ID: 1151871809

View in Genome Browser
Species Human (GRCh38)
Location 17:76841704-76841726
Sequence GGTTCCACTCTGCTCCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 2, 1: 0, 2: 1, 3: 11, 4: 120}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151871800_1151871809 11 Left 1151871800 17:76841670-76841692 CCCCTGGGTGGCCTCTGATGCAG No data
Right 1151871809 17:76841704-76841726 GGTTCCACTCTGCTCCTTACTGG 0: 2
1: 0
2: 1
3: 11
4: 120
1151871799_1151871809 22 Left 1151871799 17:76841659-76841681 CCATGCTGTGGCCCCTGGGTGGC No data
Right 1151871809 17:76841704-76841726 GGTTCCACTCTGCTCCTTACTGG 0: 2
1: 0
2: 1
3: 11
4: 120
1151871802_1151871809 9 Left 1151871802 17:76841672-76841694 CCTGGGTGGCCTCTGATGCAGCC No data
Right 1151871809 17:76841704-76841726 GGTTCCACTCTGCTCCTTACTGG 0: 2
1: 0
2: 1
3: 11
4: 120
1151871804_1151871809 0 Left 1151871804 17:76841681-76841703 CCTCTGATGCAGCCACGCAAGGG No data
Right 1151871809 17:76841704-76841726 GGTTCCACTCTGCTCCTTACTGG 0: 2
1: 0
2: 1
3: 11
4: 120
1151871797_1151871809 23 Left 1151871797 17:76841658-76841680 CCCATGCTGTGGCCCCTGGGTGG No data
Right 1151871809 17:76841704-76841726 GGTTCCACTCTGCTCCTTACTGG 0: 2
1: 0
2: 1
3: 11
4: 120
1151871801_1151871809 10 Left 1151871801 17:76841671-76841693 CCCTGGGTGGCCTCTGATGCAGC No data
Right 1151871809 17:76841704-76841726 GGTTCCACTCTGCTCCTTACTGG 0: 2
1: 0
2: 1
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151871809 Original CRISPR GGTTCCACTCTGCTCCTTAC TGG Intergenic
900661754 1:3788198-3788220 GCCTCCACTCTGCTCTTTCCTGG + Intronic
903573695 1:24324754-24324776 GGTCCAGCTCTGCTACTTACTGG - Intronic
903605042 1:24569315-24569337 GGTTCCACTCTGGCCCTCCCTGG + Intronic
903767649 1:25744945-25744967 GGTTACACTCTGGTCCCTAAAGG + Intronic
904689350 1:32282208-32282230 GGGTCCTCACTGCTCCTTCCCGG + Intronic
905592480 1:39176481-39176503 GCTTCCACTCTCCTCCTTTTAGG + Intronic
907848500 1:58231462-58231484 GGTTCCACTCTGCCACATAAGGG + Intronic
910114416 1:83716531-83716553 TGTCCAACTCTGCTGCTTACCGG - Intergenic
911181458 1:94864189-94864211 GTTTCTACTCTGCTCTTTAAAGG - Intronic
919826033 1:201503930-201503952 GGGTCCCCTCTGCTCCTACCTGG + Intronic
920093708 1:203472132-203472154 GGGCCCACACTGCTCCTTCCCGG + Intergenic
924525970 1:244849247-244849269 AGTTCCATTCTGAACCTTACAGG - Intronic
1065424302 10:25583050-25583072 GGCTCCAATCTGCTGCTCACAGG + Intronic
1065472103 10:26092676-26092698 AGTTCCACTCAGCTGCTTGCAGG - Intronic
1068993904 10:63180644-63180666 GGTGCCACTCTACTCCATCCTGG - Intronic
1069776604 10:70930895-70930917 TGTTCCACTCTCCTCCTCACTGG - Intergenic
1070151136 10:73805880-73805902 CGTTCCTCTCAGCACCTTACCGG + Exonic
1072217049 10:93296305-93296327 GGTAGCACCCTGCTCCTTCCTGG - Intergenic
