ID: 1151880006

View in Genome Browser
Species Human (GRCh38)
Location 17:76889154-76889176
Sequence AGATGCAGTGAGAAGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 369}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151880002_1151880006 5 Left 1151880002 17:76889126-76889148 CCATGCCAGGTACACCGAGCTGT 0: 1
1: 0
2: 2
3: 17
4: 88
Right 1151880006 17:76889154-76889176 AGATGCAGTGAGAAGATGCAGGG 0: 1
1: 0
2: 3
3: 38
4: 369
1151880003_1151880006 0 Left 1151880003 17:76889131-76889153 CCAGGTACACCGAGCTGTTTTGC 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1151880006 17:76889154-76889176 AGATGCAGTGAGAAGATGCAGGG 0: 1
1: 0
2: 3
3: 38
4: 369
1151880004_1151880006 -9 Left 1151880004 17:76889140-76889162 CCGAGCTGTTTTGCAGATGCAGT 0: 1
1: 0
2: 1
3: 20
4: 229
Right 1151880006 17:76889154-76889176 AGATGCAGTGAGAAGATGCAGGG 0: 1
1: 0
2: 3
3: 38
4: 369
1151880000_1151880006 14 Left 1151880000 17:76889117-76889139 CCAGGTCTCCCATGCCAGGTACA 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1151880006 17:76889154-76889176 AGATGCAGTGAGAAGATGCAGGG 0: 1
1: 0
2: 3
3: 38
4: 369
1151879999_1151880006 15 Left 1151879999 17:76889116-76889138 CCCAGGTCTCCCATGCCAGGTAC 0: 1
1: 0
2: 3
3: 9
4: 148
Right 1151880006 17:76889154-76889176 AGATGCAGTGAGAAGATGCAGGG 0: 1
1: 0
2: 3
3: 38
4: 369
1151880001_1151880006 6 Left 1151880001 17:76889125-76889147 CCCATGCCAGGTACACCGAGCTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1151880006 17:76889154-76889176 AGATGCAGTGAGAAGATGCAGGG 0: 1
1: 0
2: 3
3: 38
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151880006 Original CRISPR AGATGCAGTGAGAAGATGCA GGG Intronic
900679075 1:3906350-3906372 AGCTGCAGAGAGAGGCTGCAGGG + Intergenic
901226026 1:7613479-7613501 GGCTGCAGGGAAAAGATGCACGG + Intronic
902720658 1:18302056-18302078 GGAGGCAGTGAGAAGGTGCCAGG - Intronic
903073098 1:20737904-20737926 AGATGCAGAGAAAAGAGGAATGG + Intergenic
903376099 1:22866990-22867012 GGATGCAGTGAGGTCATGCATGG - Intronic
904170992 1:28592244-28592266 AGATGAAGTGAGGAGGGGCATGG - Exonic
904487336 1:30835487-30835509 AGAGGCAGTGAGGAGAAGCAAGG - Intergenic
904889639 1:33770248-33770270 AAATCCAGAGAGAAGATGCTTGG + Intronic
906249948 1:44303225-44303247 AGTGGCAGTGAGAAAATCCAGGG + Intronic
906873364 1:49509202-49509224 AGATACAAGGAGAAGATTCAAGG + Intronic
906882294 1:49604846-49604868 AGATGAAGTCTGAAGCTGCAAGG - Intronic
906909155 1:49927438-49927460 AGATGGAGTGAGTACAAGCAGGG + Intronic
908457371 1:64316998-64317020 AGAAGCAGAGAGTAGAAGCATGG - Intergenic
908953776 1:69595695-69595717 AGATGTGGTGAAATGATGCATGG + Intronic
909106691 1:71418961-71418983 AAATGTAATGAGAAGATGTAAGG - Intronic
909683490 1:78319378-78319400 AGAGGCAGTGAGAGGAGGGAGGG + Intronic
910092187 1:83478582-83478604 AGATTCAGTGAGGCAATGCATGG - Intergenic
910938830 1:92510937-92510959 AAGTGAAGTGAGATGATGCATGG - Exonic
911781029 1:101878666-101878688 AGATGGACCCAGAAGATGCATGG - Intronic
913496339 1:119431570-119431592 AGAGGCAGAGGGAAAATGCAGGG + Intergenic
914012484 1:143790411-143790433 AGAAGGAGGGAGAAGAAGCAGGG + Intergenic
914165348 1:145170772-145170794 AGAAGGAGGGAGAAGAAGCAGGG - Intergenic
914651113 1:149699021-149699043 AGAAGGAGGGAGAAGAAGCAGGG + Intergenic
914686501 1:149984557-149984579 AGTTTCAATGAGAAGATGGAAGG - Intronic
915997391 1:160577220-160577242 AGAAGCAGTGGAGAGATGCAGGG - Intronic
916313190 1:163419287-163419309 AGAAGCCGTGAGAAGGTACACGG - Intergenic
916825543 1:168438512-168438534 AGATGCCTTGAAAAGATGCGGGG - Intergenic
919498584 1:198309167-198309189 ATATACAGTGAGCAGATGCATGG + Intronic
919647464 1:200109402-200109424 AGATGCAATGAGATAATGGATGG - Intronic
920044969 1:203127304-203127326 ATATGGGATGAGAAGATGCAGGG + Exonic
920586242 1:207164904-207164926 AGAGGCAGAGAGAAGAGACAGGG - Intergenic
