ID: 1151880008

View in Genome Browser
Species Human (GRCh38)
Location 17:76889164-76889186
Sequence AGAAGATGCAGGGCTGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 282}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151880003_1151880008 10 Left 1151880003 17:76889131-76889153 CCAGGTACACCGAGCTGTTTTGC 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1151880008 17:76889164-76889186 AGAAGATGCAGGGCTGGCGCAGG 0: 1
1: 0
2: 1
3: 32
4: 282
1151880002_1151880008 15 Left 1151880002 17:76889126-76889148 CCATGCCAGGTACACCGAGCTGT 0: 1
1: 0
2: 2
3: 17
4: 88
Right 1151880008 17:76889164-76889186 AGAAGATGCAGGGCTGGCGCAGG 0: 1
1: 0
2: 1
3: 32
4: 282
1151879999_1151880008 25 Left 1151879999 17:76889116-76889138 CCCAGGTCTCCCATGCCAGGTAC 0: 1
1: 0
2: 3
3: 9
4: 148
Right 1151880008 17:76889164-76889186 AGAAGATGCAGGGCTGGCGCAGG 0: 1
1: 0
2: 1
3: 32
4: 282
1151880000_1151880008 24 Left 1151880000 17:76889117-76889139 CCAGGTCTCCCATGCCAGGTACA 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1151880008 17:76889164-76889186 AGAAGATGCAGGGCTGGCGCAGG 0: 1
1: 0
2: 1
3: 32
4: 282
1151880001_1151880008 16 Left 1151880001 17:76889125-76889147 CCCATGCCAGGTACACCGAGCTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1151880008 17:76889164-76889186 AGAAGATGCAGGGCTGGCGCAGG 0: 1
1: 0
2: 1
3: 32
4: 282
1151880004_1151880008 1 Left 1151880004 17:76889140-76889162 CCGAGCTGTTTTGCAGATGCAGT 0: 1
1: 0
2: 1
3: 20
4: 229
Right 1151880008 17:76889164-76889186 AGAAGATGCAGGGCTGGCGCAGG 0: 1
1: 0
2: 1
3: 32
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151880008 Original CRISPR AGAAGATGCAGGGCTGGCGC AGG Intronic
900183483 1:1322603-1322625 AGAAGAAGCGGGGCGGGCGGAGG + Intronic
900379219 1:2375561-2375583 AGTACATGAAGGGCTGGGGCAGG + Intronic
901626046 1:10625673-10625695 AGAGCAGGCAGGGCTGTCGCTGG - Intronic
901741798 1:11346545-11346567 AGAACACGCAGGGCTGGGCCGGG + Intergenic
901932134 1:12602569-12602591 AGAAGGAGAAGGGCTGGAGCAGG + Intronic
902562682 1:17287601-17287623 AGTAGCTGCAGGGCTTCCGCAGG + Intergenic
902655178 1:17862083-17862105 AGAAAGTGCAAGGCTGGTGCTGG + Intergenic
903020340 1:20389289-20389311 AGGAGGAGCAGGGCTGGAGCAGG + Intergenic
903515760 1:23909802-23909824 TGGAGATGCAGGGCAGGCTCGGG - Intronic
904477944 1:30776697-30776719 AGAAGAGGCCGAGCTGGGGCTGG + Intergenic
905107504 1:35573314-35573336 AGAGGAGGAAGGGCGGGCGCTGG + Intergenic
905380863 1:37560659-37560681 AGAAGAGGCGGGGCTGGTGTAGG - Intronic
906531305 1:46525554-46525576 AGATGGGGCAGGGCTGGCCCTGG - Intergenic
906639339 1:47432355-47432377 GGAAGAGGCAGGACTGGAGCAGG + Intergenic