1073100849 10:101005845-101005867 GGTTCCCCTCTGTCCCTTTCTGG + Intronic
1073185051 10:101610903-101610925 GGTTCCTTTCTGCCCCTTCCTGG - Exonic
1074901617 10:117821107-117821129 GGCTCCACTCTGCTCCATTATGG + Intergenic
1075409321 10:122215694-122215716 GGACCCACTCTGCTCCATTCAGG + Intronic
1080661482 11:34299813-34299835 GGCAACACTCTGCTCCTTTCCGG - Intronic
1083621257 11:64050457-64050479 GCTTCCACTCTGCCCCTTCCTGG + Intronic
1086364189 11:86091645-86091667 GCTTCCACTTTGCTCTTTCCTGG + Intergenic
1089375043 11:117988241-117988263 GTGCCCACTCTGCCCCTTACGGG + Intronic
1090797346 11:130146457-130146479 GGCTCCACTCTGCTCCCTGGTGG + Intergenic
1095907117 12:47389869-47389891 GGTGCCACTGTGCTCCAGACTGG - Intergenic
1101102270 12:101406327-101406349 TGTCCCACTATCCTCCTTACTGG - Intronic
1103905031 12:124322727-124322749 GGTTCCACTCTGCTCCAGAAGGG + Intergenic
1104253700 12:127121589-127121611 GGTTTCTCTCTGCTCATTATAGG + Intergenic
1105414417 13:20196358-20196380 GGCTCCACTGTGCTCCTTTGTGG + Intergenic
1106504563 13:30360032-30360054 GATTCCACCCTACTCCTTCCTGG - Intergenic
1112585435 13:100715185-100715207 GGCTCCTCTCTGCTCTTTCCTGG - Intergenic
1114331178 14:21638383-21638405 GGTGCCACTGTACTCCTTCCTGG + Intergenic
1114615667 14:24066979-24067001 GGCTCCTCTCTGCACCTTGCTGG + Intronic
1117524689 14:56586399-56586421 GGTTTCACTCTGCTCCGTTATGG + Intronic
1121636402 14:95456708-95456730 GATTCCACACTTCTCCTCACGGG + Intronic
1122172916 14:99891472-99891494 CATTCCACTCTCCTCCTTACTGG - Intronic
1127747223 15:61990877-61990899 AATTCCACTCTGCTACTTAATGG - Intronic
1127796626 15:62443942-62443964 TGTGCCACTCTGCTCCTGCCTGG + Intronic
1127825774 15:62701677-62701699 GGGTCAACTCTGCTCCTGAAAGG - Intronic
1128794360 15:70454098-70454120 GGGTCCACCCTGCCCCTTGCAGG - Intergenic
1132372130 15:101306518-101306540 GGCTCCACCCTGCTGCTTGCTGG + Intronic
1133339156 16:5025588-5025610 GGTTCCTCTCTGCTCTGGACAGG + Exonic
1135929042 16:26721126-26721148 GTTTCCCCTCATCTCCTTACGGG + Intergenic
1137506851 16:49061493-49061515 GGTTCCGCTCTGCTGCCTGCTGG + Intergenic
1138659049 16:58507175-58507197 TGTTCCCCTCTGCCCCTCACAGG - Intronic
1148332906 17:46822566-46822588 GGTCCCACTCCGCTCCCTGCGGG + Intronic
1149765474 17:59273481-59273503 AATTCCACTTTGTTCCTTACAGG - Intronic
1151871809 17:76841704-76841726 GGTTCCACTCTGCTCCTTACTGG + Intergenic
1156529102 18:37797745-37797767 GGATCCACTCTGCTCCATCTGGG + Intergenic
1165893362 19:39127673-39127695 GGTTCCACTCTGCTCCCACCAGG - Intronic
1166001018 19:39877578-39877600 GGTTTCACTCTGGTCCTTCTGGG - Intronic
1166003801 19:39893837-39893859 GGTTTCACTCTGGTCCTTCTGGG - Intronic
1166171911 19:41033797-41033819 GGTGTCAATCTGCCCCTTACTGG - Intergenic