921068116 1:211637194-211637216 GGAGGCAGTGAGAAGGGGCAGGG + Intergenic
922696311 1:227732784-227732806 AGAGGCACTGAGAAGCTGCGCGG + Intronic
923205927 1:231758833-231758855 AGATCCAGTGGAAAAATGCACGG - Intronic
923296917 1:232603238-232603260 AAATGTATTGAGAAGATCCAAGG + Intergenic
1062850747 10:740645-740667 AGATGCACAGAGAAAATGGAAGG - Intergenic
1063087886 10:2836093-2836115 AGCTGCAGTGATAAAACGCATGG - Intergenic
1063649248 10:7917207-7917229 AAGTGCTGTGAGAAGAAGCAAGG + Intronic
1065111003 10:22439433-22439455 AGATGTAGTGAAAGGATGAAAGG - Intronic
1065565572 10:27004593-27004615 AGATGCAATGAGAAGATCACTGG + Exonic
1065825121 10:29563864-29563886 AGATGCATTAAGGAGATACATGG - Intronic
1065941878 10:30572262-30572284 AGACACAGTGAGAAGGTGCCAGG + Intergenic
1067538154 10:47131986-47132008 GGCTGCACTGAGGAGATGCAAGG + Intergenic
1067695891 10:48535428-48535450 AGATGCAGGGAGAGGGGGCAGGG + Intronic
1067837229 10:49649084-49649106 GGATGCAGGGAGAAGATTCTAGG - Intronic
1068508842 10:57937996-57938018 AGTTGAAGTGAGAGGAAGCAGGG + Intergenic
1070822079 10:79363423-79363445 AGAAGCAGTTAGAAAAGGCAAGG - Intergenic
1070872425 10:79768361-79768383 TGCTACAGTGAGAAGATGCCAGG - Intergenic
1071639346 10:87290513-87290535 TGCTACAGTGAGAAGATGCCAGG - Intergenic
1071655891 10:87447436-87447458 TGCTACAGTGAGAAGATGCCAGG + Intergenic
1073033528 10:100547203-100547225 AGAAACATTGAGAAGATGCTTGG + Exonic
1074418339 10:113286756-113286778 GGATGAAGTGAGATGATGGAAGG - Intergenic
1075488640 10:122847703-122847725 AGAAGCAATGAGATGATGCAGGG - Intronic
1075495477 10:122915534-122915556 AGAGGCAGTGAGATGAGGCCAGG + Intergenic
1075745702 10:124725854-124725876 AGATGCAGTGGGAAAATGAAAGG + Intronic
1075835543 10:125449765-125449787 AGAGGCTGTGATGAGATGCAGGG - Intergenic
1076043631 10:127273204-127273226 AGATGCAGTGGGTGGATGTAGGG + Intronic
1076224665 10:128764522-128764544 AGAGGCAGTGGGGAGATGCTGGG + Intergenic
1077659731 11:4056932-4056954 AGATGCAGTGAAAAAAAGCAGGG - Intronic
1077990140 11:7400140-7400162 AGCAGCAGTGAGCAGAGGCATGG + Intronic
1078369324 11:10732073-10732095 AGAGAGAGAGAGAAGATGCAAGG - Intergenic
1078469503 11:11575726-11575748 AAATGCTGTGAAAAGATGAAAGG + Intronic
1078525693 11:12099408-12099430 GGATGCAGAGAGAAAAAGCATGG + Intronic
1079257685 11:18846786-18846808 AGATGCACTCCAAAGATGCATGG + Intergenic
1079611090 11:22433194-22433216 CGCTGCAGTGGGGAGATGCAAGG + Intergenic
1083324096 11:61864824-61864846 AGAGGCAGTGAGGTGAGGCACGG - Intronic
1084537266 11:69764542-69764564 AGATGGAGTGAGAGGCTGCTGGG + Intergenic
1085262119 11:75212243-75212265 AGATTGAATGAGATGATGCAAGG - Intergenic
1086115584 11:83246029-83246051 AGAGGCAGTGAGCAAGTGCATGG + Intronic
1086540061 11:87898391-87898413 ATATACATTGAGAAGATTCATGG - Intergenic
1088607957 11:111549239-111549261 AGATGCACTGAGAAGAGACATGG - Intronic
1089164868 11:116468090-116468112 AAATCAAGTGAGAAAATGCAGGG + Intergenic
1090190699 11:124765003-124765025 AGATGCAGAAAAAAAATGCATGG + Intergenic
1090382982 11:126339703-126339725 ACAGGCAGAGAGAAGCTGCAGGG - Intronic
1090425304 11:126603293-126603315 AGTTGCTGTGAGATGATGCCAGG - Intronic
1090735897 11:129611979-129612001 TGGTGCAGTGAGAAGAGGGAAGG - Intergenic
1091319168 11:134637702-134637724 AGAGGCAGTGAGATGATGATCGG - Intergenic
1091337618 11:134784273-134784295 GGATGCAGTGAGCAGGTGCTGGG + Intergenic
1091632587 12:2173156-2173178 AGATGTAGTGGGATGATGGAGGG + Intronic
1091863360 12:3806724-3806746 TGATGCATTGAGAAGAAGCAAGG - Intronic
1091968341 12:4764363-4764385 AGTAGCAGTGAGAAGATGGCGGG - Intronic
1092222832 12:6726874-6726896 AGTTGAAGAGAGAAGATGAATGG + Intronic
1093202532 12:16206852-16206874 AGCTGCAGAGAGAACAGGCATGG + Intronic
1094426229 12:30320173-30320195 AGAGGCAGTGACAGGATTCAGGG + Intergenic
1094773949 12:33699537-33699559 ACATGCAGTGATAAACTGCACGG - Intergenic
