergenic
1124439263 15:29674991-29675013 GAACCTCCCCTCCCCCGCCGGGG + Intergenic
1125999374 15:44194921-44194943 GCGCCGCCCCGCCCCGCCCGCGG - Intronic
1127893879 15:63277769-63277791 GGGGCTCCCCTCCCCCGCTGGGG + Intronic
1127904370 15:63365513-63365535 GAGCTTCCCCTCCCCTGCCTGGG + Intronic
1128067483 15:64774252-64774274 GAGCCTTCCTGCCCCTGCCCTGG - Intronic
1128743691 15:70099371-70099393 GAACCTCCCCGCGCCCGCTCCGG + Intergenic
1129234145 15:74213792-74213814 CAGCCTCCCTTCCCCCGCAGGGG - Intergenic
1129666452 15:77582144-77582166 GACCACCCCCGCCCCCGCCATGG + Intergenic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1130966986 15:88705183-88705205 CAGCCTCCCCGCCCCTGCTGTGG - Intergenic
1131012679 15:89031788-89031810 GAGCCTCCCCGGATCCGCTGAGG - Intergenic
1131257554 15:90872032-90872054 CAGCCTCCCCGCCGCCACCGGGG + Intronic
1131510419 15:93046809-93046831 GAGCCTCCCTGCTCCAGCCCCGG - Intronic
1132580784 16:683779-683801 TCCCCTCCCCGCCCCCGCAGAGG - Exonic
1132645480 16:997486-997508 GAGCCTGCCCGCCTCCTCCACGG + Intergenic
1132779427 16:1614484-1614506 GAGCCCGCCCGAGCCCGCCGCGG - Intronic
1132806553 16:1777673-1777695 CAGCCACCCCGCCCCAGCCCAGG - Intronic
1132933769 16:2471234-2471256 GAGCAGCCCCGCCCCCGGCTGGG + Intergenic
1133033490 16:3022450-3022472 GAGCCTCACCCCCGCCCCCGCGG - Intergenic
1133220179 16:4316293-4316315 GGGCCCCCCCCCCCCCGCCCCGG - Intronic
1133232094 16:4371776-4371798 GAGAGGCCCCGCCCCTGCCGCGG + Intronic
1135335806 16:21599918-21599940 GGGCCGCCACGCCCCCGCCCCGG - Intronic
1135942668 16:26836187-26836209 GAGCCTCCCCGCCTCCTCCGTGG - Intergenic
1137327990 16:47461025-47461047 GAGCCGGCCCGCCGCCGCCATGG + Exonic
1137613567 16:49834684-49834706 CAGCCACCCTGCCCCCTCCGTGG - Intronic
1137917129 16:52444248-52444270 GAGCCTGGCCGCCCCTGCCCAGG + Intronic
1139442332 16:66974500-66974522 GACCCTCCCCCCACCCCCCGTGG + Exonic
1139549815 16:67666975-67666997 CCGCCTCTCCGCCCCTGCCGAGG - Exonic
1139919554 16:70450884-70450906 GAGCCTCCCCAGCCACGCCGTGG - Intergenic
1140124131 16:72106176-72106198 CATCCTGCCCGCCCCCGCCCGGG - Intronic
1140209141 16:72957571-72957593 CAGCCTGCCCTCACCCGCCGAGG - Exonic
1141285449 16:82667561-82667583 GAGCCTCTCCGCCCTTGCCAAGG - Intronic
1142120467 16:88384025-88384047 CTGCCCCCCCGCCCCCGCCGGGG - Intergenic
1142474601 17:181487-181509 GCGCCGCCCCGCCCCGGGCGCGG + Exonic
1142684520 17:1570268-1570290 GATCCACCCCGCCCCCGCTTCGG + Intronic
1143001573 17:3798235-3798257 TAGCCTCCCCGGCCCCGGCAGGG - Intronic
1143135243 17:4709181-4709203 GAGCCTCCCCTCCCCCTCCGTGG - Intergenic
1143708620 17:8718166-8718188 GAGCCTCCCCGCCGCCACCGTGG - Intergenic
1144775726 17:17783691-17783713 GGGGCTCCTCGCCCCCGCCCCGG + Intronic
1145694246 17:26774654-26774676 TTGCCCCCCCGCCCCCACCGCGG + Intergenic
1145963818 17:28902952-28902974 GCGCCTCCCGGCTCCCGCCCAGG + Exonic
