ID: 1151880005

View in Genome Browser
Species Human (GRCh38)
Location 17:76889153-76889175
Sequence CAGATGCAGTGAGAAGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 295}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151880004_1151880005 -10 Left 1151880004 17:76889140-76889162 CCGAGCTGTTTTGCAGATGCAGT 0: 1
1: 0
2: 1
3: 20
4: 229
Right 1151880005 17:76889153-76889175 CAGATGCAGTGAGAAGATGCAGG 0: 1
1: 0
2: 1
3: 35
4: 295
1151880003_1151880005 -1 Left 1151880003 17:76889131-76889153 CCAGGTACACCGAGCTGTTTTGC 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1151880005 17:76889153-76889175 CAGATGCAGTGAGAAGATGCAGG 0: 1
1: 0
2: 1
3: 35
4: 295
1151880001_1151880005 5 Left 1151880001 17:76889125-76889147 CCCATGCCAGGTACACCGAGCTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1151880005 17:76889153-76889175 CAGATGCAGTGAGAAGATGCAGG 0: 1
1: 0
2: 1
3: 35
4: 295
1151879999_1151880005 14 Left 1151879999 17:76889116-76889138 CCCAGGTCTCCCATGCCAGGTAC 0: 1
1: 0
2: 3
3: 9
4: 148
Right 1151880005 17:76889153-76889175 CAGATGCAGTGAGAAGATGCAGG 0: 1
1: 0
2: 1
3: 35
4: 295
1151880000_1151880005 13 Left 1151880000 17:76889117-76889139 CCAGGTCTCCCATGCCAGGTACA 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1151880005 17:76889153-76889175 CAGATGCAGTGAGAAGATGCAGG 0: 1
1: 0
2: 1
3: 35
4: 295
1151880002_1151880005 4 Left 1151880002 17:76889126-76889148 CCATGCCAGGTACACCGAGCTGT 0: 1
1: 0
2: 2
3: 17
4: 88
Right 1151880005 17:76889153-76889175 CAGATGCAGTGAGAAGATGCAGG 0: 1
1: 0
2: 1
3: 35
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151880005 Original CRISPR CAGATGCAGTGAGAAGATGC AGG Intronic
900679074 1:3906349-3906371 CAGCTGCAGAGAGAGGCTGCAGG + Intergenic
900679267 1:3907394-3907416 CAAAGGCCGTGGGAAGATGCAGG + Intergenic
900960107 1:5913627-5913649 CAGAGGCAGTGTGAAGACGTTGG - Intronic
902183649 1:14709098-14709120 AGGATGCAGTGAGCAGACGCAGG - Intronic
906181417 1:43823057-43823079 CAGAGGTAGTGAGAAGTGGCTGG - Intronic
906249947 1:44303224-44303246 CAGTGGCAGTGAGAAAATCCAGG + Intronic
906346343 1:45017672-45017694 CAAGTGCAGGGAGAAGATGAAGG - Exonic
907192429 1:52660449-52660471 CAGCCGCAGTGGGAGGATGCTGG + Intronic
908456508 1:64309635-64309657 GAGGGGCTGTGAGAAGATGCTGG - Intergenic
909932696 1:81516429-81516451 AAGATGCAGGAAGAAAATGCAGG - Intronic
910806607 1:91194674-91194696 GAAAGGCACTGAGAAGATGCTGG + Intergenic
910965949 1:92808094-92808116 CAGATGGAGGAAGAAAATGCTGG + Intergenic
911856242 1:102879841-102879863 CAGAGGCAGTCAGAAGTTTCAGG + Exonic
912556038 1:110516642-110516664 AAGATGCAGTGAGATAATGTAGG + Intergenic
913049410 1:115103867-115103889 CAACTGCAGTGTGAAAATGCTGG + Intergenic
913098566 1:115542185-115542207 AATATTAAGTGAGAAGATGCTGG - Intergenic
914829804 1:151162561-151162583 CAGAAGCAGTGAAAAGACCCAGG - Intronic
915362978 1:155296860-155296882 CAGATGCAGTGGAGAGATGGAGG - Intronic
916740529 1:167643549-167643571 CACATCCTGTGAGTAGATGCAGG + Intronic
916825544 1:168438513-168438535 AAGATGCCTTGAAAAGATGCGGG - Intergenic
918116591 1:181503259-181503281 GAAATGCAGTGAGATCATGCTGG - Intronic