1095427393 12:42091928-42091950 AGAGGCTGTGAAAAGATCCACGG - Intronic
1095689605 12:45071849-45071871 AGAAGCACTGAGAAAATCCAAGG + Intergenic
1097818156 12:64098332-64098354 AGCTGCAGTGTGAGAATGCAGGG - Intronic
1098935061 12:76469376-76469398 AGATGCAGTGACAAGACAGATGG - Intronic
1100323511 12:93519080-93519102 AGATGAAGAGAGAAGATTCCAGG + Intergenic
1100605950 12:96152312-96152334 AGTTGCAGTGAGAAGGTGGCTGG - Intergenic
1101143489 12:101819482-101819504 AAATGAAGTGAGAAAATGAAGGG + Intronic
1101506214 12:105349181-105349203 GGATGCAGAGAGAAGGGGCATGG - Intronic
1101740763 12:107498137-107498159 AGATGCAGAGAGGAGTTACAAGG + Intronic
1101765242 12:107691950-107691972 AGATGCAGTGAAAAGAATGAAGG - Intronic
1102024152 12:109703975-109703997 AGCTGCAGTGGGAAGATGGATGG - Intergenic
1102524838 12:113505029-113505051 AGATGAAGTGAGATGATTTATGG - Intergenic
1102820396 12:115904139-115904161 AGATCCAGTGAAAATCTGCATGG - Intergenic
1102907055 12:116684826-116684848 GGATTCAGTGGGATGATGCATGG + Intergenic
1103170884 12:118818773-118818795 AGATTCAGTAAGAAAATGCATGG + Intergenic
1105073463 12:133252807-133252829 AGCTGAGGTGAGAAGGTGCAGGG - Intergenic
1105315808 13:19261539-19261561 GGATGCAATGAGAAGATCCCAGG + Intergenic
1105411958 13:20177947-20177969 AGATGCAGTGAGCACTGGCAGGG - Intergenic
1105803565 13:23934280-23934302 AGATGCAGTGAGACGATTACAGG - Intergenic
1105965929 13:25384880-25384902 GGAGGCAGTGAAAAGCTGCAGGG + Intronic
1106456630 13:29933692-29933714 GGGTGCAGTGAGACGATGCATGG - Intergenic
1107008552 13:35643657-35643679 ATGTGCTGTGAGAATATGCAGGG + Intronic
1108111965 13:47083137-47083159 AGAAGCAGTAAGAATATACATGG - Intergenic
1108997632 13:56754502-56754524 AAATTCAGTGAGAAGATACTGGG - Intergenic
1109044203 13:57387171-57387193 AGATGTAGTGAGAAGAACCGAGG + Intergenic
1111329032 13:86738206-86738228 AGATGTTGGGAAAAGATGCAGGG + Intergenic
1111820990 13:93214943-93214965 ACATGCCTTGAGAAGATACAGGG - Intergenic
1112957882 13:105084089-105084111 AGATGTAGTGAGAACAGGGAAGG - Intergenic
1116199828 14:41777972-41777994 AGAACCATTAAGAAGATGCATGG + Intronic
1116468433 14:45259913-45259935 AGATGCAGTGAAAGCCTGCAAGG - Intergenic
1118810585 14:69270500-69270522 AGCTGCTGTGAGAAGATGAAGGG - Intronic
1120583351 14:86280732-86280754 AGATGGAGGGAGAAAATGAAGGG - Intergenic
1121840075 14:97126494-97126516 AGATGAAATGAAATGATGCAGGG + Intergenic
1122905453 14:104799724-104799746 AGAAGCATTGAGAAGATGTGAGG - Intergenic
1122916283 14:104860506-104860528 AGATGGAGGGTGGAGATGCAGGG - Intergenic
1123213227 14:106781667-106781689 ATATGCAGAGGGAAGAAGCAGGG - Intergenic
1123668385 15:22628556-22628578 AGATGGATAGAGAGGATGCAAGG - Intergenic
1123685508 15:22794401-22794423 AGATGGAGTGTGGAGATGGATGG + Intronic
1124524362 15:30435017-30435039 AGATGGATAGAGAGGATGCAAGG - Intergenic
1124534303 15:30531206-30531228 AGATGGATAGAGAGGATGCAAGG + Intergenic
1124764345 15:32476405-32476427 AGATGGATAGAGAGGATGCAAGG - Intergenic
1124774289 15:32572693-32572715 AGATGGATAGAGAGGATGCAAGG + Intergenic
1125202513 15:37112310-37112332 AGGGGCAGTGAGAACATGCCAGG + Intergenic
1126118408 15:45229567-45229589 GGATTCAGTGAGATAATGCATGG + Intergenic
1127548999 15:60018404-60018426 AGAAGTAATGAGAAGATGGATGG + Intronic
1128894543 15:71360282-71360304 AGATCCAGTTGGAAGCTGCAGGG + Intronic
1128938989 15:71771681-71771703 AGATGCAGTGACTAGACTCAAGG + Intronic
1129789137 15:78329041-78329063 AGATGATGTGAAAAGAGGCAGGG - Intergenic
1129999117 15:80032119-80032141 AGATGCAAGGAGGAGCTGCAGGG + Intergenic
1130173511 15:81543496-81543518 AAATGGCGTGAGAATATGCATGG - Intergenic
1131829370 15:96344398-96344420 AGATGAAGTGAGGAGAGGCAAGG - Intergenic
1131866529 15:96717194-96717216 AGATTCACTGAGAAGATGCATGG + Intergenic
1132018456 15:98339433-98339455 AGATGTCCTGGGAAGATGCAGGG - Intergenic
