ID: 1151879214

View in Genome Browser
Species Human (GRCh38)
Location 17:76885114-76885136
Sequence CAGTGAGGCCGTGGTGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 377}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151879214 Original CRISPR CAGTGAGGCCGTGGTGGAGA TGG Intronic
901019746 1:6249674-6249696 CAGCGAGGCCGAGGCGGAGCGGG + Exonic
901712793 1:11128887-11128909 CAATGAGGCCTTAGTGGAGGGGG - Exonic
902624921 1:17671066-17671088 CAGTGAGGCGCCGGTGCAGACGG - Intronic
902760123 1:18575580-18575602 CAGTGAGTCCGTGGGGGCGAGGG - Intergenic
903140872 1:21338503-21338525 CAGTGAGGAAGTGGTGGGGCTGG + Intronic
904768539 1:32868796-32868818 GAGTGTGGCAGTGGTGGTGATGG - Intronic
904849652 1:33447738-33447760 CAGAGAGGCCTCTGTGGAGAGGG + Intergenic
904905902 1:33896992-33897014 CACAGAGGCCGTGGTGGAGGGGG + Intronic
904940429 1:34162240-34162262 CAGGGAGGCTGGGGTGGGGAGGG + Intronic
905304844 1:37010445-37010467 CAGTCAGGAAGTGGTGGAGCCGG + Intronic
905893271 1:41530164-41530186 CAGGGCAGCCATGGTGGAGAAGG - Intronic
906214676 1:44031714-44031736 CAGCGAGGCAGGGGCGGAGAAGG - Intergenic
906233694 1:44188998-44189020 CAGTGAGTATGTGGTGGTGATGG - Intergenic
907731235 1:57068045-57068067 CAGTGGGGGCGGGGTGGGGAGGG - Intronic
909892505 1:81025333-81025355 CAGTGAGGTCATACTGGAGAGGG - Intergenic
912510918 1:110189676-110189698 CAGTGAGGACGAGGTGGGGGTGG - Intronic
914502384 1:148258582-148258604 CAGTGAGACCGTGGCTGAAAAGG + Intergenic
915174149 1:154000880-154000902 AAGTGAGGCAGTGGTAGTGAGGG - Exonic
916256673 1:162794926-162794948 CAGTGAGGCTGTGGGGCAGAAGG + Intronic
917727160 1:177839019-177839041 CAGTATGTCCATGGTGGAGAGGG + Intergenic
918125546 1:181580440-181580462 CAGAGAGGCCAGGGAGGAGAGGG + Intronic
918857891 1:189782023-189782045 CAGTCTGGCAGTGGTGGAGTAGG - Intergenic
922596841 1:226820403-226820425 CAGGGAGCCCGTGGTTGAGAAGG + Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
924482631 1:244451301-244451323 GACTGAGGCCGGGGTGGAGGTGG - Intronic
924624328 1:245687095-245687117 CAGATTGGCCGTGTTGGAGATGG - Exonic
1064418887 10:15173320-15173342 CAGTGAGGCTATGGTGTGGAAGG - Intergenic
1064582496 10:16808518-16808540 CACTCAGGCAGTGGTGGAAACGG - Intronic
1064651724 10:17516364-17516386 CTGTTAGGCCTTGGTGAAGATGG - Intergenic
1065963020 10:30749653-30749675 CACTCAGGCAGTGGTGGAGCAGG - Intergenic
1066723134 10:38360583-38360605 CAGTGAGGCTGTGGGGCAGAAGG + Intergenic
1067303472 10:45036086-45036108 CAGTGAAGTTGTGGTTGAGAGGG + Intergenic
1068594687 10:58889988-58890010 TAGTGAGCCCGTGGTGGACTAGG - Intergenic
1069534349 10:69241915-69241937 CAGAGAGGTCGTGGTGCAGTGGG + Intronic
1069781764 10:70961388-70961410 CAGGGAGGCAGAGGCGGAGAGGG + Intergenic
1069784438 10:70978842-70978864 CAGGGAGGCTGCGGAGGAGAAGG - Intergenic
1069928331 10:71866319-71866341 CAGCTAGTCCATGGTGGAGATGG - Intergenic
1070216965 10:74395262-74395284 GAGCAAGGTCGTGGTGGAGAGGG - Intronic
1070641260 10:78171975-78171997 CAGGGAAGCCGGGGTTGAGAAGG - Intergenic
1070850145 10:79556866-79556888 CAGTGAGGCCTTGGGGTAGAAGG - Exonic
1070854392 10:79594946-79594968 CAGTGAGGTCTTGGGGTAGAAGG - Intergenic
1070857077 10:79614434-79614456 CAGTGAGGTCTTGGGGTAGAAGG + Exonic
1073571068 10:104581565-104581587 TAGAGTGGCCTTGGTGGAGATGG + Intergenic
1073580791 10:104663893-104663915 CAGAGAGGCCGGGGTGGGGAAGG - Intronic
1074054896 10:109914410-109914432 CAGAGTGGTGGTGGTGGAGAAGG - Intronic
1074346665 10:112692880-112692902 CAGTGAGTCCCTGGAGGACAGGG + Intronic
1076994883 11:292996-293018 GGGTGAGGCCATGGTGGGGAGGG + Exonic
1077635181 11:3837283-3837305 CAGTGAGGCAGAGCTGGAGTAGG + Intronic
1078431664 11:11292939-11292961 CAGGGAGGTGGTGGAGGAGAGGG - Intronic
