ID: 1151880001

View in Genome Browser
Species Human (GRCh38)
Location 17:76889125-76889147
Sequence CAGCTCGGTGTACCTGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151880001_1151880007 10 Left 1151880001 17:76889125-76889147 CCCATGCCAGGTACACCGAGCTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1151880007 17:76889158-76889180 GCAGTGAGAAGATGCAGGGCTGG 0: 1
1: 0
2: 5
3: 40
4: 406
1151880001_1151880006 6 Left 1151880001 17:76889125-76889147 CCCATGCCAGGTACACCGAGCTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1151880006 17:76889154-76889176 AGATGCAGTGAGAAGATGCAGGG 0: 1
1: 0
2: 3
3: 38
4: 369
1151880001_1151880005 5 Left 1151880001 17:76889125-76889147 CCCATGCCAGGTACACCGAGCTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1151880005 17:76889153-76889175 CAGATGCAGTGAGAAGATGCAGG 0: 1
1: 0
2: 1
3: 35
4: 295
1151880001_1151880009 17 Left 1151880001 17:76889125-76889147 CCCATGCCAGGTACACCGAGCTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1151880009 17:76889165-76889187 GAAGATGCAGGGCTGGCGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 291
1151880001_1151880010 18 Left 1151880001 17:76889125-76889147 CCCATGCCAGGTACACCGAGCTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1151880010 17:76889166-76889188 AAGATGCAGGGCTGGCGCAGGGG 0: 1
1: 0
2: 5
3: 88
4: 1028
1151880001_1151880008 16 Left 1151880001 17:76889125-76889147 CCCATGCCAGGTACACCGAGCTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1151880008 17:76889164-76889186 AGAAGATGCAGGGCTGGCGCAGG 0: 1
1: 0
2: 1
3: 32
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151880001 Original CRISPR CAGCTCGGTGTACCTGGCAT GGG (reversed) Intronic
900647131 1:3714047-3714069 CAGCTCCTTGCACCTGGCGTTGG + Intronic
900649218 1:3722834-3722856 CACCTCTCTGCACCTGGCATGGG + Intronic
900649238 1:3722918-3722940 CACCTCTCTGCACCTGGCATGGG + Intronic
904783510 1:32968027-32968049 CATCTGGGTCTACCTGGAATTGG - Intergenic
904813556 1:33179742-33179764 CAGCCCCATGTACCTGGCTTTGG - Intronic
907856997 1:58313374-58313396 CAGGTCTGTGTCCCTGTCATGGG - Intronic
909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG + Intergenic
911451545 1:98068056-98068078 CAGCTAGGAGTAGCTGGCCTGGG + Intergenic
918074946 1:181162950-181162972 CAGCTGTGTGTACCTGGCTCAGG + Intergenic
1067690268 10:48497294-48497316 CAGCTCTGTCTCCTTGGCATGGG + Intronic
1071566212 10:86672704-86672726 CAGCCCGGAGGACCTGGCCTGGG - Intronic
1077364149 11:2154795-2154817 GAGCGCGGGGTTCCTGGCATGGG - Intronic
1081814406 11:45930440-45930462 CTGCTGGTTGTACCTGACATAGG - Intronic
1089693935 11:120204713-120204735 TAGCCCTGTGTACCTGGCACTGG - Intergenic
1096651525 12:53064206-53064228 CAGCTGGGTGGAACTGGCAGGGG - Exonic
1099199433 12:79658188-79658210 CAGATCTTTGCACCTGGCATTGG + Intronic
1100313750 12:93423553-93423575 CAGCCTGGTGTACCTAGCGTGGG + Intronic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1110487687 13:76066128-76066150 CAGTTTGGTGTTCCTGCCATAGG + Intergenic
1113424077 13:110193606-110193628 CGCCTCGATGTCCCTGGCATGGG - Intronic
1119376267 14:74196143-74196165 CAGCTCTGTGTACTTGGATTAGG + Intronic
1121421472 14:93818716-93818738 CATCTGGGTGTCACTGGCATAGG - Intergenic
1122256244 14:100479216-100479238 CTGCTCTGAGTCCCTGGCATAGG + Intronic
1123999194 15:25740697-25740719 CACCTCTGTCTACCTGGCTTTGG + Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129834654 15:78694545-78694567 CAGCTCAGTGTTCCTGGTCTTGG - Intronic
1131149336 15:90037091-90037113 CAGCTTGGAGGACCTGGCAGGGG + Intronic
1135008311 16:18848637-18848659 CAGCTCAGTGAGCCTGGCAGAGG + Intronic
1136127071 16:28191742-28191764 GAGCTGGCTTTACCTGGCATTGG + Intronic
1139657143 16:68395967-68395989 CAACTCAGTGTGCCTGGCCTGGG + Intronic
1140613246 16:76626664-76626686 CAGATTGGTGAACCTGCCATTGG - Intronic
1141584699 16:85025953-85025975 CAGATCAGTGAACCTGACATTGG - Intergenic
1144416331 17:15050812-15050834 CAGCTCCAGGTACCTGACATTGG - Intergenic
1144771165 17:17760442-17760464 CAGCCCAGTGTCCCTGGCCTGGG + Intronic
1148193458 17:45696705-45696727 CAGGTGAGAGTACCTGGCATAGG - Intergenic