918450507 1:184653088-184653110 ATGATGCACTGAGAAGATCCTGG + Intergenic
918866582 1:189907722-189907744 CATATGCAGTGAGGAGATATGGG + Intergenic
919046788 1:192462842-192462864 CAGATGTAGTGAGAAAGTGCAGG - Intergenic
921176541 1:212600110-212600132 CAGATGAACTGTGAAGATGGTGG - Intronic
922365612 1:224860635-224860657 CAGGTGCAGTGAGAGGAAGAGGG + Intergenic
923172322 1:231429236-231429258 CAGATCCATGGAGAAGCTGCAGG - Intergenic
924478769 1:244407182-244407204 GAGATGCAGTGAGGTGATGTAGG - Intergenic
1062900578 10:1142251-1142273 CAGTTGCAATGTGGAGATGCTGG - Intergenic
1063080172 10:2760379-2760401 CAGATGGGGTGAGAAGAGACTGG + Intergenic
1065884187 10:30062420-30062442 AAGATGGAGAGAGAAGATGGTGG + Intronic
1071099155 10:82014705-82014727 CAGAGGCAGGGTGAAGGTGCTGG + Intronic
1074801692 10:117006109-117006131 CAGATGAAGTTCAAAGATGCAGG - Intronic
1074959754 10:118432478-118432500 AAGATGGAATGAGAAGATGATGG - Intergenic
1075248189 10:120843425-120843447 CAGATGAAATGAGATGATGCAGG + Intergenic
1075488641 10:122847704-122847726 AAGAAGCAATGAGATGATGCAGG - Intronic
1076224664 10:128764521-128764543 GAGAGGCAGTGGGGAGATGCTGG + Intergenic
1076717397 10:132373324-132373346 CAGACGGAGGGAGAAGGTGCAGG + Intronic
1077172730 11:1175201-1175223 CAGGTGCTGTGAGGAGATGGTGG - Intronic
1077294293 11:1817539-1817561 CTGATGCAATGAGAAGTTCCAGG - Intergenic
1077556247 11:3227517-3227539 CAGCTGCAGTGAGGAGACCCCGG - Intergenic
1077659732 11:4056933-4056955 AAGATGCAGTGAAAAAAAGCAGG - Intronic
1077924524 11:6667698-6667720 CTGATGCAGTGAGAAGGTTGGGG + Intergenic
1077984770 11:7340845-7340867 CACATCCAGTGAGGAGATACAGG + Intronic
1079875621 11:25853478-25853500 CAGAAGCAGAGTGAAGAGGCGGG + Intergenic
1080927673 11:36774992-36775014 AAAATCCAGTGAGAGGATGCTGG + Intergenic
1083140376 11:60716703-60716725 CAGAGAAAATGAGAAGATGCAGG - Intergenic
1083657322 11:64235750-64235772 CAGATGCTGGGAGCAGCTGCAGG + Intronic
1084215965 11:67647026-67647048 CACAGGCAGTGAGCACATGCTGG + Exonic
1084537265 11:69764541-69764563 TAGATGGAGTGAGAGGCTGCTGG + Intergenic
1085507361 11:77067969-77067991 CAGGTGTAGGGAGAAGATTCTGG - Intronic
1089164867 11:116468089-116468111 CAAATCAAGTGAGAAAATGCAGG + Intergenic
1090382983 11:126339704-126339726 CACAGGCAGAGAGAAGCTGCAGG - Intronic
1090881673 11:130838394-130838416 CTGAGGCAGTGAGAAGTAGCAGG - Intergenic
1091168032 11:133497887-133497909 CACTTGCAGTGGGGAGATGCTGG - Intronic
1091337617 11:134784272-134784294 AGGATGCAGTGAGCAGGTGCTGG + Intergenic
1091968342 12:4764364-4764386 CAGTAGCAGTGAGAAGATGGCGG - Intronic
1092916213 12:13191681-13191703 CAGGTCCAGTAAGCAGATGCTGG - Intergenic
1093596125 12:20961615-20961637 CACTTACAGTGAGAACATGCGGG - Intergenic
1093704216 12:22256852-22256874 CAGATCCAGAGAGAAGAGACGGG + Intronic
1094142605 12:27196301-27196323 CAGATGCAGTGAGAATAATGAGG + Intergenic
1094562492 12:31568696-31568718 CAGCTGCAGTGAAATGAAGCTGG + Intronic
1095283085 12:40379731-40379753 CAAATGCAGACAGAAGACGCAGG + Intergenic
1099993522 12:89752504-89752526 CAGCTGCGGTGAGAGGATGGTGG - Intergenic
1100049674 12:90432479-90432501 CTGATACAGAGAGAATATGCTGG - Intergenic