1134826016 16:17285050-17285072 AGATGCAGAGAGAGGAAGCAGGG + Intronic
1135002619 16:18789936-18789958 CGCAGCAGTGAGAAGCTGCACGG + Intronic
1138557768 16:57782636-57782658 AGCTGCAGTCAGAAGGTTCAAGG + Intronic
1138627877 16:58266806-58266828 TGATGCAGTGGGAATCTGCAAGG + Intronic
1140764199 16:78140615-78140637 AGATGATGTGAAAAGATACAGGG - Intronic
1141277530 16:82602145-82602167 AGAGGCAGCGTGAAGATGAATGG - Intergenic
1141661391 16:85443465-85443487 AGATCCAGTGAGGAAATGGATGG + Intergenic
1143309136 17:5973808-5973830 AGACCCAGGGAGATGATGCAAGG + Intronic
1144577038 17:16435856-16435878 AGATGCAAAGAGAAGGTGAAGGG - Intronic
1146465349 17:33081959-33081981 AGAGGCAGTGGTTAGATGCAAGG + Intronic
1148973416 17:51505163-51505185 TGATGCAGTGAGAAGGTGGTAGG + Intergenic
1149543227 17:57484247-57484269 AGGTGGAGGGAGAAGATGCAGGG - Intronic
1149651433 17:58278785-58278807 AGAGGCAGTGAGCAAATGGACGG + Intronic
1150167269 17:62955930-62955952 CGATGCAGTGAGAATCTGCGTGG + Intergenic
1150904337 17:69321528-69321550 AAACGCAGTAAAAAGATGCATGG + Intronic
1151880006 17:76889154-76889176 AGATGCAGTGAGAAGATGCAGGG + Intronic
1152367481 17:79864939-79864961 AGTCGCAGAGAGAAGAGGCAAGG - Intergenic
1152491394 17:80636962-80636984 AGATTCTGGGAGTAGATGCACGG + Intronic
1152535116 17:80946130-80946152 ACAAGCAGTAAGAAGATGCTAGG + Intronic
1153324554 18:3804632-3804654 AGACGCAGTGAAAGGATGCTGGG + Intronic
1154160351 18:11976816-11976838 AGTGGCAGTGAGAAGGTGAAAGG - Intergenic
1154330652 18:13426558-13426580 AGCTGCAGTAGGAAGAGGCACGG - Intronic
1155031730 18:21990905-21990927 AGCTGGATTTAGAAGATGCAAGG - Intergenic
1155576251 18:27250542-27250564 AATTGCAGTGATAAGATCCATGG - Intergenic
1156235834 18:35203978-35204000 AGATGCAGTGATAAGTTTCTTGG + Intergenic
1156370504 18:36468119-36468141 AAAGGCAGTGAGAACAAGCAAGG + Intronic
1156836911 18:41565961-41565983 AGAGCCACTGGGAAGATGCATGG + Intergenic
1157560770 18:48644348-48644370 AGCTGCAGTGAGAAGATGTCTGG + Intronic
1158629089 18:59096405-59096427 ACAGGCAGTGAGAAGAGGCAGGG + Intergenic
1159493229 18:69165939-69165961 AGATGGTGTGAGGAGATGCTTGG - Intergenic
1159967076 18:74605282-74605304 AGCTGCAGACAGCAGATGCAAGG - Intronic
1160354313 18:78214218-78214240 AGATGCAGTGTGATGGTGCTTGG - Intergenic
1160591342 18:79946465-79946487 ACCTGCCGTGAGAAGAGGCATGG - Intronic
1160790001 19:918867-918889 AGATGCACTCAGAAGCTGGAGGG + Intronic
1161116550 19:2500231-2500253 AAATGCAGTTAGAAGACACAGGG + Intergenic
1161128319 19:2572976-2572998 AGATCCACAGAGAATATGCATGG - Intronic
1163580139 19:18133985-18134007 AGATGCACCCAGAAGGTGCACGG - Intronic
1164542242 19:29129655-29129677 AGATGATGTGAGAACACGCAAGG + Intergenic
1164938006 19:32229908-32229930 GGAAGCAGTGAGAACATACATGG + Intergenic
1165213462 19:34253497-34253519 AGATGCAGTGTGGAGAAGGAAGG - Intergenic
1165833620 19:38741909-38741931 AGCTGGTGGGAGAAGATGCAGGG + Exonic
1166295434 19:41887193-41887215 AGATGGAGGGAGGAGAGGCAGGG + Intronic
925884714 2:8384698-8384720 AGATTCAGTGAAAGGATGCATGG - Intergenic
925892335 2:8445754-8445776 AGATGCAGTGAAAGGAGACAGGG - Intergenic
926797577 2:16631387-16631409 AGATACAGTGAGTAGATGAGTGG + Intronic
927180093 2:20439600-20439622 AGATGCAGTGAGCAGAAGGGAGG - Intergenic
927290498 2:21400421-21400443 AGCTAGAGTAAGAAGATGCATGG - Intergenic
930283264 2:49396688-49396710 AGATGGAGTGAGTACAAGCAGGG + Intergenic
931144361 2:59500933-59500955 GGATCCAGTGAGAAAATGTATGG - Intergenic
932001279 2:67887225-67887247 AGATGCCATGAGAAGATGAAGGG - Intergenic
932084553 2:68746657-68746679 AGATGGAGGGAGAAGGGGCATGG + Intronic
932694974 2:73948328-73948350 AAATGCATTAAGAAGCTGCATGG + Intronic
935338226 2:102036313-102036335 AAATGCTGAGATAAGATGCACGG - Intergenic
935455906 2:103267776-103267798 AGATGAGGTGAGAAGACACAAGG + Intergenic
935790834 2:106588548-106588570 AGAAGCAATGAGAAGTTGAACGG - Intergenic