1078664422 11:13312965-13312987 CAGTGAGACCGGGGTGGAGAGGG + Intronic
1079383165 11:19956807-19956829 CAGTAAGGCGGGGATGGAGATGG - Intronic
1079528640 11:21421572-21421594 ACGTGAGGGGGTGGTGGAGAAGG - Intronic
1083792639 11:64995806-64995828 CAGTGAGCCCGCTGTGGACATGG - Intronic
1083896637 11:65623422-65623444 CAGTGGGGCAGTGGGGAAGATGG - Intronic
1084176216 11:67423716-67423738 GAGTGAGGCTGATGTGGAGAGGG + Exonic
1084563280 11:69915820-69915842 CAGTGAGGTGGGGGTGGGGAGGG + Intergenic
1085031344 11:73272682-73272704 CAGTGGGGGCGGGGAGGAGATGG + Intronic
1086330639 11:85750406-85750428 CAGTGAGGCAGTGTTTGAGCTGG - Intronic
1088601243 11:111478111-111478133 CAGGGAGGTGGTGGTGGTGATGG - Intronic
1088974403 11:114802973-114802995 CAGAGAGGCCGTGGTGAAGCAGG + Intergenic
1089215484 11:116832180-116832202 CAGTCAGGGTGAGGTGGAGAAGG - Intronic
1089401369 11:118166493-118166515 CAGAGAGGACCTGGTGGGGAGGG - Exonic
1090540125 11:127692750-127692772 CAACGAGGCTGTGGTTGAGATGG - Intergenic
1090798659 11:130156814-130156836 CAGTGAGGGGGTGGTGGAGAAGG + Intergenic
1090941318 11:131390577-131390599 GATTGAGGTCGGGGTGGAGAAGG + Intronic
1090990491 11:131812759-131812781 AAGGGAGGCCGAAGTGGAGAGGG + Intronic
1091319122 11:134637333-134637355 CAGAGAGGCTGTGGTGGGGGAGG + Intergenic
1091337935 11:134786372-134786394 CAGTGAGGCAGTGGCGTAAATGG - Intergenic
1091670613 12:2449648-2449670 CTGTGTGGGAGTGGTGGAGAGGG - Intronic
1091691820 12:2602251-2602273 CACTGGGGCCGTGGTGGAGGAGG - Intronic
1092725381 12:11480447-11480469 CAGAGTGGGGGTGGTGGAGAAGG - Intronic
1092750996 12:11719129-11719151 TAGTGAGGCCGCTGGGGAGAGGG + Intronic
1094032926 12:26034036-26034058 CAGGGAGGTGGTGGTGGAGTGGG + Intronic
1095359967 12:41325581-41325603 CAGTGAGGCCCTTCTAGAGAAGG + Intronic
1095983404 12:47985074-47985096 CAGGGAGCCCCTGGTGAAGATGG - Exonic
1096183214 12:49562413-49562435 CAGTGAGGCCCTTGGGGAAAGGG + Intronic
1097647133 12:62249862-62249884 CTGTGAGGCACAGGTGGAGAGGG - Intronic
1097980038 12:65729138-65729160 CACCGAGGCCGTCCTGGAGATGG - Intergenic
1100404526 12:94262124-94262146 CAGTGAGACTGTGGTGGGGCAGG - Intronic
1101582000 12:106049896-106049918 CAGTGAGGCCATGGTGATAACGG - Intergenic
1102247151 12:111362799-111362821 CGGCGAGGCGGTGGTGGAGGGGG + Exonic
1103953265 12:124563504-124563526 CAGTGAGGCCCTGGGGCAGATGG - Intronic
1104448102 12:128848955-128848977 CAGTGAGGCAGTGGGGAAAATGG - Intergenic
1104647407 12:130506985-130507007 CACTGAGGCTGTGGTGGAGGTGG - Intronic
1104894560 12:132155522-132155544 CAGTGTGGACTTGGTGGGGACGG + Intergenic
1105209179 13:18247805-18247827 GGATGAGGGCGTGGTGGAGAGGG - Intergenic
1106395772 13:29379517-29379539 CACTGTGGCCGTGGTGTAAAAGG + Intronic
1106755439 13:32818529-32818551 CAGTGAGGATGTGGAGGAAAGGG + Intergenic
1108813301 13:54257642-54257664 CAGTGTGGAAGTGGAGGAGAAGG - Intergenic
1109224366 13:59674672-59674694 TAGGGAGGCCATGGTGGATACGG - Intronic
1112284335 13:98090647-98090669 CTGAGAGGCAGTGGTGGTGATGG + Intergenic
1113501216 13:110775915-110775937 CAGAGATGCCGTGGTGGAGGTGG - Intergenic
1113522494 13:110950671-110950693 CCGTGAGGCCGAGGCTGAGATGG - Intergenic
1113618605 13:111698173-111698195 CAGGGAGGCTGTGGTGTTGATGG + Intergenic
1113624134 13:111783434-111783456 CAGGGAGGCTGTGGTGTTGATGG + Intergenic
1113965873 13:114153551-114153573 GAGTGATGCAGTGATGGAGATGG - Intergenic
1114835959 14:26203445-26203467 CAGTGAGGCAGAGGTTGAGATGG - Intergenic
1115618319 14:35117546-35117568 CAGTGAGGCTGAAGTGGAAATGG - Intronic
1116686039 14:48040183-48040205 CGGTGAGGCTTTGCTGGAGATGG + Intergenic
1118134675 14:63010374-63010396 GAGTGAGGCTGGGGTGGGGAAGG - Intronic
1118321880 14:64758144-64758166 CAGGGAGGCAGGGGTGGATAGGG - Intronic