1101893407 12:108735242-108735264 AAGAGGCAGTCAGAAGATGAAGG - Intergenic
1102311331 12:111846875-111846897 CATATACAGTGTGAACATGCTGG - Intronic
1103192725 12:119016081-119016103 CAGATGCACAGGGAAGATGAAGG + Intronic
1103590802 12:121990647-121990669 AAGATTCAGTGCCAAGATGCAGG - Intronic
1104144527 12:126019770-126019792 CTGATGCAGAGAGAAGCAGCTGG + Intergenic
1104396964 12:128442340-128442362 CACATGCAGTTTGCAGATGCTGG + Intronic
1104494183 12:129221229-129221251 ATGATGCAGTGAGGAGATGCTGG + Intronic
1105250792 13:18697482-18697504 CAGATGCAGCTGGAAGATGGCGG + Intergenic
1105893762 13:24700885-24700907 CAGATGCAGTCACCAAATGCCGG + Exonic
1106798867 13:33235316-33235338 CAGATGCTGTGATAAAAAGCAGG + Intronic
1108249062 13:48546837-48546859 AATATGCTGTAAGAAGATGCTGG - Intergenic
1108582623 13:51839808-51839830 CAGCTGCAGAGAGAAGCTGCGGG - Intergenic
1108694939 13:52894854-52894876 GGGATGCAGTGAGATGCTGCCGG - Intergenic
1108997633 13:56754503-56754525 CAAATTCAGTGAGAAGATACTGG - Intergenic
1110250296 13:73373518-73373540 CAGATACAGTGAGAAGTCACTGG - Intergenic
1110457044 13:75700736-75700758 CACATGCAGTGTGAATATGCTGG + Intronic
1113616625 13:111685083-111685105 CAGATGCAGTGAGAGGACTGCGG - Intergenic
1113622155 13:111770354-111770376 CAGATGCAGTGAGAGGACTGCGG - Intergenic
1113654513 13:112059325-112059347 TAGAGGCAGTGAGAAGAAGTGGG - Intergenic
1113822836 13:113227340-113227362 AGGATGCAGTGAGAAGGTGCTGG - Intronic
1116257351 14:42572353-42572375 CACATGCAGTAAGAACATCCAGG + Intergenic
1116747773 14:48843522-48843544 CAGATACAGTTAGAAAATGATGG + Intergenic
1118810586 14:69270501-69270523 GAGCTGCTGTGAGAAGATGAAGG - Intronic
1121357515 14:93228318-93228340 CAGAGGCAGAGAGAAGCTGAGGG - Exonic
1121391528 14:93580146-93580168 CAGATGGAGTTACAAGATGATGG + Exonic
1121451012 14:94008320-94008342 AAGAGGCAGTGAGAAGAGGCAGG + Intergenic
1124706772 15:31973124-31973146 CAGATCAAGTGAGACGATGATGG + Intergenic
1126257272 15:46642722-46642744 CTGAAGCAGTGAGAAAAGGCTGG - Intergenic
1126804089 15:52328501-52328523 TAGAAGCAGTGAGAAGTAGCTGG - Intronic
1127305418 15:57700841-57700863 CAGATGCTGTGAGAAGGGGAAGG + Intronic
1128245217 15:66128217-66128239 CAGAGGCAGTCAGGAGATCCAGG - Intronic
1129176646 15:73845048-73845070 CAGAGGCATTGAGAAGACTCAGG + Intergenic
1131429517 15:92375542-92375564 CTGATGCAGTCAGAGGCTGCAGG + Intergenic
1132714495 16:1284027-1284049 CAGATTCAGTGGGAAGAGGTGGG - Intergenic
1134054220 16:11159152-11159174 CAGCAGCAGTTAGAAGAAGCTGG + Intronic
1134826015 16:17285049-17285071 CAGATGCAGAGAGAGGAAGCAGG + Intronic
1135040284 16:19113107-19113129 CCGAGGGAGTGAGAAGGTGCTGG - Intergenic
1135053886 16:19214539-19214561 AAGAAGGACTGAGAAGATGCTGG + Intronic
1135849795 16:25952965-25952987 CAGATGCATTGGAAAGATGTAGG - Intronic
1138320368 16:56106143-56106165 CAGCTGCAGTGAGAAGGGGCTGG + Intergenic
1139529129 16:67533685-67533707 CGGGTGTAGTGAGAAAATGCAGG + Intronic
1141162488 16:81638632-81638654 CAGGTGCAGGCAGAAGCTGCCGG - Intronic
1142931200 17:3285180-3285202 CAGAAGCTGTGGGAAGATGTAGG + Intergenic
1143367871 17:6420279-6420301 CAGAAGCAGAATGAAGATGCGGG + Intronic