935883706 2:107592847-107592869 AGAATCAGTGAGCAGATCCATGG - Intergenic
937694403 2:124791760-124791782 ATATGCAGGGAAAAGATACAGGG - Intronic
939316949 2:140563854-140563876 AGAAAAAGTGAGAAGATGAATGG + Intronic
939472126 2:142636304-142636326 GGATACAGAGAGAAGAAGCATGG + Intergenic
940029343 2:149244363-149244385 AGATGCAGTGAAAAGATCTAAGG + Intergenic
940155213 2:150649000-150649022 AGAGGCCATGAGAAGATACAGGG + Intergenic
940808914 2:158220897-158220919 AGATGCCCTGAGAAACTGCAAGG + Intronic
940882497 2:158960541-158960563 AGCTGCAGTTAGAATATGCCTGG - Intergenic
942130057 2:172869601-172869623 AAATGCAGTGAGAGGGTGGATGG - Intronic
945078447 2:206064204-206064226 AGAGTCAGTGAGAAAATGGAAGG + Intronic
945206374 2:207337022-207337044 TGATGTAGTGAAAAGATGCCTGG - Intergenic
945897776 2:215504030-215504052 AGTTTCTGTGAGAAAATGCAGGG + Intergenic
946336182 2:219038261-219038283 AGATGCAGAGGGAAGAGTCAGGG + Intronic
946657694 2:221966032-221966054 AGAGGCTGTGAGAACCTGCAGGG - Intergenic
948060036 2:235036164-235036186 AGAGGCAGGGAGAAGATGTTTGG - Intronic
948483490 2:238264976-238264998 AGGAGCTGGGAGAAGATGCATGG + Intronic
948851598 2:240710861-240710883 ACATGCAGTGAGACGATGATGGG + Intergenic
948883828 2:240873327-240873349 AGAAGCAGTGGGAAGAGGAAGGG + Intronic
1170161114 20:13312455-13312477 AGAGGAAGGGAGAAGTTGCAGGG - Intergenic
1170810936 20:19673998-19674020 AGAGGGTGAGAGAAGATGCAAGG + Intronic
1172627279 20:36354593-36354615 AGATGCAGTGAGGGGATCCTGGG - Intronic
1173239883 20:41285062-41285084 ATTTGCAGTGGGGAGATGCAAGG - Intronic
1174098318 20:48107156-48107178 AGATGCAGTGAGATGATGGCTGG - Intergenic
1174140981 20:48413401-48413423 AGCTGCCGGGTGAAGATGCAGGG + Intergenic
1174343743 20:49914910-49914932 AGATGGAATGAGATCATGCAGGG - Intronic
1174888844 20:54367544-54367566 AGATGCAGTAGGCTGATGCAGGG - Intergenic
1176417418 21:6485140-6485162 AGAAGAAGACAGAAGATGCAAGG - Intergenic
1176623222 21:9072357-9072379 TGAGGCACTGAGAAGGTGCAGGG + Intergenic
1179692914 21:43093473-43093495 AGAAGAAGACAGAAGATGCAAGG - Intronic
1180593129 22:16957394-16957416 AGATGCAGTGAGGAAATCGAGGG - Intergenic
1182502523 22:30757757-30757779 ATATGCAGTGGGAAGAGGCCAGG - Intronic
1183929089 22:41225868-41225890 AGATGGCGTGGGAAGAGGCATGG - Exonic
1183931273 22:41237489-41237511 AGGTGCAGGGAGAAGAGGCTGGG + Exonic
1184305018 22:43592150-43592172 AGATTCAGTGGGAATATTCAGGG + Intronic
1184799244 22:46750081-46750103 AGATGAAGGGAGAAGAGGCGTGG + Intergenic
1185240144 22:49738139-49738161 AGCTGCAGTGAGAACCCGCACGG + Intergenic
1185292294 22:50033113-50033135 AGCCGCAGTGAGAAGCAGCACGG - Intronic
949562590 3:5216126-5216148 ATTTGAAGTGAGAAGATACATGG + Exonic
949779480 3:7669793-7669815 AGATGCAGTGAGAGTAAGCCTGG - Intronic
950002546 3:9668400-9668422 AAATTCAGTGAGAAGATGATGGG + Intronic
950783760 3:15415209-15415231 AGATACAATGAGAAAATGTATGG - Intronic
953075558 3:39566899-39566921 GGATGCAGTAAGAAAATACATGG - Intergenic
953200031 3:40770298-40770320 AGAAGCAGAGAGAACAAGCAGGG - Intergenic
953455826 3:43041623-43041645 AGATGAAGTCAGAAGGTGGATGG - Intronic
953837080 3:46356126-46356148 TGATGCAGTGAATACATGCATGG + Intronic
955141700 3:56276228-56276250 ACATCCAGTGATAAGATACAAGG - Intronic
955198004 3:56823398-56823420 AGATGCAGTTAGGATATGCCTGG - Intronic
955353782 3:58213742-58213764 GGATGCAGGGAGGAGATGAAAGG + Intronic
955395664 3:58555529-58555551 TGAGGCAGTGAGAAGACCCAGGG - Intergenic
956050735 3:65245474-65245496 AGAAGAAGGGAGAAGATGAATGG - Intergenic
956361145 3:68449146-68449168 AAATGCACGGAAAAGATGCAGGG + Intronic
957007153 3:74962918-74962940 AGGTGCAGGGAGAACAGGCAGGG - Intergenic
957023782 3:75155298-75155320 AGATGCAAAGAGAACAAGCAAGG - Intergenic
957520617 3:81313781-81313803 AGATGAAGTGAGAATGTTCACGG - Intergenic
958461314 3:94399910-94399932 AGCTGCAGTGTGAAGATATAAGG + Intergenic
