ID: 1151871804

View in Genome Browser
Species Human (GRCh38)
Location 17:76841681-76841703
Sequence CCCTTGCGTGGCTGCATCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151871804_1151871809 0 Left 1151871804 17:76841681-76841703 CCTCTGATGCAGCCACGCAAGGG No data
Right 1151871809 17:76841704-76841726 GGTTCCACTCTGCTCCTTACTGG 0: 2
1: 0
2: 1
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151871804 Original CRISPR CCCTTGCGTGGCTGCATCAG AGG (reversed) Intergenic
No off target data available for this crispr