ID: 1151876437

View in Genome Browser
Species Human (GRCh38)
Location 17:76870050-76870072
Sequence CTGTGGCCACGTCCCGAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151876437_1151876453 25 Left 1151876437 17:76870050-76870072 CCGGACTCGGGACGTGGCCACAG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1151876453 17:76870098-76870120 CCGAGAAGGCGGAGCTTGCAGGG 0: 1
1: 1
2: 91
3: 545
4: 1604
1151876437_1151876449 14 Left 1151876437 17:76870050-76870072 CCGGACTCGGGACGTGGCCACAG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1151876449 17:76870087-76870109 CGGGAAGGAGCCCGAGAAGGCGG 0: 1
1: 0
2: 0
3: 33
4: 352
1151876437_1151876448 11 Left 1151876437 17:76870050-76870072 CCGGACTCGGGACGTGGCCACAG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1151876448 17:76870084-76870106 GCGCGGGAAGGAGCCCGAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 206
1151876437_1151876444 -6 Left 1151876437 17:76870050-76870072 CCGGACTCGGGACGTGGCCACAG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1151876444 17:76870067-76870089 CCACAGGTGGGCTCCGGGCGCGG 0: 1
1: 0
2: 1
3: 16
4: 201
1151876437_1151876445 -5 Left 1151876437 17:76870050-76870072 CCGGACTCGGGACGTGGCCACAG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1151876445 17:76870068-76870090 CACAGGTGGGCTCCGGGCGCGGG 0: 1
1: 0
2: 2
3: 18
4: 209
1151876437_1151876451 24 Left 1151876437 17:76870050-76870072 CCGGACTCGGGACGTGGCCACAG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1151876451 17:76870097-76870119 CCCGAGAAGGCGGAGCTTGCAGG 0: 1
1: 0
2: 3
3: 101
4: 733
1151876437_1151876446 -1 Left 1151876437 17:76870050-76870072 CCGGACTCGGGACGTGGCCACAG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1151876446 17:76870072-76870094 GGTGGGCTCCGGGCGCGGGAAGG 0: 1
1: 0
2: 0
3: 32
4: 306
1151876437_1151876454 26 Left 1151876437 17:76870050-76870072 CCGGACTCGGGACGTGGCCACAG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1151876454 17:76870099-76870121 CGAGAAGGCGGAGCTTGCAGGGG 0: 1
1: 4
2: 104
3: 780
4: 2318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151876437 Original CRISPR CTGTGGCCACGTCCCGAGTC CGG (reversed) Intronic
900313994 1:2048148-2048170 CTGTGGCCTTGTCTGGAGTCTGG - Intergenic
900997692 1:6131264-6131286 CTGGGGCCACTTCCAGAGGCAGG - Intronic
901633274 1:10658235-10658257 CTGTGGCCAGGCCCTGCGTCGGG + Intronic
908510138 1:64844711-64844733 CTCTGGCCCCACCCCGAGTCAGG - Intronic
919369436 1:196705346-196705368 CTGCTGCCATGTCCTGAGTCTGG - Intronic
919382004 1:196871393-196871415 CTGCTGCCATGTCCTGAGTCTGG - Intronic
920506543 1:206519068-206519090 GTCTGGCCACTTCCCGAGGCCGG - Intronic
1063161507 10:3421935-3421957 CGGTGGCCACGTCCACAGCCCGG - Intergenic
1067349548 10:45463471-45463493 GTGAGGCCACGTCCCGAAGCCGG - Exonic
1069738992 10:70675491-70675513 CTGTGCCCACGCCACGAGCCAGG - Intronic
1075644703 10:124090018-124090040 CTGCGGCCAGGTCCCTAGGCTGG - Intronic
1076683862 10:132187931-132187953 CCGAGGCCAAGTCCAGAGTCGGG - Intronic
1076870211 10:133189272-133189294 CACAGGCCCCGTCCCGAGTCAGG - Intronic
1077330598 11:1982367-1982389 CTGTGGCCCCTTCCCGACCCTGG - Intronic
1083267002 11:61551402-61551424 CTGCGCCCACGCCCTGAGTCTGG + Exonic
1085295618 11:75430089-75430111 CTGCGGCCGCGTCCTGCGTCAGG - Exonic
1202813576 11_KI270721v1_random:37546-37568 CTGTGGCCCCTTCCCGACCCTGG - Intergenic
1095876110 12:47080616-47080638 CTGTTGCCGCCTCCTGAGTCAGG - Intronic
1101498679 12:105280497-105280519 CTGTGGCCACATCCCACCTCTGG + Intronic
1102569427 12:113818482-113818504 CTGGGCCCACGTCCAGAGGCTGG - Intronic
1112374224 13:98823955-98823977 CTATGACCAGGACCCGAGTCTGG + Intronic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1121426582 14:93856552-93856574 CTGTCCCCATGTCCCGAGTCTGG - Intergenic
