ID: 1151880001

View in Genome Browser
Species Human (GRCh38)
Location 17:76889125-76889147
Sequence CAGCTCGGTGTACCTGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151880001_1151880007 10 Left 1151880001 17:76889125-76889147 CCCATGCCAGGTACACCGAGCTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1151880007 17:76889158-76889180 GCAGTGAGAAGATGCAGGGCTGG 0: 1
1: 0
2: 5
3: 40
4: 406
1151880001_1151880009 17 Left 1151880001 17:76889125-76889147 CCCATGCCAGGTACACCGAGCTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1151880009 17:76889165-76889187 GAAGATGCAGGGCTGGCGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 291
1151880001_1151880005 5 Left 1151880001 17:76889125-76889147 CCCATGCCAGGTACACCGAGCTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1151880005 17:76889153-76889175 CAGATGCAGTGAGAAGATGCAGG 0: 1
1: 0
2: 1
3: 35
4: 295
1151880001_1151880006 6 Left 1151880001 17:76889125-76889147 CCCATGCCAGGTACACCGAGCTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1151880006 17:76889154-76889176 AGATGCAGTGAGAAGATGCAGGG 0: 1
1: 0
2: 3
3: 38
4: 369
1151880001_1151880008 16 Left 1151880001 17:76889125-76889147 CCCATGCCAGGTACACCGAGCTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1151880008 17:76889164-76889186 AGAAGATGCAGGGCTGGCGCAGG 0: 1
1: 0
2: 1
3: 32
4: 282
1151880001_1151880010 18 Left 1151880001 17:76889125-76889147 CCCATGCCAGGTACACCGAGCTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1151880010 17:76889166-76889188 AAGATGCAGGGCTGGCGCAGGGG 0: 1
1: 0
2: 5
3: 88
4: 1028

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151880001 Original CRISPR CAGCTCGGTGTACCTGGCAT GGG (reversed) Intronic