1118351701 14:64976810-64976832 CAGTGTGGCTGGGGTGGGGATGG - Intronic
1118398147 14:65355072-65355094 CAGTGAGAGAGTGGTGGAGCGGG - Intergenic
1118851806 14:69589669-69589691 TAGGGAGGCAGTGGAGGAGAGGG + Intergenic
1121618534 14:95330504-95330526 CAGGGAGGAAGTGGTGGAGCTGG - Intergenic
1121780637 14:96619621-96619643 CTGGGAGGCCGGGGTGGAGGCGG + Intergenic
1122416967 14:101554668-101554690 CAGTGAGGATGTGGTGGCGTGGG + Intergenic
1123386288 15:19809875-19809897 CACTGAGGCCATGGTGGAAAAGG - Intergenic
1124593180 15:31071230-31071252 GAGTGATGCCTTGGTGGAGATGG + Intronic
1125293599 15:38177178-38177200 CTGGGAGGGAGTGGTGGAGAAGG - Intergenic
1125475970 15:40048256-40048278 CAGTGAAGCGGGGGTGGGGAGGG + Intergenic
1125732402 15:41900574-41900596 CGGTGAGTCAGTGGTGGAGCAGG + Exonic
1125920737 15:43524154-43524176 CAGTGAGGAGGTGGGTGAGATGG - Exonic
1126113623 15:45189339-45189361 CACTGAGGCAGTGGGGGAAAGGG - Intronic
1126144664 15:45463712-45463734 CAGTGTGGTGGTGGTGGTGATGG - Intergenic
1126404826 15:48313287-48313309 CAGAGAGGCAGAAGTGGAGATGG - Intergenic
1127797481 15:62451211-62451233 CAGTGGGGCTGTGGTGCACACGG - Intronic
1128235802 15:66066333-66066355 CAGTGGGGAGGTGGTGGGGAGGG - Intronic
1128596546 15:68956919-68956941 CTGTAAGGGCGTGTTGGAGAAGG - Intronic
1129767367 15:78178869-78178891 CAGTGGGGGCTTGGAGGAGACGG - Intronic
1130024874 15:80262260-80262282 GAGGGAGGCAGTGGGGGAGAGGG + Intergenic
1131158321 15:90088567-90088589 CAGGTAGGCCAGGGTGGAGAGGG - Exonic
1132611864 16:821078-821100 CAGTGGGGTTGTGGTGGTGAAGG - Intergenic
1132753136 16:1468172-1468194 CAGTGCTGTCGTGGTGTAGACGG - Intronic
1132849271 16:2017200-2017222 CAGTGTGGCCTTCCTGGAGAGGG + Intronic
1134439410 16:14288902-14288924 CAGACAGGCTATGGTGGAGATGG - Intergenic
1136344630 16:29666767-29666789 CTGTGGGGCCTGGGTGGAGAGGG + Exonic
1136458988 16:30398369-30398391 GAGTGAGGCGGTGGCGAAGAAGG - Exonic
1136994674 16:35181561-35181583 CAGTGAGGCCAACTTGGAGAGGG - Intergenic
1137454145 16:48605388-48605410 CTGTGAAGCAGTGGTGGAAAGGG - Intronic
1137733758 16:50709368-50709390 CAGTGAGGCTGTGATGGCGGGGG + Intronic
1138050028 16:53766649-53766671 CAAAGAGGCTGTTGTGGAGAGGG + Intronic
1139593544 16:67945959-67945981 CCTTGAGGCCGAGGTGGAGGTGG - Exonic
1142226017 16:88877980-88878002 CAGTGAGGGCGAGGTGGGGTGGG - Intronic
1142594605 17:1023373-1023395 CAGGGAGGCAGTGGTGGGGTGGG - Intronic
1142613263 17:1120827-1120849 CAGTGAGACAGTGGTAGAGTGGG + Intronic
1142983627 17:3685461-3685483 CAGTGCGGCCGCCGGGGAGAGGG + Intronic
1143699091 17:8644395-8644417 CAGAGAGGCCCTGGCAGAGAAGG - Intergenic
1144465827 17:15496442-15496464 CAGTGGGGCAGGGGTGGAGTGGG - Intronic
1144782093 17:17813513-17813535 GAGTCAGGCAGTGGTGGAGATGG - Intronic
1145066016 17:19761953-19761975 CACTGAGGCCGAGGAGGAGGAGG - Intergenic
1146655448 17:34632208-34632230 CAGAGAGGCCGTGGAGGACATGG + Intronic
1146712283 17:35052765-35052787 CAGTGAGGCCATGGTCTAGTAGG + Intronic
1146910380 17:36644787-36644809 CAGGAAGGCAGTGGTGGAAAGGG + Intergenic
1147424880 17:40341764-40341786 GAGCGAAGCCGTGGTGGAGGAGG - Intronic
1147668239 17:42162274-42162296 CAGTGAGGCTGAGGAGGTGAAGG - Exonic
1148149786 17:45389767-45389789 CAGTGAGGCCGTGGTGAGGGAGG + Intergenic
1148438809 17:47701254-47701276 CAGCTAGGCCTTTGTGGAGAGGG + Intronic
1148819246 17:50351006-50351028 CAGAGAGGCCTGGGTGGAGAAGG + Intronic
1148913431 17:50955404-50955426 CAGTGAGGCCGAGGCGGCAAGGG + Intergenic
1149062263 17:52436446-52436468 CAGTGAGTCAGTAGTGAAGATGG - Intergenic
1149302022 17:55314030-55314052 CAGTGAGGAAGAGGGGGAGATGG + Intronic
1149572521 17:57683445-57683467 CAGTGTGGAGGTGGTGGAGGAGG - Exonic
1150320785 17:64212825-64212847 CAGTGAGGACGAGGTGGACTCGG - Exonic