1143724710 17:8837095-8837117 CAGGTGCTGGGAGAAGAGGCTGG - Intronic
1144133301 17:12268435-12268457 CAGAAGCAGAGTGAAGATGGGGG - Intergenic
1144705465 17:17364862-17364884 CAGATGAAATGAGAAGGAGCAGG - Intergenic
1147390534 17:40106633-40106655 CAGATGCAGGGAGAATGTGGGGG + Intergenic
1147557132 17:41486668-41486690 CAGAGGCACTGAGATGATCCGGG - Intronic
1148736399 17:49867591-49867613 CTCATGCATTGAGAACATGCTGG + Intergenic
1148800725 17:50223797-50223819 AAGATGCAGTGAGAAGAACATGG - Intergenic
1149436304 17:56636453-56636475 GAGCTGCAGTCAGAAGATGAAGG + Intergenic
1149543228 17:57484248-57484270 GAGGTGGAGGGAGAAGATGCAGG - Intronic
1151880005 17:76889153-76889175 CAGATGCAGTGAGAAGATGCAGG + Intronic
1151967799 17:77440648-77440670 CAGAAGCAGGGAGAAGAGGCAGG + Intronic
1152336406 17:79701846-79701868 CAGGTGCAGGGAGATGGTGCTGG + Intergenic
1153324553 18:3804631-3804653 CAGACGCAGTGAAAGGATGCTGG + Intronic
1153649191 18:7224415-7224437 CAGATTCCCTGAGAAGGTGCAGG + Intergenic
1153803413 18:8691310-8691332 CAGATCCTGTGAGATCATGCAGG - Intergenic
1154438058 18:14361444-14361466 CAGATGCAGCTGGAAGATGGCGG - Intergenic
1157223775 18:45845293-45845315 CAGATGCAGTGAGAGGCTGTGGG + Intergenic
1158629088 18:59096404-59096426 CACAGGCAGTGAGAAGAGGCAGG + Intergenic
1159997896 18:74984272-74984294 CAGTTGCAGTGAGCAGCGGCAGG - Intronic
1161116549 19:2500230-2500252 CAAATGCAGTTAGAAGACACAGG + Intergenic
1161327056 19:3669076-3669098 GGAATGGAGTGAGAAGATGCTGG - Intronic
1162309730 19:9898980-9899002 CAAACGCAGTGAGAAGCTGCTGG - Intronic
1166287542 19:41841130-41841152 CTGATCAAGGGAGAAGATGCAGG + Intronic
1166661345 19:44649294-44649316 CACAGGCAATGAGAATATGCAGG - Intronic
1167761305 19:51451404-51451426 CAGGTGCACTGAGGAGATGAAGG - Exonic
1168238363 19:55077379-55077401 CAAATTCAGTCAGATGATGCAGG - Intronic
925273668 2:2633851-2633873 CAGAAGCAGAGAGTAGATGGTGG - Intergenic
925441909 2:3895322-3895344 CAGCTGCTGTGGGAAGATGGGGG + Intergenic
925892336 2:8445755-8445777 CAGATGCAGTGAAAGGAGACAGG - Intergenic
929221592 2:39469916-39469938 CAGAGGCACTGAGAAGATTGAGG + Intergenic
929759596 2:44796166-44796188 CAGATGCTGTGGGAGGTTGCTGG + Intergenic
932001280 2:67887226-67887248 GAGATGCCATGAGAAGATGAAGG - Intergenic
932067923 2:68586782-68586804 AAGATGAAGAGTGAAGATGCGGG - Intronic
935553292 2:104480739-104480761 CAGTTGCTGTGACAAGCTGCAGG - Intergenic
936844856 2:116818578-116818600 CAAATGCAATGAGAAGAGACAGG + Intergenic
937312228 2:120909384-120909406 CAGGTGCAGTGGGAGGAAGCTGG - Intronic
937694404 2:124791761-124791783 CATATGCAGGGAAAAGATACAGG - Intronic
938132673 2:128731188-128731210 CAAATGCAGAGACAAGCTGCAGG + Intergenic
939499490 2:142965143-142965165 CGGATGTAGTGGGAAGATGCAGG - Intronic
940176825 2:150886990-150887012 CAGATGCAGTTTGGAGAAGCTGG + Intergenic
940258459 2:151757006-151757028 CAGATGGGCTGAGAAGATGGAGG - Intergenic
941764309 2:169279957-169279979 CAGTTCCATTTAGAAGATGCAGG + Intronic
941783566 2:169475207-169475229 CTGATGCTGTAAGAAGATGGGGG - Intergenic
942803309 2:179901040-179901062 GAGAAACATTGAGAAGATGCAGG - Intergenic