1149238869 17:54625039-54625061 CAGCTGGGTGTTTCTGGCTTGGG - Intergenic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1156148503 18:34215616-34215638 CAGCTCGGAGGACCTCGGATGGG + Intronic
1156401660 18:36745210-36745232 CTGCTCGGTGCACCTGGCAGAGG - Intronic
1157002590 18:43544875-43544897 CAGCCAGGTGTTCCTGCCATTGG - Intergenic
1157041945 18:44050117-44050139 CAGCTAGGTGTACCTCCCAGTGG + Intergenic
1157099247 18:44714546-44714568 CAGCTCTGTGTATTTTGCATTGG + Intronic
1157696038 18:49724469-49724491 CACCTGCCTGTACCTGGCATTGG - Intergenic
1157813800 18:50716853-50716875 CCGCTCTGTGTACAGGGCATGGG - Intronic
1160982599 19:1823248-1823270 CATGTCGGGGTACCTGGCATTGG - Intronic
1166251342 19:41573020-41573042 AAGCTTGGTCTACCTGGCACAGG - Intronic
1166960104 19:46492085-46492107 CATCTGGGTGTCCCTGACATAGG + Exonic
926221950 2:10942235-10942257 CTGCTCGTTGTCCCTGCCATGGG + Intergenic
928208543 2:29305602-29305624 AAGCTGGGTATACTTGGCATGGG - Intronic
928600799 2:32901623-32901645 CAGCTCAGCATAACTGGCATGGG + Intergenic
931999913 2:67875751-67875773 TAGCTCTGTGTAACTGGCAATGG - Intergenic
934112179 2:88754264-88754286 CAGTTGTGTGTACCTGGCACTGG + Intergenic
934780981 2:96969560-96969582 CTTGTCGGTGTGCCTGGCATTGG - Intronic
937126009 2:119475428-119475450 CAGCTCTGGGCACCTGGCCTGGG - Intronic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
1171492584 20:25531867-25531889 CAGCTGGGGGTGCCTGGCCTTGG + Intronic
1180731766 22:17987614-17987636 TTGCTCGGAGTACCTGCCATAGG - Intronic
1180758978 22:18184371-18184393 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1180769265 22:18368162-18368184 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1180777047 22:18494233-18494255 CACCCCAGTGTGCCTGGCATGGG - Intergenic
1180809769 22:18751571-18751593 CACCCCAGTGTGCCTGGCATGGG - Intergenic
1180827137 22:18871391-18871413 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1181195907 22:21185794-21185816 CACCCCAGTGTGCCTGGCATGGG - Intergenic
1181213621 22:21307330-21307352 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1182314816 22:29438556-29438578 CAGCTCGCTGTTCCTCACATGGG + Intergenic
1182695133 22:32193484-32193506 CAGCTCGCTGTTCCTCACATGGG - Intronic
1182716215 22:32357840-32357862 CAGCTCGCTGTTCCTCACATGGG + Intronic
1183661741 22:39225383-39225405 CAGCTCCCTGCCCCTGGCATCGG - Intronic
1203230894 22_KI270731v1_random:109047-109069 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1203277282 22_KI270734v1_random:97296-97318 CACCCCAGTGTGCCTGGCATGGG + Intergenic
952952050 3:38533205-38533227 CTCCTCGGTGTACCTGCGATAGG + Intronic
955110164 3:55941218-55941240 CAGTTGCGTGTACCTGCCATGGG + Intronic
960018706 3:112923764-112923786 CTTCTCTGTGTAGCTGGCATAGG + Exonic
960798609 3:121514734-121514756 TAGCTCTGTGTACCTGCCAGTGG + Intronic
961617093 3:128191426-128191448 CAGCTCACTGTGCCTGGCCTGGG + Intronic
966321727 3:178708353-178708375 TAGCTCTCTGTGCCTGGCATTGG + Intronic
968963716 4:3758879-3758901 CAGCCCTGGGTACCTGGCTTGGG - Intergenic
969718096 4:8877989-8878011 CAGCTCGGTGGCCCTGGCACAGG - Intergenic
972635190 4:40877892-40877914 CAGCTCAGGGTACAGGGCATGGG + Intronic
975874263 4:78817547-78817569 CAGAGTGGTGTACCTAGCATGGG - Intronic
983645924 4:169991504-169991526 TAGCTCGGTGGACGTGACATCGG + Exonic
985789511 5:1917807-1917829 CAGCTCGGAACACCTGGCAGTGG - Intergenic
997859964 5:137407449-137407471 CAGCTTGGTGTACCTGAGAGGGG + Intronic
1001045901 5:168371414-168371436 CGGTTTGGTGTACCTGGCAAGGG - Exonic
1001773327 5:174311670-174311692 CAGCCCGGTGTAGCCAGCATGGG + Intergenic
1023956889 7:44893735-44893757 CAGCACGGGGTGCCTGGCCTGGG - Intergenic
1029273090 7:99388527-99388549 CAGCTCCGTGGACTGGGCATCGG + Intronic
1033042823 7:137933796-137933818 CAGCTGGGTGTCCTTGGCAGTGG + Intronic
1035458466 7:159024414-159024436 CAGCTCGGGGTGCCTGGCGGCGG - Intergenic
1035558703 8:588703-588725 CTGATTGGTGTACCTGGGATGGG - Intergenic
1047760003 8:127947493-127947515 AGGCTCAGTGTGCCTGGCATTGG - Intergenic
1059210531 9:112510748-112510770 CAGTTCGGTGTAGGGGGCATAGG + Intronic
1061357684 9:130118869-130118891 CAGCTGGGTGTGCCTGCCCTTGG - Intronic
1061806109 9:133138502-133138524 CAGCTGGGTGTGCCAGGCAGTGG + Intronic