1150342387 17:64378952-64378974 CGGTAAGGCCTGGGTGGAGAAGG - Intronic
1151598724 17:75093605-75093627 CAGTGAGGCCGTGGCAGCGTCGG + Exonic
1151833821 17:76570537-76570559 CAGCCAGGCCGTGGTGGTGTGGG - Intronic
1151879214 17:76885114-76885136 CAGTGAGGCCGTGGTGGAGATGG + Intronic
1152036418 17:77875823-77875845 CAGTGAAGCCGGGGAGGAGGGGG + Intergenic
1152412877 17:80138355-80138377 CAGGGAGACCCTGGTGGAAAAGG + Intronic
1152499487 17:80698301-80698323 CAGTGAGGCCTGGGTGGGGGTGG - Intronic
1152798078 17:82317679-82317701 CAGGGAGGCAGTGCTGGGGAGGG - Intergenic
1153489840 18:5635660-5635682 CAGGGAAGTCATGGTGGAGATGG - Intergenic
1154354057 18:13611389-13611411 CGGGGTGGCCGTGGTGGAAAGGG - Intronic
1155208452 18:23580662-23580684 CAGTGAGGCGATGGAGGAGAGGG + Intronic
1155267037 18:24104325-24104347 CAGTGGGGCAGGGGTGGAGTGGG - Intronic
1157781558 18:50444376-50444398 CAGTGGGGACTTGGTGGAGGGGG + Intergenic
1158154303 18:54408096-54408118 CAGTGATGCCCTGGTGGGAAGGG - Intergenic
1158517592 18:58143669-58143691 CAGAGAGGCCGTGGATGGGATGG + Intronic
1159615037 18:70570345-70570367 GAGGGAGACCGTGGGGGAGAGGG + Intergenic
1159615046 18:70570369-70570391 GAGGGAGACCGTGGGGGAGAGGG + Intergenic
1159615055 18:70570393-70570415 GAGGGAGACCGTGGGGGAGAGGG + Intergenic
1159615064 18:70570417-70570439 GAGGGAGACCGTGGGGGAGAGGG + Intergenic
1159703935 18:71663532-71663554 CAGTGTGGCCATGGAGGTGATGG + Intergenic
1160121795 18:76137206-76137228 CAATGAGGCTGTGTTGGTGAGGG - Intergenic
1160532751 18:79575162-79575184 CAGTGTGACCGTGGTGCAGGTGG + Intergenic
1160744532 19:704384-704406 CAGTGAGGCGGTGGAAGTGAGGG + Intergenic
1160898586 19:1415215-1415237 CAGTGAGGTGGGGGTGGAGGGGG + Intronic
1161205640 19:3039885-3039907 CAGTGACGCAGTGGCGGAGGTGG - Intronic
1161443805 19:4306775-4306797 CGGGGACGCCGTGATGGAGAGGG - Intronic
1161606026 19:5215453-5215475 CTGTGAGGCCGAGGTGATGAGGG + Intronic
1161652902 19:5496263-5496285 CAGACAGGCTGTGATGGAGAGGG + Intergenic
1162864003 19:13530096-13530118 CTGTCAGGCAGTGGTGGGGAAGG + Intronic
1163034675 19:14563842-14563864 CAGTGTGGCCGTGGTGCCCACGG - Exonic
1163126068 19:15244783-15244805 TAGTGAGGCTCTGGGGGAGAAGG + Intronic
1163152711 19:15424592-15424614 CAGTGAGTGCTTGGTGGAGGAGG - Exonic
1163314382 19:16532247-16532269 CAAGGAGGCCGTGGCTGAGAAGG + Intronic
1164547510 19:29181203-29181225 CAGTGAGGGCTTGCTGGAGATGG + Intergenic
1164917493 19:32063702-32063724 CAGTGAGGGAGTGATGGAGAAGG - Intergenic
1166312373 19:41970005-41970027 CAGAGAGGAGGAGGTGGAGAAGG + Intronic
1166393830 19:42424667-42424689 CTGTGAGGCCCTGGTCCAGAGGG - Intronic
1166633723 19:44431017-44431039 CTGTGAGGCAGTGGTGGAGCTGG + Intronic
1166835447 19:45664890-45664912 CAGTGTGACCGTGGGGGTGAGGG + Intergenic
1166941041 19:46365909-46365931 CTGTGAAGCAGCGGTGGAGAAGG + Intronic
925278269 2:2665710-2665732 CAGTGAGGCCTTGGGGAAGGAGG - Intergenic
926978978 2:18546498-18546520 CACTGAGGCCTTTTTGGAGAAGG - Intergenic
926989082 2:18657744-18657766 CAGTGGGGCCGAGGTGCAGGTGG - Intergenic
927468069 2:23351658-23351680 CTGGGAGTCCGTGGTGGGGACGG + Intergenic
929037275 2:37706307-37706329 CAGAGAGGCCCTGGAGGAGGAGG - Intronic
929241816 2:39661227-39661249 CAGTTAGGCCTTGGAGGAAAAGG - Intergenic
931057005 2:58483500-58483522 CAGTGAGGGCCTGGAGGATAGGG - Intergenic
931442455 2:62299884-62299906 GTGAGAGGCCCTGGTGGAGAAGG - Intergenic
931669729 2:64636467-64636489 CAGTGAGGCCGGGGTGAGGCAGG + Exonic
932463220 2:71896765-71896787 CAGTGAGCAGGTGGTGGAGCAGG - Intergenic
933054289 2:77642698-77642720 CAGGCAGGCTGTGATGGAGAGGG + Intergenic
933671247 2:85009472-85009494 CAGTGAGGTCGTGCTGTACAGGG + Intronic
933846030 2:86327972-86327994 CAGGGTGGCAGTGGTGGAGGTGG + Intronic