942997244 2:182277483-182277505 CATATGCAGTGAGACTATGGTGG - Intronic
943632882 2:190273858-190273880 CAGATGCAGTGAGACAATCATGG + Intronic
946336181 2:219038260-219038282 CAGATGCAGAGGGAAGAGTCAGG + Intronic
946657695 2:221966033-221966055 CAGAGGCTGTGAGAACCTGCAGG - Intergenic
947104633 2:226655638-226655660 AAGATGCTGGGAGAAGGTGCAGG - Intergenic
947414185 2:229876404-229876426 CAAATGAGATGAGAAGATGCTGG - Intronic
948851597 2:240710860-240710882 GACATGCAGTGAGACGATGATGG + Intergenic
948883827 2:240873326-240873348 CAGAAGCAGTGGGAAGAGGAAGG + Intronic
1168868153 20:1106518-1106540 CAGATGAGATGAGAAGATGCTGG + Intergenic
1171384885 20:24763425-24763447 CACTTGAAGTGAGAAGCTGCTGG - Intergenic
1171962587 20:31505449-31505471 GAGATGCAGAGAGAGGATCCTGG + Intergenic
1172062272 20:32194779-32194801 CAGATGCAGTCAGCAGTTTCTGG - Exonic
1172627280 20:36354594-36354616 GAGATGCAGTGAGGGGATCCTGG - Intronic
1173575658 20:44111691-44111713 CAGAGCCCGTGAGCAGATGCGGG + Exonic
1173847717 20:46198577-46198599 CAGCTGCATTGAGAAGAGCCTGG - Intronic
1174532433 20:51224752-51224774 CAGAAGCTGTGTGAAGATGGAGG + Intergenic
1175339179 20:58217070-58217092 CAAAAGGAGTGAGAAGATGTGGG - Intergenic
1175526046 20:59634382-59634404 AAGATTCAATGAGAAAATGCAGG + Intronic
1175530320 20:59670540-59670562 CAAATGCAGAGAGAACATGGAGG - Intronic
1176187782 20:63790832-63790854 CAGAGGCCGTGAGAGGACGCCGG + Exonic
1176457619 21:6928025-6928047 CAGATGCAGCTGGAAGATGGTGG + Intergenic
1176835791 21:13793109-13793131 CAGATGCAGCTGGAAGATGGTGG + Intergenic
1177359001 21:20045203-20045225 CAGATGCAGTGACACGGTGCTGG - Intergenic
1178225205 21:30708766-30708788 CAGAAGCAGTGAGAAGCTGTGGG + Intergenic
1178420028 21:32436004-32436026 CAGAAACAGTGAGACGTTGCAGG + Intronic
1178895934 21:36556975-36556997 CAGAAGCAGAGAGTAGATGGTGG - Intronic
1179348873 21:40588161-40588183 CAGCTGCTCTGAGAAGAGGCAGG + Intronic
1179996498 21:44976771-44976793 CAGATGCAGCTGGAAGATGGCGG + Exonic
1180073268 21:45449267-45449289 CAGGTGCGGGGAGAAGAGGCAGG + Intronic
1180248320 21:46563099-46563121 GACATGCAGGGAGAAGATGGAGG + Intronic
1180593130 22:16957395-16957417 CAGATGCAGTGAGGAAATCGAGG - Intergenic
1181778311 22:25175631-25175653 ATGATGCAGTGACATGATGCTGG - Intronic
1181926670 22:26365255-26365277 GGGATGCAGAGAGAGGATGCTGG + Intronic
1181939348 22:26463476-26463498 CAGATGCAGTGAGATAATGCAGG - Intronic
1181979482 22:26755953-26755975 CAGATTAAGTGAGAGGATACAGG - Intergenic
1182074158 22:27483649-27483671 CAGCCGCAGAGAGGAGATGCTGG + Intergenic
1182325497 22:29509555-29509577 CAGATGAGGTGAAAGGATGCTGG + Intronic
1183931272 22:41237488-41237510 CAGGTGCAGGGAGAAGAGGCTGG + Exonic
1184779686 22:46640861-46640883 CAGCTGAAATGAGAGGATGCTGG - Intronic
1184941561 22:47769854-47769876 CAGATGCAGTGAGCAGAGGTGGG - Intergenic
1184989124 22:48155354-48155376 CAGCTGCCGTGGGAAGATGCCGG + Intergenic
1185171712 22:49298170-49298192 CAGATGCGGTGAGGAAATGCTGG + Intergenic
1185292136 22:50032445-50032467 CAGAGGCAGTGAGCAGGTGAGGG + Intronic
949260785 3:2100060-2100082 CAGATTCGGTGCGAAGAAGCTGG + Intronic
949636759 3:5990841-5990863 CAGAGGCAGAGAGAATAGGCGGG + Intergenic