1166312262 19:41969580-41969602 GCTTCCTCTCTCCTCCTTCCAGG - Exonic
1167399327 19:49254574-49254596 GGTGCCACTCAGCTCCTTTAGGG + Intergenic
925639647 2:5975117-5975139 GGGTCCACTCTGCTTTTAACAGG + Intergenic
926907853 2:17822682-17822704 AGTTCCACACTGCTGTTTACTGG - Intergenic
930271013 2:49256853-49256875 GATTGCACTCTGCTCCTTGAAGG - Intergenic
931943772 2:67282613-67282635 GGTTCCAGGCTACTCCTCACAGG - Intergenic
936648992 2:114404710-114404732 AATCCCACTGTGCTCCTTACAGG - Intergenic
937927973 2:127182540-127182562 GGTGCCACTGTGCTCCATCCCGG + Intergenic
938069184 2:128299603-128299625 AGATCCACTGTGCTCCTCACCGG - Intronic
942124334 2:172808819-172808841 TTTTCCACTCTGCTGCTTCCAGG + Intronic
1173173825 20:40748845-40748867 TGTTCCCCTCTGCTCCTTTCTGG - Intergenic
1173551440 20:43935622-43935644 AGATCCACTCTGCTTCTTACAGG - Intronic
1178511322 21:33207267-33207289 GGTTCAACACTGCTTCTTCCAGG + Intergenic
1184903952 22:47466188-47466210 GGTTCCACTCTGCTCCTTACTGG + Intronic
950099102 3:10346311-10346333 GGTTACAGTGGGCTCCTTACTGG + Intronic
950941606 3:16898565-16898587 CGTTCTACTGGGCTCCTTACTGG + Intronic
956251607 3:67239862-67239884 GGTTCCACTGTGCTCCAGTCTGG - Intergenic
957291170 3:78280177-78280199 AGTTCCACTCTACTCCTTCCTGG - Intergenic
960151054 3:114249272-114249294 GGTTCCTCTCTGCTTCTTGAGGG - Intergenic
961709203 3:128814135-128814157 GGTTCAACCCTCCACCTTACAGG - Exonic
964726393 3:159818475-159818497 GGCTCCACACTGCCCCTTCCTGG - Intronic
969093712 4:4716857-4716879 GGTTCCACTCTATTCCTTGGAGG + Intergenic
970114093 4:12673547-12673569 GTCTCCACTGTGCTCCTTGCTGG + Intergenic
972626762 4:40807076-40807098 TCTTCCACTGTGCTCCTTAAAGG + Exonic
978392932 4:108246483-108246505 GGTTCTACTCTCCTCCATGCTGG - Intergenic
978639438 4:110852261-110852283 GGTACCACTCTGCTCATGATAGG + Intergenic
979568156 4:122180543-122180565 GGTTCCAATCTACTTCTTGCTGG - Intronic
980225157 4:129974057-129974079 TGTTCTACTCAGGTCCTTACTGG + Intergenic
980832580 4:138149855-138149877 GTTTCAACTCTGCTCCCTAAAGG - Intergenic
981846069 4:149171150-149171172 GGTTTTACTCTGCTTCTTGCTGG + Intergenic
981924087 4:150118671-150118693 GATCCCACTCTGCTTCTTAAAGG + Intronic
982416231 4:155135621-155135643 GACTTCACTCTTCTCCTTACAGG - Intergenic
986754452 5:10822805-10822827 GGTTCCATTCTTTTCCATACTGG + Intergenic
987433290 5:17862981-17863003 GGTACCACTCTGGTCCTCAGTGG + Intergenic
991419371 5:66425900-66425922 TGCTCCACTCTGCTCCTTCTTGG - Intergenic
991531603 5:67621329-67621351 GATGTCACTCTGCTACTTACTGG - Intergenic
997104248 5:131000442-131000464 GTTTCAACTCTGCTCCCTAAAGG + Intergenic
997829162 5:137134103-137134125 GGTTCTAATCTTCCCCTTACTGG + Intronic
1000650961 5:163818115-163818137 GGTTCCAGGCTTTTCCTTACAGG + Intergenic