959496788 3:107061076-107061098 AGCAGCAGTGAGAGGAGGCAGGG + Intergenic
961820069 3:129571421-129571443 AGATGCAGTGGGAGGAGGCCTGG + Intronic
963504211 3:146163624-146163646 AGATGAAGAGAGAACATGAAGGG - Intronic
963993024 3:151675388-151675410 CAATTCAGTGAGAACATGCATGG - Intergenic
964408666 3:156376379-156376401 AGAGACAGACAGAAGATGCAAGG + Intronic
965360687 3:167735103-167735125 AGATGAAGAGAGATGGTGCACGG + Intergenic
966302622 3:178496322-178496344 ATATGCTGTTAGAAGAAGCAAGG - Intronic
967860576 3:194148394-194148416 AGATGCAGGGATGAGATACAGGG - Intergenic
968182884 3:196610198-196610220 AGAAGCAGTGAGAAGGTCCTAGG - Intergenic
968822657 4:2867237-2867259 AAATGCAGCTAGAAAATGCAAGG - Intronic
969054558 4:4393524-4393546 AGAGGCAGGGAGATGAGGCAGGG - Intronic
969092444 4:4705091-4705113 AGACACAGGGAGAAGATGGATGG + Intergenic
969844916 4:9912916-9912938 AGATTCAGAGAGAAGACGTAAGG + Intronic
970699892 4:18723504-18723526 AGAAGCTGTGAGAACTTGCAGGG - Intergenic
971022556 4:22552186-22552208 ATATGCAATTATAAGATGCAAGG + Intergenic
971957965 4:33446999-33447021 AAATGCAGTGAGCAAATGGATGG - Intergenic
972765365 4:42149025-42149047 AAATGGAGTGAAAAGATGAAAGG - Intronic
973720023 4:53713780-53713802 GGATGGAGTGAGATTATGCATGG + Intronic
975359415 4:73450536-73450558 AGAGTCTGTGAGAAGAAGCAAGG + Intronic
976044864 4:80933326-80933348 AGATGCAGAGAGTAGATTGATGG - Intronic
977008252 4:91600474-91600496 AGATTCTGTTAGAAAATGCAAGG - Exonic
979297348 4:119048790-119048812 AGATGAAGTCAGATAATGCAAGG + Intronic
979318795 4:119299499-119299521 AGAAGCAGTGAGATGAAACAGGG - Intronic
980212402 4:129806684-129806706 ACATGCCTTGAGAAGAGGCATGG - Intergenic
980529072 4:134027173-134027195 AGATCCAGGCAGAAGCTGCATGG - Intergenic
980809761 4:137860769-137860791 ACATTAAATGAGAAGATGCAGGG - Intergenic
981741479 4:148006765-148006787 AAATGCAGTGAGAACCTGCCAGG + Intronic
981824762 4:148927153-148927175 AGATGCACTCAGAAAAAGCATGG + Intergenic
983013872 4:162584466-162584488 AAATGCAGTGAGAAAATAAATGG + Intergenic
983932985 4:173473575-173473597 AGATGCAGAGAGAAAAGGAAAGG + Intergenic
985600030 5:823461-823483 AGATGCTCTGAGTAGATGAATGG - Intronic
985802247 5:2012350-2012372 AAAGGCAGTGTGAAGATGGAGGG - Intergenic
986129358 5:4912581-4912603 AGATGCTGAGAGAAGCTGCAAGG + Intergenic
987183105 5:15386647-15386669 AGATGAAATTAGGAGATGCAGGG - Intergenic
988662913 5:33293114-33293136 TGAGGCAATGAGAAAATGCAGGG - Intergenic
988717862 5:33845759-33845781 GGATGCAATGAGAAAATACATGG + Intronic
989275648 5:39585588-39585610 AGATGAAATGAGAAGATGTATGG + Intergenic
990250790 5:53912966-53912988 AGATGAAGCAGGAAGATGCATGG + Intronic
991032975 5:62101638-62101660 AGAAGCAGTGAGGGGAGGCATGG - Intergenic
991258195 5:64638283-64638305 AGGAGCAGTGACAAGATGGAAGG + Intergenic
993001483 5:82385700-82385722 AGAAGCAGAGAGAAGAGGGACGG - Intronic
993229711 5:85218543-85218565 AAAATCAGTGAGAAGATGTATGG + Intergenic
994473858 5:100242507-100242529 AGATTCAGGTAGAAGTTGCAAGG - Intergenic
995318585 5:110804556-110804578 AGCTGCAGTGAAAATAGGCAGGG - Intergenic
996537057 5:124588935-124588957 AGATTCAGTGGGCACATGCACGG + Intergenic
996651347 5:125880543-125880565 AGAAGCTGTGAGGAGATGCTTGG - Intergenic
998987335 5:147774991-147775013 AGTTTCAGTTAGAATATGCATGG - Intronic
999250791 5:150181111-150181133 AGGTGCAGTGAGAAGGGGGACGG - Intronic
1000132433 5:158313083-158313105 GGATCCAGTTAGAAGAAGCATGG + Intergenic
1001024476 5:168212241-168212263 AGATGCATTGAGAATTTTCATGG + Intronic
1001656265 5:173352854-173352876 AGATGAAGTTAAAATATGCACGG + Intergenic
1001861449 5:175059170-175059192 AGCTGGAGTGAGAAGATGTAGGG - Intergenic
1003519545 6:6846725-6846747 AGATGGAGTGAGGAGGTGTAAGG + Intergenic
1003956400 6:11169230-11169252 AGAGGCAGGGGGAAGTTGCAAGG + Intergenic
1004470716 6:15926704-15926726 AGATGAAGTGAGAGAATGGATGG + Intergenic