950002545 3:9668399-9668421 AAAATTCAGTGAGAAGATGATGG + Intronic
950563534 3:13749848-13749870 GAGATGAAGTGAGAGGATTCAGG - Intergenic
950901162 3:16499063-16499085 CAGATGCAGACAGAAGACACAGG + Intronic
951508801 3:23479361-23479383 CAGATGCATTGTTCAGATGCAGG - Intronic
951655644 3:25005122-25005144 CAGAGGCAGTGAGAAGTGGTTGG - Intergenic
952277649 3:31892786-31892808 CAGATGCAGTGGGAAGACCAGGG + Intronic
952752314 3:36834832-36834854 CAGATGCTTTGAGCAGATTCAGG - Exonic
954411634 3:50373709-50373731 GAGATGCAGGGAGAAGAGGAGGG + Intronic
954891876 3:53938070-53938092 CAGTTGCAGAGAGAAGATTAGGG - Intergenic
955395665 3:58555530-58555552 CTGAGGCAGTGAGAAGACCCAGG - Intergenic
955482650 3:59404942-59404964 CTGATGGAGTGAGCACATGCCGG - Intergenic
955556044 3:60138567-60138589 AGGATGCAATGAGAAGAGGCAGG - Intronic
957464968 3:80576899-80576921 CAGAAGCATTGAGAAAATGATGG - Intergenic
958731760 3:97967511-97967533 CAGATGAAGTTAGAAGCAGCTGG - Exonic
958739719 3:98054907-98054929 CAGATGCAATGAGAGGAACCGGG - Intergenic
959496787 3:107061075-107061097 CAGCAGCAGTGAGAGGAGGCAGG + Intergenic
960051844 3:113246823-113246845 GAGAGGGAGTGAGAAGGTGCAGG - Intronic
961424684 3:126835656-126835678 GAGCTGCAGTGAGAAGCAGCAGG + Intronic
961883976 3:130083492-130083514 CAGAAACAGTGAGACGTTGCAGG - Intronic
962090528 3:132239656-132239678 CAGCTGCAGAGAGAAGAAGCTGG + Intronic
964095178 3:152923076-152923098 CAAATGTAGTGTGAAAATGCAGG + Intergenic
964435417 3:156646470-156646492 CAGATGCAGTGATAAGAAAGGGG - Intergenic
966125435 3:176571126-176571148 TAGAAGCACTGAGAGGATGCAGG - Intergenic
967860577 3:194148395-194148417 CAGATGCAGGGATGAGATACAGG - Intergenic
969820803 4:9718802-9718824 CAGAAACAGTGAGATGTTGCAGG + Intergenic
970132613 4:12887818-12887840 TAGATACAGAGAGAAGATGATGG + Intergenic
970674723 4:18435856-18435878 GAGATGCAGTGGGGAGGTGCTGG + Intergenic
971235723 4:24840290-24840312 CAAAGGCAGGCAGAAGATGCAGG + Intronic
971395659 4:26224811-26224833 CAGAAGCAGTCACAAGATACTGG + Intronic
972855744 4:43104628-43104650 CAAATGCACTTCGAAGATGCAGG - Intergenic
975105448 4:70563708-70563730 CAGATGCATAGAGAAGAGACTGG - Intergenic
975886615 4:78973966-78973988 CAGAGACAATGAGAAGATGAGGG + Intergenic
976208784 4:82646700-82646722 GAGATGCATCCAGAAGATGCAGG - Intronic
976367350 4:84245889-84245911 CAGATGCAGTCAGCAGTTTCTGG + Intergenic
978535191 4:109754635-109754657 CAAATTCAGTGAGAAGACACAGG - Intronic
982239246 4:153282158-153282180 CATCTCCAGTGAGATGATGCTGG - Intronic
984836729 4:184029178-184029200 CAGATGCAAAGAGAAGGAGCAGG - Intergenic
985807666 5:2059108-2059130 CAAAGGCAGTGAAAAGATCCTGG - Intergenic
986561051 5:9061210-9061232 CAGATGCAGTGTTATGATCCAGG - Intronic
989427633 5:41315145-41315167 AATATGCTGTCAGAAGATGCTGG - Intronic
990324352 5:54660332-54660354 CAGATGCTGTGTGAAGATGAAGG - Intergenic
990776793 5:59312793-59312815 GAAATGCAGGGACAAGATGCAGG + Intronic
995601885 5:113806525-113806547 CACATGAATTGAAAAGATGCTGG - Intergenic
1000913941 5:167057462-167057484 GTAATGCAGTGATAAGATGCAGG + Intergenic
1000923291 5:167163430-167163452 CGGATACAGTGAGAAAATACTGG + Intergenic