933983936 2:87575272-87575294 AAGTGGGGCCTGGGTGGAGAGGG - Intergenic
935123002 2:100198575-100198597 CAGGGAGGACGAGGGGGAGAAGG - Intergenic
935936000 2:108183592-108183614 CAGGGAGGCAGTGGAGGAGAAGG - Intergenic
936309919 2:111375524-111375546 AAGTGGGGCCTGGGTGGAGAGGG + Intergenic
939568952 2:143817538-143817560 CTGTGAGGCAGTGGATGAGATGG + Intergenic
941287714 2:163634482-163634504 CAGTTTGGCTGTGGTGTAGATGG - Intronic
942547152 2:177076919-177076941 CAGAGAGCGCCTGGTGGAGAAGG - Intergenic
946027296 2:216679543-216679565 CAGTCAGGGCGTGGACGAGAAGG + Intronic
946354918 2:219178460-219178482 CAGTGAGGCAGAGGAGGAGGCGG + Exonic
946787526 2:223263396-223263418 CTGTGAGGGCCTGGTGGAGGTGG - Intergenic
946879688 2:224164437-224164459 GAGGGAGGACCTGGTGGAGATGG - Intergenic
947035623 2:225851120-225851142 CAGTGTGGCAGAGGTGGAGGAGG + Intergenic
948098794 2:235357729-235357751 TAGTAAGTACGTGGTGGAGAAGG + Intergenic
948369106 2:237475986-237476008 CAGTGAGTCAGGGGTGGAGTAGG - Intergenic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948656033 2:239477075-239477097 GAGGGAGGCGGTGTTGGAGATGG + Intergenic
1170570060 20:17627533-17627555 CATTGAGGCCCTGCTGGAGGCGG - Exonic
1170684738 20:18559230-18559252 CAGTGAGACCGCTGTGGAGATGG + Intronic
1171970250 20:31560155-31560177 CAGTGAGCACGAGGGGGAGAAGG + Intronic
1172033422 20:31996505-31996527 GAGGGAGGCGGAGGTGGAGAGGG - Exonic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1172848730 20:37945233-37945255 CAGTGATGACGTGGGGGAGGTGG + Exonic
1172853792 20:37985485-37985507 CAGGGAGGCAGTGGGGGAGTGGG + Intronic
1175029119 20:55934679-55934701 CAGAGAGGTCGTCATGGAGAAGG + Intergenic
1175390706 20:58625642-58625664 CAGTGAGGCCGGGCTGCAGAGGG - Intergenic
1176177050 20:63733633-63733655 GAGGGAGGCCGTGGTGGAGGGGG + Exonic
1176676885 21:9786940-9786962 CAGTGAGACAGAGGTGTAGAAGG - Intergenic
1179654635 21:42837663-42837685 CAGAGGGGCCCGGGTGGAGAAGG - Intergenic
1179988362 21:44933081-44933103 CAGAGGGGCCCCGGTGGAGAAGG + Intronic
1180003728 21:45008882-45008904 CAGTGGGGCTGTATTGGAGATGG - Intergenic
1180767076 22:18351492-18351514 GGATGAGGGCGTGGTGGAGAGGG + Intergenic
1180779235 22:18510887-18510909 GGATGAGGGCGTGGTGGAGAGGG - Intergenic
1180811954 22:18768207-18768229 GGATGAGGGCGTGGTGGAGAGGG - Intergenic
1180895756 22:19331127-19331149 CCTTGGGGCCGTGCTGGAGACGG + Exonic
1181057627 22:20267639-20267661 CCGTGAGGCTGGGGTGGAGGCGG + Intronic
1181198109 22:21202451-21202473 GGATGAGGGCGTGGTGGAGAGGG - Intergenic
1181401635 22:22653353-22653375 GGATGAGGGCGTGGTGGAGAGGG + Intergenic
1181647917 22:24243764-24243786 GGATGAGGGCGTGGTGGAGAGGG - Intronic
1183988949 22:41585152-41585174 CTATGATGGCGTGGTGGAGATGG + Intronic
1184923312 22:47620708-47620730 CAGTGAGGCCGACCTGGAGCAGG + Intergenic
1184993533 22:48186221-48186243 TACTCAGGCCATGGTGGAGAAGG + Intergenic
1185043173 22:48515983-48516005 GAGTGAGGCTGGGGTGGGGAGGG - Intronic
1185080536 22:48707237-48707259 GAGTGAGGCCAGGCTGGAGATGG - Intronic
1203228698 22_KI270731v1_random:92386-92408 GGATGAGGGCGTGGTGGAGAGGG + Intergenic
949143904 3:671768-671790 CAGAGAGAGGGTGGTGGAGACGG + Intergenic
949404620 3:3701224-3701246 CACTGTGGCAGTGGTGGTGATGG - Intronic
949491523 3:4594161-4594183 CAGTGAGTCCCTGGTGAAGGTGG - Intronic
949930498 3:9074614-9074636 CAGTGAGCCCAGGGTGGAGCTGG + Intronic
951690113 3:25386291-25386313 CATAGAGGCTGGGGTGGAGAGGG + Intronic
952956635 3:38561925-38561947 CAGTGGGGCTGTGGTCGGGAGGG - Intronic
952957050 3:38563899-38563921 CATGGAGGCCGGGGTAGAGAGGG - Intronic
953434860 3:42870491-42870513 AAGTAAGGCTGGGGTGGAGAGGG - Intronic
954538935 3:51381265-51381287 CAGAGAGGCTGTAGTGGACAGGG - Exonic
956559742 3:70561819-70561841 CAGTGAGGATGTGGAGGAAAGGG - Intergenic