1005783124 6:29214702-29214724 AGATAAAGGGAGAAGATCCAGGG + Intergenic
1006309349 6:33247030-33247052 AGATTTAGTGTGAAGATTCAAGG - Intergenic
1006362525 6:33594787-33594809 AGATGCAGTGAGAGGATGGAAGG - Intergenic
1008700772 6:54096737-54096759 AGATGCAGAGACAAAATTCAGGG - Intronic
1009465182 6:63960137-63960159 AGATGCATTAAGAACATCCATGG + Intronic
1010858547 6:80875436-80875458 GGATGGAGTGAGAGGATGCATGG - Intergenic
1012795000 6:103748704-103748726 AGCTGGAGTGGGAAGATGGAGGG - Intergenic
1013287238 6:108692073-108692095 GGATTAAGTGAGATGATGCATGG + Intergenic
1014474795 6:121859130-121859152 AGCTGCAGTGAGCAGAGGCTTGG - Intergenic
1014972707 6:127837280-127837302 AGCTGCAATGAGAAAATTCAAGG + Intronic
1015267724 6:131305740-131305762 AGAGGAGGTGAGAAGAGGCATGG + Intergenic
1015325243 6:131917206-131917228 AGATGGAGAGAGAAGATGTGAGG - Intergenic
1015573589 6:134647436-134647458 GGATTCAGTTAGAAGATGGAAGG + Intergenic
1015759874 6:136647292-136647314 AGATTAAGTGAGAGGATGAATGG - Intronic
1016349608 6:143153138-143153160 AGATGAAGTGAGAATATGATAGG + Intronic
1016420983 6:143882873-143882895 AGAAGGACTGAGAAGATGCTGGG - Intronic
1018320992 6:162608389-162608411 GGAAGCAGTGAGAAGATGGGAGG + Intronic
1018465623 6:164042024-164042046 AGATGAAGTAAGTAGATGAAAGG - Intergenic
1018866601 6:167751424-167751446 GGATGCAGAGAGTTGATGCACGG + Intergenic
1019768817 7:2870706-2870728 GGATACAGGGAGAGGATGCAGGG + Intergenic
1020083943 7:5300557-5300579 ATGAGCAGTGAGAAGATGCAGGG - Exonic
1020775094 7:12443145-12443167 AGCTGCAATGAAAAGAGGCAAGG - Intergenic
1021892954 7:25204888-25204910 AGAAGCTCAGAGAAGATGCACGG - Intergenic
1023183247 7:37507632-37507654 AGATGCAGTGAAAAGGTCCCAGG + Intergenic
1023233146 7:38054656-38054678 AGATTCAGTGAGAAAAGTCAGGG + Intergenic
1023315271 7:38929617-38929639 AGATTCACTGAGAAGAAGTAGGG - Intronic
1023480615 7:40629897-40629919 AGTTGCAGTGAGAAGCTACAGGG + Intronic
1024107908 7:46111540-46111562 ATATGAAAAGAGAAGATGCATGG - Intergenic
1024269975 7:47634980-47635002 AGCTGCACAGAGAAGATGCATGG - Intergenic
1024433042 7:49312853-49312875 ATATCCAGTGAGGAAATGCAGGG + Intergenic
1025210329 7:57016633-57016655 ATGAGCAGTGAGAAAATGCAGGG + Intergenic
1025661626 7:63560214-63560236 ATGAGCAGTGAGAAAATGCAGGG - Intergenic
1025996641 7:66531524-66531546 ATATGCAGGGAGGAGCTGCAGGG - Intergenic
1027309045 7:76935062-76935084 AGATTCAGTGAGGCAATGCATGG - Intergenic
1028404122 7:90457653-90457675 ATAAGCAGTGAGAAGAAGGAAGG + Intronic
1029151967 7:98486631-98486653 AGAGACAGAGGGAAGATGCAGGG + Intergenic
1029643340 7:101835186-101835208 AGATGCAGAGAATAGATGAATGG - Intronic
1029745749 7:102514886-102514908 AGAGACAGTGGGAAGAGGCAGGG + Intronic
1029763687 7:102613865-102613887 AGAGACAGTGGGAAGAGGCAGGG + Intronic
1030789973 7:113712484-113712506 AGATACAGAGAGAAGAGGGAAGG - Intergenic
1030894490 7:115040479-115040501 AGATGCGGTCAGAAGACACAAGG + Intergenic
1031817855 7:126461384-126461406 AGAGGCAGGGAGAAGAGGCTGGG - Intronic
1031828308 7:126594533-126594555 AGATGCAGAGAGTAGAATCATGG + Intronic
1032789260 7:135230502-135230524 AGATTCACTGAGAAAATACATGG - Intergenic
1033582217 7:142748558-142748580 CGATGCAGTGAGATTATGCTTGG - Intergenic
1034080896 7:148276786-148276808 ACAGGAAGTGAGAAGCTGCAGGG + Intronic
1034448630 7:151125989-151126011 AGAGGGAGTGGGAAGAGGCACGG + Intronic
1034834110 7:154336279-154336301 AACTGCAGGCAGAAGATGCACGG + Intronic
1034917557 7:155053449-155053471 TGGTGCAGTGAAAATATGCATGG - Intergenic
1035075783 7:156176419-156176441 AGAGGCTGTGTGAGGATGCAGGG + Intergenic
1035160121 7:156944063-156944085 GTTTTCAGTGAGAAGATGCAGGG + Intergenic
1035264473 7:157683646-157683668 AGAAGCAGTGAGAATCTGAAGGG - Intronic
1035494036 7:159306236-159306258 AGCTGAGGTGAGAAGGTGCAGGG - Intergenic
1035704058 8:1661337-1661359 AGGAGCACTGAGAAGAGGCAGGG + Intronic