1001385898 5:171338456-171338478 CAGATGCAGCGGGAAGGTGGTGG - Intergenic
1001861450 5:175059171-175059193 AAGCTGGAGTGAGAAGATGTAGG - Intergenic
1001874099 5:175184462-175184484 CAGATGGAGTGAGATGGGGCTGG - Intergenic
1002432629 5:179212304-179212326 CAGGTGCAGTGAGCAGGTGTGGG + Intronic
1002834429 6:853951-853973 AAGATGCAATGAGAAGATATTGG + Intergenic
1003013890 6:2452277-2452299 CAGAGGGGCTGAGAAGATGCTGG + Intergenic
1003193848 6:3897687-3897709 CAGATGCTGTTAGAAGATGATGG - Intergenic
1004088002 6:12470945-12470967 AGGATGAAGTGAGAAAATGCAGG + Intergenic
1005075675 6:21904067-21904089 CAAAGGCAGTGGGAAGATGGAGG - Intergenic
1005315788 6:24601607-24601629 CTGTTGCAGTGGGAAGCTGCAGG + Intronic
1005843993 6:29763269-29763291 CAGGGGCAGTGGGAAGATGAGGG - Intergenic
1005922495 6:30415036-30415058 CAGATCCAGTGGGAAGAGACAGG - Intergenic
1006059660 6:31410868-31410890 CAGATCCAGTGGGAAGAGACAGG - Intronic
1007054717 6:38870995-38871017 CATATGCAGTCAAAAGATTCAGG - Intronic
1007303442 6:40886343-40886365 TAGATGCAGAGAGAATGTGCCGG + Intergenic
1010412828 6:75580229-75580251 CATATGCAGTGTGAAAATACTGG + Intergenic
1010922721 6:81703957-81703979 CAACTGCAGTGAGAAGATAGTGG - Intronic
1011440897 6:87386192-87386214 CAGATTTGGTGAGAAGATGGGGG + Intronic
1015946930 6:138512565-138512587 CAGCTGCAGAAAGAAGAGGCTGG - Intronic
1016420984 6:143882874-143882896 CAGAAGGACTGAGAAGATGCTGG - Intronic
1016797586 6:148134283-148134305 CAGAGGTAGTGATAATATGCTGG - Intergenic
1018185109 6:161260089-161260111 CTGAAGCAGTGAGAGGCTGCTGG - Intronic
1018866663 6:167751748-167751770 CAGATCCAGGGAGATGGTGCTGG + Intergenic
1019227883 6:170530096-170530118 CTTCTGCAGTGAGAAGCTGCTGG - Intergenic
1019528864 7:1493896-1493918 CAGACGCAGGAAGAAGCTGCGGG + Exonic
1020083944 7:5300558-5300580 CATGAGCAGTGAGAAGATGCAGG - Exonic
1021922016 7:25495097-25495119 TGGATGCAGTGAGAGGCTGCAGG - Intergenic
1022022263 7:26412207-26412229 CAGCTGCAGTGAGAATACACAGG + Intergenic
1023480614 7:40629896-40629918 GAGTTGCAGTGAGAAGCTACAGG + Intronic
1024433041 7:49312852-49312874 CATATCCAGTGAGGAAATGCAGG + Intergenic
1025210328 7:57016632-57016654 CATGAGCAGTGAGAAAATGCAGG + Intergenic
1025661627 7:63560215-63560237 CATGAGCAGTGAGAAAATGCAGG - Intergenic
1025996642 7:66531525-66531547 CATATGCAGGGAGGAGCTGCAGG - Intergenic
1026901549 7:74040155-74040177 CACAGGAAGTGAGAAGAGGCTGG - Intronic
1031143893 7:117976512-117976534 CAGGTGAAGTCAGATGATGCAGG - Intergenic
1031817856 7:126461385-126461407 CAGAGGCAGGGAGAAGAGGCTGG - Intronic
1032443455 7:131960246-131960268 CAGTGGGAGTGAGAAGATGGGGG - Intergenic
1033609624 7:142953311-142953333 CAGGTGTGGTGTGAAGATGCTGG - Intronic
1034849944 7:154484228-154484250 CAGATGCGGTGAGGAGAGGGTGG - Intronic
1035241977 7:157538091-157538113 CAGATGGAGAGAGAGGAAGCAGG - Intergenic
1035632332 8:1117547-1117569 CAGATTCAGAGAGAAGAAACAGG + Intergenic
1035981211 8:4374514-4374536 CAGATCTAGAGAGAAGAGGCTGG + Intronic
1036048313 8:5167967-5167989 CAAATGCAATGTGAGGATGCTGG - Intergenic
1037918128 8:22785158-22785180 GAAATGCAGAGAGAAGTTGCCGG - Intronic
1038950035 8:32404123-32404145 CAGATGAAGAGAGAAGACCCTGG + Intronic