1146646661 17:34581052-34581074 GACCCCTCCCGCCCCCGCCTCGG + Exonic
1147028363 17:37609223-37609245 GCCCCTCGCCGCCCCCGCGGAGG + Intronic
1147741099 17:42671342-42671364 TGGCCTCACCTCCCCCGCCGTGG + Exonic
1147971824 17:44222265-44222287 GCGGCTGCCCGCCGCCGCCGGGG - Intergenic
1150217211 17:63477357-63477379 GCCCCGCCCCGCCCCCGCCCGGG - Intergenic
1150830118 17:68511876-68511898 GACTCTCCCCGCCCCGGCCCGGG + Intronic
1150873725 17:68944853-68944875 GAGCGTCCTCTCCCCCGCCGTGG - Intronic
1151866461 17:76806387-76806409 GAGCCTCCCCGCCCCCGCCGTGG + Intergenic
1152069889 17:78129151-78129173 GACTCTCCCCGACCCCGGCGGGG + Intronic
1152245706 17:79183556-79183578 CAGCCTCCCCGCCCGGGCAGGGG - Intronic
1153480447 18:5542982-5543004 TAGCCTCCCCACCCCCACCGCGG + Intronic
1154070533 18:11148713-11148735 GAGCGTCGCGGCCCGCGCCGAGG - Intronic
1155654589 18:28178044-28178066 GAGCCTCCCCGCCCGCGTCGTGG + Intergenic
1156250152 18:35344526-35344548 GGGCCGCCCCTCCCCCGCCCGGG - Intronic
1159008590 18:63037199-63037221 GGGCCACCCCGCCCCCGCCCCGG + Intergenic
1160011291 18:75108728-75108750 GGGCCTCCCTGCCTCCACCGAGG + Intergenic
1160019273 18:75167785-75167807 GAGCCGCCTCGCCCCCACCCTGG - Intergenic
1160200049 18:76788663-76788685 GAGCCTCCCCCTCCCCGCCATGG - Intergenic
1160727240 19:622772-622794 GTGCCTGCCCGCCCCGCCCGGGG + Intronic
1160772841 19:840815-840837 CAGCCTCCCCGCCCCCACAAAGG + Intergenic
1160780543 19:876076-876098 TAGCCTCGCAGCCCCCGCCTGGG + Intronic
1160859007 19:1229830-1229852 CGCCCTCCCCGCCCGCGCCGCGG - Exonic
1160881639 19:1323455-1323477 GAGGCTCCCTGCCCCCACCTGGG - Intergenic
1160968921 19:1758785-1758807 GACCGCCCCCACCCCCGCCGAGG - Intronic
1160992212 19:1864421-1864443 CACCCTCCCGGGCCCCGCCGCGG - Intergenic
1160997165 19:1888131-1888153 GAGGCTCCCAGCCTCCGCTGAGG + Intergenic
1161073831 19:2275516-2275538 GAGCCTCCCCTCCCGTGCTGGGG - Exonic
1161175989 19:2842162-2842184 GGGCGTCTCCGCCCCCGCCGAGG - Intronic
1161407482 19:4098691-4098713 GAGCCCTCCCGCCCCCTCCCGGG + Intronic
1161439703 19:4283860-4283882 GAGCCACCGCGCCCCCGCCCGGG + Intronic
1161504443 19:4636341-4636363 GATCCCGCCCGCCCCGGCCGCGG + Intergenic
1161513194 19:4683055-4683077 GCCCCTCCCCGCCGCCGCAGAGG + Intronic
1162024922 19:7888457-7888479 GAGCCGCCCCGCCCCGCCCCCGG - Intergenic
1162797854 19:13095829-13095851 CCGCCTCCCCGCCCCCCACGTGG + Exonic
1163597078 19:18226388-18226410 GGGCCCCCCCGCGCCCGCCCCGG - Intronic
1163685268 19:18708853-18708875 CAGCCACCCTGCCCACGCCGTGG + Intronic
1163793372 19:19321205-19321227 GAGCGGCCCCCCACCCGCCGCGG - Intronic
1164598624 19:29546646-29546668 CAGCCTCGCCGTCCCCGCTGGGG + Intronic
1164693728 19:30228336-30228358 CAGGGCCCCCGCCCCCGCCGGGG + Intronic
1165777751 19:38414823-38414845 GAGCCCCCCTGGCCCCGCCCAGG - Intronic
1166546972 19:43639719-43639741 GACCCTACCTGGCCCCGCCGCGG + Exonic