1036417663 8:8565490-8565512 AAATGTAGTGATAAGATGCCAGG - Intergenic
1036912648 8:12770402-12770424 AATTGCAGTGAGAACATTCAAGG - Intergenic
1037151568 8:15641384-15641406 AGTTGCATTGAGAAGAAGGAAGG + Intronic
1037918127 8:22785157-22785179 AAATGCAGAGAGAAGTTGCCGGG - Intronic
1038109418 8:24479117-24479139 AGAAGCAGTGAGAATGTGAAGGG - Intronic
1038166852 8:25093889-25093911 AGATGCAGAGAGAATTGGCATGG + Intergenic
1038351715 8:26782063-26782085 AGATGCTGTTGGAAGATGCAAGG - Intronic
1039577058 8:38632159-38632181 AGAGGCAGCGAGGAGATGCAGGG + Intergenic
1040984081 8:53274314-53274336 AGAGGCAGTGAGGACATTCATGG + Intergenic
1041726459 8:61022172-61022194 AGATGCCGTGAGGATGTGCAGGG - Intergenic
1043572527 8:81621131-81621153 AGAGGCAGTGAGAATAGCCAAGG - Intergenic
1043577513 8:81674946-81674968 AGAGGCAGTGAGAATAGCCAAGG - Intronic
1044119987 8:88382579-88382601 AGATGCACTGAGAAGCTTCCTGG - Intergenic
1045309334 8:100986935-100986957 AAAGGCAGTGAGAAGAAGCAAGG + Intergenic
1045747095 8:105435943-105435965 AGATAAAGTTAGAAGATGAAGGG + Intronic
1045845523 8:106630925-106630947 AGGTGCAGTGAGAAAATGTAAGG + Intronic
1047074798 8:121389113-121389135 AAATGCATTGAGAAGATCAAGGG - Intergenic
1047530579 8:125670501-125670523 ATAGGCAGTGAGAAGATGGGGGG + Intergenic
1048267580 8:133001024-133001046 AGATGGAGTGAAGAGGTGCAAGG - Intronic
1048452996 8:134550346-134550368 AGATCCAGAGAGAAAATGCCAGG + Intronic
1051997092 9:23230671-23230693 TGTTGCAGTGAGTAGATGCTAGG - Intergenic
1052900927 9:33794501-33794523 AGATGCAGTGAGATTATGCTGGG - Intronic
1053024805 9:34720604-34720626 AGCTGCCCTGAGAAGATGGAAGG - Intergenic
1053553545 9:39109509-39109531 AGTTGCTGTGAGAAGCTGCATGG - Intronic
1053817657 9:41929657-41929679 AGTTGCTGTGAGAAGCTGCATGG - Intronic
1054107911 9:61073329-61073351 AGTTGCTGTGAGAAGCTGCATGG - Intergenic
1054612946 9:67257796-67257818 AGTTGCTGTGAGAAGCTGCATGG + Intergenic
1055660805 9:78502219-78502241 GGATGCAATGAGAAGATACAAGG - Intergenic
1056382327 9:86066393-86066415 AGAGGCAGTGGGAAAGTGCAGGG - Intronic
1056474307 9:86938826-86938848 ACATGCAGTGGGAAGAGGAAGGG - Intergenic
1058114797 9:101072591-101072613 AGATGCATTCAGTAGATGCTGGG + Intronic
1058719747 9:107752868-107752890 AGACCCAGGGAGAAGCTGCAAGG - Intergenic
1060716516 9:125935174-125935196 AGATCCAGTGAGAACAAACAAGG - Intronic
1060869861 9:127030828-127030850 AGAAGGAGGGAGAGGATGCAAGG + Intronic
1061586028 9:131569170-131569192 AGATACAGAGAGCAGATTCATGG - Intergenic
1061648193 9:132023677-132023699 ATATACAGTCAGAAGAGGCAAGG + Intronic
1186219420 X:7333804-7333826 AGATGTAATGAGATAATGCACGG + Intronic
1186505597 X:10089628-10089650 AGATTTAATGAGAAAATGCAAGG - Intronic
1186663688 X:11696515-11696537 AGATTAAGTGAGAGGATGTAGGG - Intergenic
1187435648 X:19266465-19266487 AGATGGAGTGAGTACAAGCAGGG - Intergenic
1188950664 X:36369748-36369770 AGAAGCACGTAGAAGATGCATGG + Intronic
1189395171 X:40615151-40615173 AGGTGGATTGAGAAGATACAGGG - Intergenic
1189859358 X:45257358-45257380 GGATGAAATGAGATGATGCAGGG + Intergenic
1192216109 X:69159505-69159527 AGATGAAATGAGAAGACTCATGG - Intergenic
1192246172 X:69373489-69373511 AGATGCAGTTAGATGATGCAGGG - Intergenic
1194018079 X:88651448-88651470 AGATCCACAGAGAAAATGCAAGG + Intergenic
1196554246 X:117068534-117068556 AGATGCAGTCAGAAGACAAAGGG + Intergenic
1196704193 X:118702615-118702637 AGAAGCAGAGAGAAAAAGCAAGG - Intergenic
1198539265 X:137619488-137619510 AGAACCAGTCAGAAGATGCAGGG - Intergenic
1198814659 X:140576745-140576767 AGATGAAGTGATAAGATGTTTGG - Intergenic
1198995442 X:142568601-142568623 ACATGGAGTGAGCAGAAGCATGG + Intergenic
1199428726 X:147734178-147734200 AGCTGCAGTCAGAAGATGACTGG - Intergenic
1200136802 X:153879202-153879224 AGACAGAGTGAGAAGAGGCAGGG + Intronic
1201310515 Y:12594875-12594897 AGATACTGGGAGTAGATGCAGGG + Intergenic