ID: 1151867497

View in Genome Browser
Species Human (GRCh38)
Location 17:76813900-76813922
Sequence CTGTAGCCACAGGCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151867497_1151867502 -3 Left 1151867497 17:76813900-76813922 CCCACCTCAGCCTGTGGCTACAG No data
Right 1151867502 17:76813920-76813942 CAGGCACACACCATCACACCCGG 0: 65
1: 1366
2: 6931
3: 25532
4: 61215
1151867497_1151867506 26 Left 1151867497 17:76813900-76813922 CCCACCTCAGCCTGTGGCTACAG No data
Right 1151867506 17:76813949-76813971 TTTGAATTTTTTGTAGAAACAGG 0: 6
1: 502
2: 14928
3: 206735
4: 238644
1151867497_1151867507 27 Left 1151867497 17:76813900-76813922 CCCACCTCAGCCTGTGGCTACAG No data
Right 1151867507 17:76813950-76813972 TTGAATTTTTTGTAGAAACAGGG 0: 5
1: 316
2: 8367
3: 88951
4: 193560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151867497 Original CRISPR CTGTAGCCACAGGCTGAGGT GGG (reversed) Intergenic
No off target data available for this crispr