1166824774 19:45601998-45602020 GCTCCTCCCCGCCCCCTCGGGGG - Intronic
1166945737 19:46395098-46395120 AAGCCTCCCCTCCCCCTCCTGGG + Intergenic
1167134295 19:47608240-47608262 CCGCCTCCCCGGCGCCGCCGTGG + Exonic
1167267666 19:48491497-48491519 GAGCGTCCAGGCCCCCCCCGAGG - Exonic
1167292231 19:48630647-48630669 AACCCTCCCCGCCCCCGCAAGGG + Exonic
1167738819 19:51312020-51312042 GGGCCTCCCCGCGCCGGCCCAGG - Intronic
1168340769 19:55621869-55621891 GAGTCTCCCAGCCCCGGCCCCGG + Exonic
1202683781 1_KI270712v1_random:31100-31122 TTGCATCCCCGCCGCCGCCGTGG + Intergenic
926095694 2:10079828-10079850 GCGCGTCCCCGCCCCAGCCCTGG - Intronic
926422931 2:12716832-12716854 GCCCCGCCCCGCCCCCGCCCGGG - Intergenic
926801845 2:16665930-16665952 CAGCCGCCCCGCCCCGGCCCCGG + Intronic
926805521 2:16707142-16707164 GAGACTCCCGCCCCCCGCCCTGG - Intergenic
927542741 2:23927206-23927228 CAGCTGCCCCGCCCCCGGCGCGG + Intergenic
928143701 2:28752316-28752338 GAGCCTCCTCGCCCCCTCCTCGG - Intronic
928617912 2:33057515-33057537 GAGTCTCCCCCACCCCACCGTGG - Intronic
928723090 2:34142623-34142645 GAGCCTCCCCACCCACCCCATGG - Intergenic
929501161 2:42493057-42493079 GAGCCGCCTCGGCCCCGCCGGGG + Exonic
930636552 2:53812197-53812219 GAGCCTCCGCGCCCCAGCCAGGG + Intronic
932496410 2:72147868-72147890 GGCCCTCCCCTCCCCCGCCGCGG - Exonic
932621934 2:73269718-73269740 GAGCCTTCCTGACCCCGCAGGGG - Exonic
932725721 2:74178547-74178569 CAGCTACCCCGCCCCCGCCTCGG + Intronic
933667103 2:84971986-84972008 GAGCCTTCCCGCCAGCCCCGCGG - Intronic
933707691 2:85304108-85304130 AGGCCTCCCTGCCCCCGCCCAGG + Intronic
934247909 2:90323715-90323737 TTGCATCCCCGCCGCCGCCGTGG - Intergenic
934261467 2:91479094-91479116 TTGCATCCCCGCCGCCGCCGTGG + Intergenic
934296814 2:91749016-91749038 CACCCTCGCCGCCGCCGCCGCGG + Intergenic
937203868 2:120223506-120223528 TCGCCTCCCCGCGCTCGCCGCGG + Intergenic
937294207 2:120799915-120799937 GAGCATCCCCGCCCCTGAGGGGG - Intronic
937309494 2:120893332-120893354 CAGCCTCCCCTCCCCCACCTGGG + Intronic
938368835 2:130756255-130756277 GGGCCTCCCCCTCCCGGCCGCGG + Intronic
939153836 2:138501834-138501856 CAGCCCCCACCCCCCCGCCGCGG - Exonic
940215120 2:151296229-151296251 GAGCCTCCCCCGCGCCTCCGTGG + Intergenic
940784582 2:157968002-157968024 GAGCCTCCCCTCCCACTCCGTGG - Intronic
941951324 2:171160237-171160259 GGGCCTCCTCTCCCGCGCCGCGG - Intronic
943060499 2:183037949-183037971 GGGCCCGCCCGCCTCCGCCGCGG + Intronic
943443326 2:187951987-187952009 GAGCCTCCCCTTCCCCCCCATGG + Intergenic
944111435 2:196135491-196135513 GAGCCACTGCGCCCCCGCCCAGG - Exonic
945102506 2:206274954-206274976 GCCGCGCCCCGCCCCCGCCGCGG - Intronic
945225713 2:207529845-207529867 GAGCGGCCCCGCCCCCGCGCTGG - Intronic
945664197 2:212721157-212721179 AAGCCTCCCCCGCCCCGTCGTGG - Intergenic
946843242 2:223837784-223837806 CCCCCTCCCCGCCCCCGCCTCGG + Intronic