1133188071 16:4114832-4114854 CTGTCGCCGCGTCCTGAGACAGG + Exonic
1136181248 16:28554089-28554111 CCGTCGCCACCTACCGAGTCCGG - Exonic
1141100905 16:81196888-81196910 CTGTGGCCACCTCCCCTGGCTGG + Intergenic
1141787410 16:86211039-86211061 CTGCGGCCACCTCCTGAGCCAGG + Intergenic
1142317933 16:89360927-89360949 CAGTGGCCAAGTCCCGACACAGG - Intronic
1147744013 17:42684106-42684128 GTGTGGCCACGGCCCGGATCCGG - Exonic
1149536576 17:57438175-57438197 CTCTGGGCACGTCCCCAGCCAGG - Intronic
1151876437 17:76870050-76870072 CTGTGGCCACGTCCCGAGTCCGG - Intronic
1152288455 17:79425459-79425481 CTGTGGACACGGCTCCAGTCCGG - Intronic
1162100286 19:8334911-8334933 CGGCGGCCACCTCCCGGGTCTGG + Exonic
1162997991 19:14348559-14348581 CTTTAGCCCCGTCCCGGGTCTGG - Intergenic
1163112502 19:15170127-15170149 CTGTGGCCACCTCCCCCATCAGG + Exonic
1168508510 19:56955900-56955922 CTGAGGCCACGTCCAGTGTCTGG + Intergenic
935676729 2:105600789-105600811 CTCTGGCCAAGACCGGAGTCAGG + Intergenic
940509408 2:154593524-154593546 CTGTGGCCACACCCAGAGGCTGG + Intergenic
946172665 2:217904801-217904823 CTGTCCCCACATCCCCAGTCTGG - Intronic
1168730916 20:79992-80014 CTGTGGCCAGGGCCTGAGTAGGG + Intergenic
1172884023 20:38219541-38219563 CTCTGGGCCCGTCCCTAGTCAGG - Intronic
1173221117 20:41134007-41134029 CTGTGCCCATGCCCAGAGTCTGG - Intergenic
1175407739 20:58745717-58745739 CTGTGGCCACCTCATGAGACAGG - Intergenic
1178829615 21:36044977-36044999 CTGTGACCACCTCCCAAATCAGG + Intronic
1178983489 21:37284122-37284144 CAGTGGCCAGGTCCCCACTCTGG + Intergenic
1180087705 21:45515495-45515517 CTGTGGCCACCGCCAGAGTGCGG + Exonic
1180115986 21:45705357-45705379 CTGTGCCCACATCTCCAGTCTGG - Intronic
1181043798 22:20205227-20205249 CTGTGACCCCGTCCTGAGTGGGG - Intergenic
1181431977 22:22887488-22887510 CTGTGGCCCTTTCCTGAGTCAGG - Intronic
1183081903 22:35462224-35462246 CAGTGGCCAGGGCCCGAGGCGGG - Intergenic
1183466748 22:37983922-37983944 CTGTGCCCACGTCCTGTCTCGGG - Intronic
955345979 3:58162169-58162191 CTGTGGAGACGTCCAGAGGCAGG + Intronic
967043057 3:185711644-185711666 CTGTGGCCACCTGCTGAGCCAGG - Intronic
968457248 4:706022-706044 CTGCGGCCTCGGCCCGTGTCCGG + Intronic
968516346 4:1017177-1017199 CCGTGGCCAGGTCCTGGGTCAGG + Intronic
969425032 4:7119184-7119206 ATTTGGCAACGTCCTGAGTCTGG + Intergenic
972543006 4:40056161-40056183 CAGCGGCCACGGCCCTAGTCAGG + Intergenic
982235609 4:153248988-153249010 CTGTGGCCTTTTCCCGTGTCCGG - Intronic
986984302 5:13482664-13482686 CTGTGCCCACTCCCCGAGTGAGG - Intergenic
991090589 5:62690464-62690486 CTGTGGCCACTTTAGGAGTCAGG - Intergenic
1001114539 5:168928480-168928502 CTGGGGCCAAGTCCCAGGTCAGG + Intronic
1001652005 5:173322674-173322696 CTGGAGCCAGGTCCCAAGTCTGG + Intronic
1002172359 5:177382521-177382543 CTGTGGCCACCTCCCTGGACTGG - Intronic
1003683410 6:8277909-8277931 CAGTGGCCAGGCCCCGCGTCAGG + Intergenic
1005682478 6:28220325-28220347 CTCTGGCCACATCCAGAGACAGG + Intergenic
1006640628 6:35487936-35487958 CAGTGTCCACATCCCCAGTCAGG + Intronic
1012887240 6:104859786-104859808 CTGGGGCCACGTCCTGCGTCCGG + Exonic
1020438002 7:8186475-8186497 CTGTGGCCACTTCCCTGCTCAGG - Intronic
1025021724 7:55485685-55485707 CTGTGTGCACGTCCCGTGTGCGG - Intronic
1033175907 7:139123546-139123568 CTGTGGCCACATCCTAAGCCAGG + Intergenic
1035257609 7:157641610-157641632 ATGGTGCCACGTCCAGAGTCTGG - Intronic
1042612527 8:70614482-70614504 CTGTGGCCACTGCCTGTGTCAGG + Intronic
1053294212 9:36901381-36901403 CGGGGGCCACTTCCCGAGGCTGG - Intronic
1057064267 9:92033965-92033987 CTGAGGCCAGGTGCCAAGTCAGG - Intronic
1062139956 9:134950518-134950540 CTGAGGCCAGGTTCCGACTCTGG + Intergenic
1062574140 9:137198784-137198806 CTGTCCCCACGGCCCAAGTCAGG + Intronic