1001827058 5:174753462-174753484 GCTTCGTCTCTGCTCTTTACTGG - Intergenic
1001926691 5:175642307-175642329 GGTCCCGCTCTGCCACTTACTGG - Intergenic
1001945088 5:175772113-175772135 AGTTCCCCTCTCCTCCTTAGAGG + Intergenic
1004286855 6:14329264-14329286 TGTCACACTCAGCTCCTTACTGG - Intergenic
1005805824 6:29473587-29473609 TGTTTCACTCTGCTCATTCCAGG - Intergenic
1010795600 6:80113564-80113586 TTTTCCTCTCTGCTCCATACAGG - Intronic
1012593984 6:101019333-101019355 GTTTCCACACTGATCATTACAGG + Intergenic
1013220469 6:108073641-108073663 AGTTCCACTCTGCTTATTAGCGG - Intronic
1014250246 6:119108311-119108333 GGTTCCACTCTGCTCCAGACAGG - Intronic
1014282347 6:119455792-119455814 GATTTCTCCCTGCTCCTTACTGG + Intergenic
1015153914 6:130069162-130069184 GTTTCCACTCTGCTCCTCAAGGG - Intronic
1016988980 6:149916507-149916529 GAGTCCACTCTGCTCCTGGCAGG + Intergenic
1017004325 6:150019400-150019422 GAGTCCACTCTGCTCCTGGCAGG + Intronic
1017038550 6:150288923-150288945 GGTTCCACTGTGCTCCAGCCTGG - Intergenic
1017375112 6:153760005-153760027 TGTTCCACTCTGCTTCATGCAGG - Intergenic
1018170683 6:161140757-161140779 GGTTCAGCTCTGCTCCCTGCAGG - Intronic
1018929102 6:168228398-168228420 GGCTCCCCTCTGCTCATTGCTGG - Intergenic
1021187706 7:17584720-17584742 GGTTTCACTCTGCCACTAACTGG - Intergenic
1022029747 7:26481392-26481414 GGCTCCACTCTCCTCCCTCCAGG + Intergenic
1022458337 7:30579164-30579186 TTTTCCTCTCTGCTCCTTACAGG - Intergenic
1022573652 7:31476973-31476995 GGTCTCTCTCTGCTCCTTATTGG - Intergenic
1023545249 7:41311771-41311793 GTACCCTCTCTGCTCCTTACTGG - Intergenic
1032437533 7:131912422-131912444 AGTTCCATTCTGCTGCTTAGTGG - Intergenic
1037032944 8:14131289-14131311 GGTTCCAAGCTGATCCTGACAGG - Intronic
1039250646 8:35660634-35660656 GGTACAACTCTGCTCCTCTCTGG - Intronic
1039415328 8:37388934-37388956 GGTTCAGCTCTGCCACTTACCGG + Intergenic
1039897905 8:41729432-41729454 GGTGCCACTGTGCTCCTGCCTGG - Intronic
1043230000 8:77789047-77789069 GGATCCCCTCTGCTCCTGGCTGG + Intergenic
1044842097 8:96345243-96345265 GGATCCAGCCAGCTCCTTACGGG - Intergenic
1046711815 8:117519284-117519306 GGTTCCACACTGCTCCCTTCAGG + Intergenic
1049108901 8:140630572-140630594 GGTTGCTCTCTCCTCCTCACTGG - Intronic
1052240407 9:26265484-26265506 GGTTCCTCTCTGCTCTTAGCAGG - Intergenic
1060371033 9:123071690-123071712 TTTTCCAGGCTGCTCCTTACAGG - Intronic
1061818784 9:133211201-133211223 GCTCCCACTCTGCTCCTTCTTGG - Intergenic
1062706463 9:137946790-137946812 TTTTCCTCTCTGCTCCATACAGG - Intronic
1187387207 X:18859899-18859921 GGTTCCACTCAGCTGGTTAGTGG - Intergenic
1190031509 X:46977722-46977744 GGTTACCCTCTTCCCCTTACAGG - Intronic
1192923540 X:75733452-75733474 TGATCCACACTTCTCCTTACTGG - Intergenic
1198923994 X:141766455-141766477 GTTTTCACTCTTCTCCTTAAAGG + Intergenic