947117942 2:226791672-226791694 GCCCCGCCCCGCGCCCGCCGCGG + Intronic
948192499 2:236070767-236070789 ATGCCTCCCCGCCCCTGCCCCGG - Intronic
948681753 2:239639944-239639966 AAGCCTCCCCGTCCCGGCCCTGG + Intergenic
948988717 2:241541264-241541286 GACAGGCCCCGCCCCCGCCGCGG - Intergenic
948991745 2:241559098-241559120 GGCCCTCCCCGCCCCGGCCCGGG - Intronic
1169266935 20:4172581-4172603 GAGCCGCCCTGCTCCCGGCGTGG + Intronic
1170230848 20:14044914-14044936 GAGCCTCCCCTCCACTGCCATGG - Intronic
1172037226 20:32018876-32018898 GAGACCCCCCCGCCCCGCCGAGG - Intronic
1172118336 20:32584221-32584243 GAGCCTCCCCCCGCCCGCCCCGG - Intronic
1172326815 20:34042221-34042243 GACGATCCCCGCTCCCGCCGAGG + Intronic
1172773126 20:37393024-37393046 GCCCCTCCCCGCTCCCGCCCAGG + Intronic
1173728402 20:45312417-45312439 GCACCTCCCCGCCCGGGCCGGGG - Intronic
1174874029 20:54208337-54208359 GAGGCTCCCGGCCCCAGCCCCGG - Intronic
1175429408 20:58891328-58891350 CCGCCTCCCCCCGCCCGCCGCGG + Intronic
1175853062 20:62104125-62104147 CAGCCACACGGCCCCCGCCGCGG - Intergenic
1176110404 20:63408215-63408237 GAGCCTCCCACCCCCGGCCTGGG - Intronic
1176189411 20:63800810-63800832 GAGCCTCCCCCTCCCCGCAGTGG + Intronic
1177833841 21:26169727-26169749 GCGACACCCCGCCCTCGCCGTGG - Intronic
1178992147 21:37366042-37366064 GCTCCTCCCCGCCCCCACCACGG + Intronic
1179411812 21:41168239-41168261 GCGCCCCCCGGGCCCCGCCGTGG + Exonic
1179976888 21:44873455-44873477 CAGCCGCCCCGCCCCCTTCGCGG + Intronic
1179985908 21:44920093-44920115 GAGCTTCCCTGCCTCCTCCGTGG - Intronic
1180650003 22:17369665-17369687 GCGCCCCGCCGCCCCCGCCGAGG + Exonic
1180698795 22:17770650-17770672 GAACCTCCCCGCCGCCGTCACGG - Intronic
1180782774 22:18530053-18530075 AACCCTCCCCGTCCCCCCCGCGG + Intronic
1180794916 22:18598279-18598301 GATCCACCCCGCCCCCACCTTGG - Intergenic
1180843598 22:18970352-18970374 GCGCCCCCCAGCCCCCGCCCAGG + Intergenic
1180843612 22:18970378-18970400 GCGCCCCCCAGCCCCCGCCCAGG + Intergenic
1181067354 22:20313216-20313238 GCACCCCCCCGCCCCCGCCCAGG + Intergenic
1181226822 22:21397038-21397060 GATCCACCCCGCCCCCACCTTGG + Intergenic
1181239664 22:21469391-21469413 AACCCTCCCCGTCCCCCCCGCGG + Intergenic
1181251827 22:21537815-21537837 GATCCACCCCGCCCCCACCTTGG - Intergenic
1181567904 22:23750980-23751002 GAGCTGCCCCGCCCCGGCCCAGG - Exonic
1182338005 22:29598154-29598176 GAACCTCTCTGCCACCGCCGTGG - Intergenic
1182358508 22:29733595-29733617 GAGCCTCCCCGCCTTCTCTGCGG - Intronic
1182593385 22:31399406-31399428 GGGCCTCCCCGAGCGCGCCGAGG - Intergenic
1183058701 22:35322338-35322360 CGGCCTCCCTGCCCCCGCGGAGG - Intronic
1183420923 22:37710786-37710808 GAGCCTCCCCTCCCCAGTCCTGG + Intronic
1183903481 22:41022643-41022665 GTCCCTCCCTGCCCCCACCGCGG - Intergenic
1184230505 22:43156012-43156034 GAAACTCCCCGCCCCCGACCAGG + Intronic