1039577057 8:38632158-38632180 CAGAGGCAGCGAGGAGATGCAGG + Intergenic
1039922970 8:41906151-41906173 GAGATGCAGGGAGAAGACACAGG - Intergenic
1040588810 8:48770204-48770226 CAGATGCATTATCAAGATGCAGG + Intergenic
1040728832 8:50417922-50417944 CAAATGCAGTGGGAAATTGCTGG - Intronic
1041726460 8:61022173-61022195 CAGATGCCGTGAGGATGTGCAGG - Intergenic
1042517416 8:69674133-69674155 AAAATGCAGTGAGAATATGATGG - Intronic
1046545747 8:115648219-115648241 CAGAGGGAGTGGGAAGAAGCGGG + Intronic
1047218123 8:122895645-122895667 TAGATGCTGTGTTAAGATGCAGG + Intronic
1047311426 8:123695777-123695799 GAGATACAGAGAGAAGAGGCGGG + Intronic
1047530578 8:125670500-125670522 CATAGGCAGTGAGAAGATGGGGG + Intergenic
1050163552 9:2742084-2742106 CAGATACAGTGACCAGAGGCTGG + Intronic
1050375972 9:4973525-4973547 TGGATGCAGTGAGAAGTTACAGG - Intergenic
1052900928 9:33794502-33794524 TAGATGCAGTGAGATTATGCTGG - Intronic
1052980029 9:34441348-34441370 AAGATTCAGAGAGCAGATGCAGG + Intronic
1053432856 9:38054637-38054659 CAAAGGCAGAGAGAAGCTGCAGG - Intronic
1053523905 9:38809686-38809708 CAGAAGCAGTGACAAGAGGATGG - Intergenic
1054196138 9:62034098-62034120 CAGAAGCAGTGACAAGAGGATGG - Intergenic
1054642267 9:67554591-67554613 CAGAAGCAGTGACAAGAGGATGG + Intergenic
1056517700 9:87370986-87371008 GAAATGCAGTGTGAAGCTGCAGG + Intergenic
1057128728 9:92638774-92638796 CAGATGGTGGGAGAAGCTGCTGG + Intronic
1058114796 9:101072590-101072612 AAGATGCATTCAGTAGATGCTGG + Intronic
1058138532 9:101334286-101334308 CAGAAGCAGCGGGAGGATGCTGG - Intergenic
1058280010 9:103102979-103103001 CATATCCACTGTGAAGATGCCGG + Intergenic
1060190548 9:121589623-121589645 CAGATGCAGGGGGAAGAGACAGG - Intronic
1060393646 9:123300502-123300524 AGCTTGCAGTGAGAAGATGCTGG + Intergenic
1060449172 9:123721102-123721124 CAGGTGAAGTGAGAAGTTGTGGG - Intronic
1061430091 9:130525529-130525551 CTGATGCAGTGAGAATTTGTGGG + Intergenic
1061640122 9:131947053-131947075 CAGATACTGTGACAAGGTGCTGG - Intronic
1061703078 9:132430849-132430871 CAGATGCAGCGGGCAGATGAGGG + Intronic
1061826379 9:133260834-133260856 CAGCTGCTGTGAGAAGAAGGGGG + Intronic
1185682269 X:1898438-1898460 CAGGCTCAGTGAGAACATGCTGG - Intergenic
1187282043 X:17864754-17864776 CAAATACAGAGAGAAGATCCTGG + Intergenic
1187435649 X:19266466-19266488 CAGATGGAGTGAGTACAAGCAGG - Intergenic
1187545922 X:20252597-20252619 CAGAGGCAGTGAGGTGATACAGG - Intronic
1189611538 X:42741646-42741668 CAGATGCAGTGAAAGCATGAGGG - Intergenic
1192246173 X:69373490-69373512 GAGATGCAGTTAGATGATGCAGG - Intergenic
1192353382 X:70376556-70376578 CAGTTGGAGTGAAAAGATGATGG + Intronic
1192539473 X:71955980-71956002 CAGAGGCAGAGAGAAGCTCCTGG + Intergenic
1193414766 X:81208565-81208587 CAGATTAAGAGAGAAGCTGCTGG + Intronic
1195067945 X:101254427-101254449 CACATCCAGTGAGAACATGAGGG + Exonic
1196894384 X:120320707-120320729 CAGAAGTGGTGAAAAGATGCTGG - Intergenic
1198539266 X:137619489-137619511 CAGAACCAGTCAGAAGATGCAGG - Intergenic
1200136801 X:153879201-153879223 CAGACAGAGTGAGAAGAGGCAGG + Intronic
1201414840 Y:13738174-13738196 CAGAAACAATGAGAAGAGGCCGG + Intergenic