959093947 3:101933508-101933530 CAGAGAGACAGTGGTAGAGATGG + Intergenic
959254524 3:103992059-103992081 CAGTGGGGTGGGGGTGGAGATGG + Intergenic
959822982 3:110758505-110758527 GACTGAGGCCCTGGTGGAGTGGG + Intergenic
960026183 3:113013342-113013364 CAGTCAGCCAGTGGTGGAGTTGG - Exonic
961885201 3:130092311-130092333 CACTGAGACCGTGGTGGGGTTGG - Intronic
963452898 3:145507286-145507308 CAGTGTGGCTGTTTTGGAGATGG + Intergenic
964943045 3:162185123-162185145 CTGTGAGGCCATAGTGGGGATGG - Intergenic
967868638 3:194211321-194211343 CAGTGAGACAGTGGAGGAGAGGG - Intergenic
967965469 3:194956912-194956934 CTGTCCGGCCGTGGTGGTGACGG - Intergenic
968122542 3:196135832-196135854 CAGTGAGACCGTGGAGGGGATGG + Intergenic
968614430 4:1571003-1571025 CAATGAGGCCTTGGTGGGCAAGG + Intergenic
968648004 4:1749453-1749475 CAGTGAGGGGCTGGTGGGGAGGG - Intergenic
968678573 4:1899770-1899792 CAGTGAGGCCCACGTGCAGAAGG - Intronic
968843808 4:3028304-3028326 CCGAGAGGCCGTGGTGCACAGGG - Intronic
968887819 4:3344724-3344746 CAGCAGGGCCCTGGTGGAGATGG - Intronic
969351750 4:6602100-6602122 CAGTGAGGAAGAGGTGGAGCAGG + Intronic
969622116 4:8283882-8283904 CAGGGAGGCGGTGCTGGAGCAGG - Intronic
970192321 4:13528452-13528474 CAGTGAGGCCCTGGTAGACGGGG + Intergenic
970421706 4:15911117-15911139 CTGTGAGTCTGTGTTGGAGATGG - Intergenic
970512515 4:16795261-16795283 AAGAGAGCCTGTGGTGGAGACGG + Intronic
971532801 4:27710272-27710294 GTGTGTGGCAGTGGTGGAGATGG + Intergenic
976112556 4:81691494-81691516 CAGTGAGTGCTTGGTGGCGAGGG - Intronic
977316121 4:95450138-95450160 CAGTGATGACATGGTGGAAAGGG - Intronic
978093796 4:104750373-104750395 CAGTTAGGAAGTGATGGAGAAGG + Intergenic
980449879 4:132957495-132957517 CAGTGTGACTGTGGTGAAGATGG + Intergenic
982221726 4:153130275-153130297 GATTGAGGCAGTGGTGGTGATGG - Intergenic
984743667 4:183192347-183192369 CAGTGAGTCAGTGGTAGAGCAGG + Intronic
984789434 4:183601749-183601771 CAGTGAGTCTCTGGTGGAGTAGG - Intergenic
985000947 4:185482116-185482138 CAGTGAGTCTTTGGTGGAGTTGG + Intergenic
985033069 4:185811696-185811718 CGCTGAGGCCGAGGCGGAGAAGG - Intronic
985398654 4:189571843-189571865 CAGTGAGACAGAGGTGTAGAAGG + Intergenic
985835028 5:2264121-2264143 CAGTGACCCTGTGGTGGAAATGG + Intergenic
986015621 5:3754635-3754657 CAGAGAGTCAGTGGTGGGGAGGG - Intergenic
987117870 5:14740483-14740505 CAGTGAGGCAGTGCTGGAATAGG + Intronic
989840568 5:46061886-46061908 CACTGAGGCCTTGGTGAAAAAGG + Intergenic
992697109 5:79300716-79300738 CATGGAGGCCATGCTGGAGAAGG + Exonic
992765105 5:79991157-79991179 CAGCGAGTCCCTGGTGGTGATGG - Exonic
993824180 5:92660873-92660895 CAGTGAGGTCATGATGGAGCAGG + Intergenic
997377618 5:133408558-133408580 CACTGAGGCGGGGGTGGAGCGGG + Intronic
997772141 5:136565121-136565143 TAGTGAGGCTGTGGAGAAGAGGG - Intergenic
997883523 5:137611480-137611502 CCGGGAGGCCCAGGTGGAGATGG - Intergenic
997962267 5:138331560-138331582 CCGTGATTCCGTGGCGGAGACGG + Intronic
998631256 5:143901222-143901244 CAGGGAGGTGGTGATGGAGATGG + Intergenic
998876418 5:146604782-146604804 CAGCTAGGCAGTGGTAGAGATGG + Intronic
998986719 5:147766134-147766156 AAGTGAGGCCGAGAGGGAGAAGG - Intronic
1000388340 5:160697281-160697303 CAGTGAGGCCTTCGTGGGAAAGG + Intronic
1001137008 5:169111006-169111028 CAGTAAGGCCGTTGCAGAGAGGG - Intronic
1001571899 5:172735546-172735568 GATGGAGGCCGTGGTGGGGAAGG + Intergenic
1001601023 5:172928456-172928478 CAGTGAGGGCTTCTTGGAGACGG - Intronic
1001912885 5:175535531-175535553 CACTGTGGCCGTGCTGGAGATGG - Intergenic
1001953114 5:175829940-175829962 CAGTGAGGCCCTGGGAGGGAGGG - Intronic
1002416883 5:179125423-179125445 CTGGGAGGCCCTGGTGGAGCTGG + Intronic
1003431944 6:6047141-6047163 CAGGGAGGTGGTGGTGGAGGTGG + Intergenic