1184677201 22:46050210-46050232 GAGCCTCCCCTCCACTGCGGAGG - Exonic
1185276189 22:49951081-49951103 CAGCCTCCCCGCCCCTGTCCCGG - Intergenic
1185278643 22:49960702-49960724 GATTCGCCCCGCCCCCGCGGAGG + Exonic
1185317864 22:50186460-50186482 GACCCTCCCCGCCCCAGCCCTGG - Intronic
1185340531 22:50288931-50288953 GAGCCTCCCCGCCCCAGCCTGGG + Intronic
950268134 3:11590514-11590536 GAGCCTTCCAGCCCCAGCAGAGG - Intronic
951332925 3:21387340-21387362 GAGCCTCCCCCCACCCGCCGTGG - Intergenic
952744406 3:36764117-36764139 GAGTCCTCCCGCCCCCGCCAAGG + Intergenic
953705256 3:45225952-45225974 GCGCGTCCGCGGCCCCGCCGCGG + Exonic
953908863 3:46882120-46882142 GAGCCTTCCGCCCCCCGCCCCGG - Intronic
954615610 3:51967528-51967550 GCCCCTCCCCGCCCCCTCCCCGG + Intronic
955001380 3:54930731-54930753 GATCCTCCCTGCCTCCGGCGAGG - Intronic
960096746 3:113696658-113696680 GCCCCTCCCCGCCCCTCCCGCGG + Intergenic
961322294 3:126084179-126084201 GGGCCTCCCTGGCCCCGCCCCGG + Exonic
962250525 3:133833419-133833441 GAGCCTTCCTGACCCCCCCGGGG + Intronic
962316716 3:134363895-134363917 AAGCCTCCCAGCCCCCACCAGGG - Intronic
964375078 3:156041549-156041571 GAGCCTCCCCAACCCCACTGTGG + Intronic
964977788 3:162640343-162640365 GAGTCTCCTCCCCCCCACCGTGG + Intergenic
966866136 3:184260058-184260080 GCGCCCCCCCGCCCCGGCCCAGG - Exonic
967904088 3:194486746-194486768 GGGCCGGCCCGGCCCCGCCGCGG - Intronic
968514981 4:1012014-1012036 GCCCCTCCCCGCCCCCGCCCCGG - Intronic
968571910 4:1346612-1346634 GCGCCTCCCCGCTCCGGCCTCGG - Intergenic
968804409 4:2763212-2763234 GAGCCTCCCCCGCTCCTCCGTGG - Intergenic
969285827 4:6201110-6201132 GAGCCTCCCCCCACCAGCCCAGG + Intergenic
973854134 4:54993743-54993765 GAACCTCCCCCGGCCCGCCGTGG + Intergenic
974839762 4:67286784-67286806 GAGTGCCCCCACCCCCGCCGTGG - Intergenic
975166715 4:71186589-71186611 GAGCCGCGCCGCCTCCGCCGGGG - Intergenic
975633038 4:76421091-76421113 GAGCCGCCCCGCAGCCTCCGCGG - Intronic
976431351 4:84966323-84966345 GGGGCTCCCGGGCCCCGCCGCGG - Exonic
977206555 4:94170117-94170139 GAGCCTCCCCACCCCCGCCCTGG + Intergenic
979547168 4:121951565-121951587 GAGCCGCAGCGCCGCCGCCGGGG - Exonic
979755893 4:124339283-124339305 GAGCCTCCCCACCCCCTCGGTGG + Intergenic
980739290 4:136929267-136929289 GAGCCTCCCCCACCACGCAGTGG + Intergenic
982647695 4:158044400-158044422 GAGCCTCCCCGCCCTGCCCTGGG + Intergenic
982868771 4:160550195-160550217 GAGCCTCCCACCCCCCTCCGTGG - Intergenic
985467702 5:12989-13011 AAGCCACCCCGCCCCCGCCGGGG - Intergenic
985784533 5:1886970-1886992 GAGGCTCCGCGCGGCCGCCGAGG - Exonic
986733104 5:10649567-10649589 GAGCCTCTACAGCCCCGCCGTGG + Exonic
986912513 5:12574602-12574624 GCTTCCCCCCGCCCCCGCCGTGG - Intergenic
987948674 5:24649038-24649060 GAGCCTCTGCGCCCCGGCCTGGG + Intergenic
988883625 5:35531900-35531922 GAGCCCCCCCTCCCCCTGCGTGG + Intergenic
989103432 5:37840075-37840097 GCGCCTCCCCTCCCCCACCCCGG - Intergenic
