ID: 1151875702

View in Genome Browser
Species Human (GRCh38)
Location 17:76867185-76867207
Sequence CTGGCTAAGGAGATGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151875702_1151875708 2 Left 1151875702 17:76867185-76867207 CCCTCCAACATCTCCTTAGCCAG No data
Right 1151875708 17:76867210-76867232 TGCCACGATGCCCAAATTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151875702 Original CRISPR CTGGCTAAGGAGATGTTGGA GGG (reversed) Intergenic
No off target data available for this crispr