1004285037 6:14313815-14313837 CAGTGAGTAAGTGGTAGAGAAGG + Intergenic
1004366132 6:15014207-15014229 CATTGAGGAAGTGTTGGAGAGGG - Intergenic
1004534495 6:16486926-16486948 CAGCGAGGCCCTGCTGGAAAAGG + Intronic
1004620485 6:17326573-17326595 GAGTGAGGGAGAGGTGGAGATGG + Intergenic
1005036777 6:21562488-21562510 CAGTGAGGACGTGGAGAAAAGGG - Intergenic
1005579894 6:27223781-27223803 ATGTGAGGACGTGGAGGAGATGG - Intergenic
1006085580 6:31592758-31592780 CAGTGAGGTCTGGGTGGAGGAGG + Exonic
1006175647 6:32119879-32119901 CTCTCAGGCCGTGGTAGAGAGGG + Exonic
1006440317 6:34049763-34049785 CAGTGTGGCCGTGGTGTTTATGG - Intronic
1006445043 6:34075272-34075294 CAGTGACACCCTGGTGGAGGAGG + Intronic
1006451487 6:34108137-34108159 GAGTGTGGCAGTGGTGGAGGTGG - Intronic
1006502051 6:34465589-34465611 CAGTGGGGCGGTGGTGCAGGGGG + Intergenic
1006678402 6:35779709-35779731 CAGGGAGGGTGTGGTGGAGCAGG + Intergenic
1006902308 6:37511077-37511099 CAGGGAGGGCCTCGTGGAGAAGG - Intergenic
1007304656 6:40894517-40894539 CAGTGAGGCCCTCCAGGAGATGG + Intergenic
1008813998 6:55540760-55540782 CAGTGAGATTGAGGTGGAGATGG + Intronic
1009729641 6:67583602-67583624 TAGTGAGGCTGTGGAGAAGAGGG - Intergenic
1010004733 6:70983429-70983451 CAGTGGGGCCAGGGTGGAGATGG - Intergenic
1011329576 6:86188650-86188672 GACTGAGGCTGTGTTGGAGATGG + Intergenic
1012171069 6:96016616-96016638 CAGGGAGGACTTTGTGGAGAAGG - Intronic
1013305922 6:108847082-108847104 CAGTGAGGAGGAGGAGGAGAAGG - Intergenic
1014667051 6:124251727-124251749 CAGTGAGGATGTGGTGCAAAGGG + Intronic
1017767621 6:157619568-157619590 CAGTGAGACCTGGGTGGGGAGGG + Intronic
1017974311 6:159341786-159341808 CAGTGAGGTGGAGGTGGAGGTGG + Intergenic
1018903140 6:168061077-168061099 CAGTGAGGGCGAGCTGGAGAGGG + Intronic
1019672730 7:2290822-2290844 CAGAGAGGCCGTGGTGGAGGAGG - Intronic
1020153760 7:5704770-5704792 CAGTGACGGCCTGGTGGAGCTGG - Intronic
1020451882 7:8328826-8328848 CAATGAGGACTTGGTGCAGAGGG + Intergenic
1020791887 7:12637420-12637442 GAGGGAGGAAGTGGTGGAGAGGG + Intronic
1021596766 7:22325414-22325436 GAGTGGGGCAGTGGTGGCGATGG - Intronic
1022324612 7:29319900-29319922 CAGTGAGGTCGGGGAGGGGAAGG - Intronic
1022522106 7:31015089-31015111 CACTGAGGCCCAGGTGGAGGCGG - Intergenic
1025501187 7:61300595-61300617 CTTTGAGGCCATGGTGGAAAAGG - Intergenic
1025516047 7:61646818-61646840 CTTTGAGGCCATGGTGGAAAAGG - Intergenic
1025540384 7:62075644-62075666 CTTTGAGGCCATGGTGGAAAAGG - Intergenic
1025589417 7:62837685-62837707 CATTGAGGCCATGGTGAAAAAGG + Intergenic
1027166150 7:75835662-75835684 CAGTGGTGCCGGCGTGGAGACGG + Intergenic
1028850997 7:95537394-95537416 CAGTGAGGCGGTGGTATACAAGG - Intronic
1029575385 7:101400149-101400171 CAGGGAGGCAGGGGTGGGGAGGG + Intronic
1030544104 7:110870996-110871018 CAGTGAGGCAGCAGTAGAGATGG + Intronic
1032514148 7:132494582-132494604 CAGTGTGGTGGTGGTGGAGGTGG + Intronic
1033836118 7:145314453-145314475 CAGTTTGGTGGTGGTGGAGAGGG - Intergenic
1034435604 7:151061481-151061503 CAGAGAGGGTGTGGTGGGGAGGG - Intronic
1035206157 7:157295243-157295265 CAGACAGGCCGTGGTGGGAAGGG + Intergenic
1035529657 8:341067-341089 TTGTGAGACCATGGTGGAGATGG - Intergenic
1035529672 8:341207-341229 TTGTGAGACCATGGTGGAGATGG - Intergenic
1035529703 8:341477-341499 TTGTGAGACCATGGTGGAGATGG - Intergenic
1038038651 8:23706349-23706371 CTGTGAGGCAGTCTTGGAGATGG - Exonic
1042167548 8:65960189-65960211 CAGAGAGGCCCTGGGGGAGGAGG + Intergenic
1042290907 8:67168299-67168321 GAGGGAGGCCGTGGGGGAGACGG + Intronic
1044553683 8:93539128-93539150 GAGTGCTGCTGTGGTGGAGAGGG + Intergenic
1045105668 8:98890121-98890143 CAGTGAGTCCGTGGTTGTGCTGG + Intronic
1045526559 8:102945450-102945472 CACTGAGGCCATGCTGAAGAGGG + Intronic