992269978 5:75053724-75053746 GCGCCTCCGCGCTCCCGCAGAGG + Intergenic
994935312 5:106246484-106246506 GAGCCTCCCCGCCCCACCGTGGG + Intergenic
996530428 5:124521897-124521919 GAGCCTCCCCCCCCCCTCCATGG + Intergenic
996815598 5:127569686-127569708 GCGCCTCCCCTCCGCCTCCGTGG + Intergenic
998166675 5:139848292-139848314 GCGCGCCCCCGCCGCCGCCGCGG - Exonic
1000212382 5:159119401-159119423 GAGCCTCCCCCCACCTGCCATGG + Intergenic
1000432338 5:161166245-161166267 GAGCCTCCCCCCGCCAGCCGTGG - Intergenic
1001082116 5:168675084-168675106 TTCCCTCCCAGCCCCCGCCGAGG - Intronic
1002026610 5:176400114-176400136 CAGCCTCCCCTGCCCCGCCCCGG - Intronic
1002498510 5:179632364-179632386 TAGCACCCCCTCCCCCGCCGCGG + Intronic
1002526766 5:179819547-179819569 GAGCCACGTGGCCCCCGCCGAGG - Intronic
1002638943 5:180621509-180621531 GCGCGTCCCCGCCCTCCCCGCGG + Intronic
1002660904 5:180790688-180790710 CAGCCTCCCCGCCCGCTCCCAGG - Exonic
1002758055 6:179867-179889 GAGCCTCCCCCCAGCCGCCGTGG + Intergenic
1003290874 6:4776904-4776926 CCGCGTCCCCTCCCCCGCCGCGG + Intronic
1003869406 6:10390302-10390324 CAGCCTCCCCGCCCCCGCCGGGG + Intergenic
1003896993 6:10617147-10617169 GAGCCTCCCCCCGACCGCCATGG - Intronic
1004194000 6:13487772-13487794 GCTCCTCCCCGGCCCCGCCCAGG + Intergenic
1004349368 6:14877912-14877934 GAGGCTTCCTTCCCCCGCCGTGG + Intergenic
1004511679 6:16288528-16288550 GAGCTTCCCCGCCCCCTCCACGG + Intronic
1004694296 6:18019763-18019785 GAGCCTCCCCCCCGCCGCCGTGG - Intergenic
1004905451 6:20233446-20233468 GAGTCTCCCCGCCCCCGCCGTGG + Intergenic
1005533592 6:26733130-26733152 GATTCGCCCCGCCCCCGCCTCGG - Intergenic
1005535058 6:26746546-26746568 GATTCGCCCCGCCCCCGCCTCGG + Intergenic
1005537203 6:26768524-26768546 GATTCGCCCCGCCCCCGCCTCGG + Intergenic
1005749892 6:28872679-28872701 GAGCCTCCCACCCCCCTCCGTGG - Intergenic
1005942262 6:30569368-30569390 GAGCCACCGCGCCCCAGCCCAGG + Intergenic
1006007856 6:31017071-31017093 GAGCCTCCCCCACGCCGCCATGG + Intronic
1006638995 6:35479451-35479473 GACCCTCCCCGTCCCCACAGAGG + Intronic
1007419828 6:41712830-41712852 AAGCCTCCCCACCCCCTCCCAGG + Intronic
1007625377 6:43243612-43243634 GAGCCGCCCCCGCCCCGCCCCGG + Intergenic
1007644349 6:43369114-43369136 GCGTCTCCCCGTCCCCGCCTCGG - Exonic
1007644358 6:43369144-43369166 GGGCCTCGCCGTCCCCGCCACGG - Exonic
1009437663 6:63636233-63636255 GGGCCTCTCCGCCCCTCCCGCGG + Intronic
1010277925 6:73990756-73990778 GAGCCTCCCCTCTCCTCCCGCGG - Intergenic
1013024967 6:106262761-106262783 GAGCCTCCCTCCCCCAGCCAAGG + Intronic
1013080260 6:106806029-106806051 GAGCCTTCCCCCCACCTCCGCGG + Intergenic
1014517749 6:122400040-122400062 GGGCCGCCCCTCCCCCACCGCGG - Intronic
1014586328 6:123202227-123202249 GTCCCCCCCCGCCCCCACCGTGG + Intergenic
1016104696 6:140148208-140148230 GAGTCTCCCCACCCCGGCCGTGG - Intergenic
1016988099 6:149910097-149910119 GACCCTCCCCTCCCCCACCCTGG + Intergenic
1017097043 6:150813517-150813539 CACCCTCCCCACCCCCGCCCTGG - Intronic
1018612700 6:165660917-165660939 GCTCCTACCCGGCCCCGCCGCGG + Intronic
1018635041 6:165853957-165853979 GAGCCTCCCCGCCACCGTGGTGG - Intronic
1018778994 6:167045349-167045371 ACCCCTCCCCGCCCCCCCCGCGG + Exonic
1019054959 6:169216997-169217019 GAGCCTCCCCGACGCCACAGCGG + Exonic
1019112160 6:169724674-169724696 GCCCCTCCCCGCCCCTCCCGGGG + Intronic
1019393757 7:805370-805392 GAGCCGCTCTGCCCCCGCCTGGG + Intergenic
1019649065 7:2146831-2146853 GAGGCTCCCTGACCCCGCCACGG + Intronic
1019843528 7:3474143-3474165 GAGCCACCGCGCCCCAGCCTGGG - Intronic
1020213109 7:6170044-6170066 GTGGCTCCCCGCCCCCTCAGCGG - Intronic
1022089301 7:27097082-27097104 GAGCCTCCGCGCTCCCGCGTGGG + Intergenic
1027778980 7:82499843-82499865 GAGCCTCCCCCCACCTACCGTGG + Intergenic
1029609549 7:101619378-101619400 GAGCCTGCCCTCCCCAGCCCTGG + Intronic
1030049041 7:105522020-105522042 CGGCCTCCCCGCGGCCGCCGGGG - Intronic
1032167644 7:129558262-129558284 CCGCCTCCCCGCCCCCACCCCGG + Intergenic
1033654386 7:143362865-143362887 GCGCCTCCCCGCCCCTGCTCCGG + Intergenic
1034338945 7:150340400-150340422 GACCCTCCCCGCTCCTGCCCGGG + Intronic
1034508884 7:151519077-151519099 CTGCCTCCCCGCCTTCGCCGCGG - Intronic
1035082700 7:156231119-156231141 TACCCTCCCCACCCCCACCGTGG - Intergenic
1035315747 7:157996915-157996937 GTGCCTCCCCACACCCGCCCCGG - Intronic
1035485310 7:159218828-159218850 GAGTCTTCCCGCCGCTGCCGTGG - Intergenic
1035734258 8:1876367-1876389 CAGCCTCCCCGGCCCTGCCCGGG + Intronic
1036562180 8:9906715-9906737 CAGCCTCCCCCACCCCGCCTGGG + Intergenic
1036664458 8:10729957-10729979 GAGCCTCCCTGCCCGCCGCGCGG + Intronic
1036827137 8:11986320-11986342 CACCCTCCCCGCCCCGGCCCTGG - Intergenic
1037417543 8:18667768-18667790 GAGCCTCCCCCACCCCGCCATGG - Intronic
1037558969 8:20055001-20055023 GAGCCTCCCCCACTCCGCCGTGG + Intergenic
1037803804 8:22048862-22048884 GAGCCTGCCCGTCCCCGGCCGGG + Intergenic
1037902386 8:22695328-22695350 GACCCTCCCCGCAGCCGCCCGGG - Intergenic
1038319680 8:26514829-26514851 GAGCCTCGCCGCACCCTGCGCGG - Intronic
1038847575 8:31244236-31244258 GAGCCTCCCCCACCATGCCGTGG - Intergenic
1040501375 8:48008332-48008354 GGGTCGCCCCGCGCCCGCCGGGG + Intergenic
1041604324 8:59762086-59762108 GAGCCTCCCCTCCTCTGCTGTGG - Intergenic
1042923439 8:73942313-73942335 GAGCCACCGCGCCCCAGCCATGG - Intronic
1043284868 8:78516252-78516274 GAGCGGCCCCGCTCCCCCCGTGG + Exonic
1043640189 8:82441650-82441672 GAGCCTCCCCCTCCGAGCCGTGG + Intergenic
1043857188 8:85276297-85276319 GAGCCTCCCCCCAACCTCCGTGG + Intronic
1044404913 8:91816594-91816616 GAGCCTCCCCTCCCACTCCGTGG + Intergenic
1047100163 8:121667533-121667555 CCCCCGCCCCGCCCCCGCCGGGG - Intergenic
1049405268 8:142449580-142449602 GCGCCGCCCCGCCCCCGGCTCGG + Exonic