1047895274 8:129359743-129359765 CAGTGAAGGCCTTGTGGAGAAGG + Intergenic
1049606798 8:143533287-143533309 CTCTGAGGCCGAGGTGGAGGTGG - Intronic
1050360854 9:4829692-4829714 CAGTGTGGCAGTGGTGGCGGTGG + Intronic
1050885252 9:10756513-10756535 CAGTGAGGCTGTGGAGAAAAGGG + Intergenic
1051805654 9:20990185-20990207 CACTGAGGCCGAGGAGGAGAGGG - Exonic
1053454636 9:38224660-38224682 CAGTGAGGATGAGGTGGGGAGGG + Intergenic
1053661872 9:40290150-40290172 CAGTGAGCACGTGCTGGGGAGGG - Exonic
1054522737 9:66086134-66086156 CAGTGAGCACGTGCTGGGGAGGG + Intergenic
1054821565 9:69526577-69526599 CAGTGAGGCTGTGGAGAAAAGGG + Intronic
1055892939 9:81142444-81142466 CAGTGATGCAGTGGTGAAGGAGG - Intergenic
1056585648 9:87925619-87925641 CAGTGAGGCCCTGGTGTGTAAGG - Intergenic
1056611231 9:88127325-88127347 CAGTGAGGCCCTGGTGTGTAAGG + Intergenic
1056737887 9:89225328-89225350 CAAGGAGGCTGTTGTGGAGAGGG - Intergenic
1056776474 9:89516552-89516574 GAGAGAGACTGTGGTGGAGAAGG + Intergenic
1057305444 9:93909707-93909729 CAGGGAGGCCTTCCTGGAGAAGG - Intergenic
1057802634 9:98199389-98199411 CAGCGAGGACGAGGTGGAGGGGG - Exonic
1058818698 9:108709360-108709382 CAGAGAGGCCCAGGTGGTGAAGG - Intergenic
1059265409 9:113024272-113024294 CAGTGTGGACCTGGTGGTGAGGG + Intergenic
1059953870 9:119495903-119495925 CAGTGAGGCTGGGGGAGAGAGGG + Intronic
1060385599 9:123225129-123225151 CAGTGATTCAGTGGTGGAGTGGG + Intronic
1060429140 9:123533847-123533869 CACAGTGGCCGTGGAGGAGAGGG - Intronic
1060941503 9:127545486-127545508 CAGGGAGGCCATGGTGGGCAGGG + Intronic
1060961657 9:127684971-127684993 AAGGCAGGCGGTGGTGGAGATGG + Intronic
1061160965 9:128893490-128893512 CAGTGAGGCAGTAGTGGGGTTGG + Intronic
1061220450 9:129247461-129247483 CAGCTAGGAAGTGGTGGAGATGG - Intergenic
1061676076 9:132216521-132216543 CAGTGGGGCAGGGGTGGAGAGGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061889117 9:133608531-133608553 GAGTGGGGAAGTGGTGGAGATGG - Intergenic
1062376545 9:136264324-136264346 TAGAGATGCCGTGGTGGAGGTGG - Intergenic
1062519462 9:136951727-136951749 CCATGAGGCCGGGGTGGAGGTGG - Intronic
1062529684 9:136994395-136994417 CAGTCAGGCCGGGGTGGGGCGGG - Intergenic
1062676470 9:137748433-137748455 CAGTGGGGCCGTCCTGGAGGAGG + Intronic
1185887466 X:3795696-3795718 CAGAAAGGCGGTGGTGGAGATGG + Intergenic
1186122159 X:6374681-6374703 CAGTGAGGCCGTGAGGGAACTGG + Intergenic
1186703685 X:12118985-12119007 CAGTCAGTCTGTGGTGGGGAAGG - Intergenic
1188150978 X:26674842-26674864 CAATGAGCCAGTGGTGGAGAGGG + Intergenic
1189282354 X:39827770-39827792 CAGTCAGGCAGAGGTGGGGAGGG - Intergenic
1189290466 X:39881549-39881571 CAGTGAGGCAGTGGAGATGATGG - Intergenic
1190388454 X:49908438-49908460 CAGTGTGGCAGTGGTAGAGAAGG + Intergenic
1191319090 X:59173577-59173599 CTTTGAGGCTGTGGTGGAAAAGG + Intergenic
1191322167 X:59214713-59214735 CTTTGAGGCTGTGGTGGAAAAGG + Intergenic
1191473446 X:61239281-61239303 CTTTGAGGCTGTGGTGGAAAAGG + Intergenic
1191512701 X:61764529-61764551 CTTTGAGGCTGTGGTGGAAAAGG + Intergenic
1191520211 X:61864828-61864850 CTTTGAGGCTGTGGTGGAAAAGG + Intergenic
1192180648 X:68913690-68913712 CAGAGAGGCCGAGGGGCAGAAGG + Intergenic
1193423116 X:81308295-81308317 CAGTGGGGCAGTGGTGGGGGCGG + Intergenic
1195702816 X:107717438-107717460 GGGTGAGGCCGTGATGGTGAGGG - Intronic
1196218555 X:113084695-113084717 TAGTGAGGCTGTGGAGAAGAGGG - Intergenic
1199482958 X:148318072-148318094 CAGTGAAGCCAGGGTGGAGGGGG - Intergenic
1200110211 X:153737120-153737142 CAGCGGGGCTGGGGTGGAGAGGG - Intronic
1200213263 X:154356296-154356318 CAGGGAGCCCGGGGTGGGGAAGG - Intronic
1200232289 X:154450072-154450094 CAGTGACGCCACTGTGGAGAAGG + Exonic
1200910133 Y:8524565-8524587 TAGTGGGGTCCTGGTGGAGAAGG - Intergenic