1049828507 8:144685458-144685480 GAGCCTCCGCGCCCCCCGCCCGG + Intergenic
1049857957 8:144875400-144875422 GAGGCTCCCCCTGCCCGCCGTGG + Intergenic
1050873927 9:10612721-10612743 GAGCCTCCTCCCCTCCGGCGCGG - Intronic
1051206285 9:14693021-14693043 GTGCCTCCCCGCCCCAGGCCTGG - Intronic
1051929022 9:22363564-22363586 GAGCCTCCCCGCTCCCCGGGTGG - Intergenic
1052028017 9:23596171-23596193 GAAGCTGCCCGCCCCTGCCGGGG + Intergenic
1053011793 9:34637791-34637813 GCGCTCCCCCGCCACCGCCGTGG + Intronic
1055654967 9:78442346-78442368 TAGCCTCCCCACCCCCAACGTGG + Intergenic
1056788116 9:89606858-89606880 GTGCCTCCCCTCCCCCTCCTCGG + Intergenic
1057605844 9:96497165-96497187 GAGCCTCCGCGGCCAGGCCGGGG + Intronic
1059988175 9:119839923-119839945 CAGCCTCCCCGCACCAGCCATGG - Intergenic
1060191795 9:121598561-121598583 GGGCCTCCCTGCCCCTGCTGGGG + Intronic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1060980054 9:127786426-127786448 GCCCCTCCCCGCCCCCACCACGG - Intronic
1061237600 9:129351708-129351730 GAACCCCCCCGCCCCCGCCTTGG + Intergenic
1061264504 9:129497357-129497379 CCCCCTCCCCGCCCCCGCCCGGG - Intergenic
1061361137 9:130143099-130143121 GATCCTCCCTGCCCCCACCCAGG + Intergenic
1061682727 9:132250890-132250912 GGGCCTCCCCAACCCCGCCATGG - Intergenic
1061835627 9:133327434-133327456 GAGCCACCACGCCCCAGCCAAGG + Intergenic
1062122853 9:134843021-134843043 AAGTCTCCCCACCCCCGCCCTGG + Exonic
1062146536 9:134992511-134992533 GGCCCCCCCCCCCCCCGCCGCGG + Intergenic
1062305905 9:135907126-135907148 GAGCGGCCGCGCCGCCGCCGAGG - Exonic
1062325832 9:136012113-136012135 GAGCCTCCCCGGCCGCTCCTGGG + Intronic
1062341417 9:136095316-136095338 CCGCCGCCCCGCCCCCGCCGCGG - Intergenic
1062469131 9:136694668-136694690 GAGCCTCCCAGCCCCACCCACGG + Intergenic
1062490054 9:136800566-136800588 GAGCCGCCCCGCACCCGCCAGGG + Exonic
1062606094 9:137349498-137349520 GAGCGTGCCAGCCCCAGCCGTGG - Exonic
1062696976 9:137880513-137880535 GATCCTCCCTGCCCCCGCCCCGG - Intronic
1189333008 X:40154547-40154569 CAGCCTCCCCTCCCCCACCTCGG + Intronic
1189385818 X:40536132-40536154 GAACCACTGCGCCCCCGCCGGGG + Intergenic
1190041856 X:47078391-47078413 CGGCCTCCCCGCCCCCTCCCTGG + Exonic
1190093375 X:47459456-47459478 GAGCCTCCACGCCCAGGCCCTGG - Intronic
1193679552 X:84501882-84501904 GACCCACCCCGCCCCCACCAAGG + Intronic
1195259342 X:103117198-103117220 GAGCCTCACCCCCACCTCCGTGG - Intergenic
1200097994 X:153673192-153673214 GACCCTCCCCTCCCCCGTCCAGG + Intronic
1200118751 X:153780777-153780799 GAGCCTCCGCACCCCAGCTGAGG - Intronic
1200126815 X:153819107-153819129 CAGCCACCCCGCCGCCGTCGCGG - Intronic
1200155351 X:153972073-153972095 GAGCCTCCACGCCTCCGCCCTGG + Intergenic
1200163103 X:154019254-154019276 CAGCATCCCTGCACCCGCCGAGG - Exonic
1201178431 Y:11323340-11323362 GAGCCTCCCAGCTCCCACCATGG + Intergenic