909559326 1:76992260-76992282 AGATGAAGCAGGGCTGGCAGTGG - Intronic
910493492 1:87799426-87799448 AGAAGAAGCAGGGATGGAGTGGG - Intergenic
912654390 1:111472570-111472592 AGAAGATGGAGGACTGGGGAAGG - Intergenic
914754897 1:150557087-150557109 AGAGGCTGCAGGGCTGGCTCGGG + Intronic
915674617 1:157518650-157518672 AGAAGCTGGAGGGCTGGTGTGGG - Intronic
922779680 1:228241417-228241439 GTAAGATGCAGGGCTGGTTCTGG + Intronic
923954797 1:239004318-239004340 AGAAGCTGCTGGGCTGGGCCTGG + Intergenic
924218421 1:241848593-241848615 AGACGATTCCGGGCTGGAGCAGG + Intronic
1064584742 10:16828823-16828845 AGAGGATGGAGAGCTGGCGTTGG + Exonic
1065804659 10:29383378-29383400 AGAAAGTTCAGGGCTGGCGATGG + Intergenic
1065919886 10:30383975-30383997 AGAAAATGTAGGCCTGGCACAGG + Intergenic
1069117246 10:64523069-64523091 AGAAGAAGCAGGGTTGAGGCAGG + Intergenic
1069573173 10:69506800-69506822 AGAAGGGGCAGGGCTGGTGAGGG - Intronic
1070723608 10:78773269-78773291 AGAGCATGCAGAGCTAGCGCTGG - Intergenic
1072059511 10:91796468-91796490 AGAAGGTGCAGGGCGGGGGATGG - Intergenic
1074134189 10:110612824-110612846 AGATGAAGCAGGGCTGGGCCAGG - Intergenic
1075094270 10:119460790-119460812 AGAAGATGCAGGGGTGGGGCAGG + Intergenic
1075619079 10:123912472-123912494 TGCAGATGCAGGGGTGGCCCAGG - Intronic
1076180209 10:128401390-128401412 AGACTCTGCAGGGCTGGCCCAGG - Intergenic
1077899981 11:6480322-6480344 TGAAGATGATGGGCTGGAGCAGG - Exonic
1078010848 11:7572091-7572113 AGAAGAGACAGGGCTGGTCCTGG + Intronic
1078338806 11:10484692-10484714 ATGAGATGCGGGGCCGGCGCAGG + Intronic
1078580657 11:12536982-12537004 AGAAGGAGCAGGGCTGGTGAAGG - Intergenic
1079494437 11:21025844-21025866 AGAAGATGCAGGTTTGGGGAGGG - Intronic
1080574317 11:33584351-33584373 AGAAGCTGCAGGGCTTTGGCTGG + Intronic
1081660921 11:44887926-44887948 AAAATATGCAGGGCTGTTGCTGG - Intronic
1081702727 11:45162145-45162167 AGAGGGTCCAGGGCTGGTGCTGG - Intronic
1081789852 11:45774901-45774923 AGAAGAGGCAGGAATGGAGCTGG - Intergenic
1081837400 11:46167306-46167328 GGAAGGAGCAGGGCTGGCACAGG + Intergenic
1082739453 11:56894492-56894514 AGCAGAGGCAAGGCTGGGGCAGG + Intergenic
1082835628 11:57648561-57648583 AGAAGAGGCAGTGTTGGCTCTGG + Exonic
1084334473 11:68448678-68448700 AGAAGATGCAGGCCGGACTCTGG - Intronic
1085269113 11:75259746-75259768 ACAAGAACCAGGGCTGGGGCTGG + Intergenic
1086121778 11:83312129-83312151 AGAGGATGCAGGGTTGGGGAGGG + Intergenic
1087140429 11:94760406-94760428 TGAGGATGCAGGGATGGCCCAGG - Intronic
1087658410 11:100955421-100955443 AGGAGATACAGGGCTGGGGTAGG + Intronic
1088153514 11:106776906-106776928 AGGAGATGAAGGGATGGCTCTGG - Intronic
1088736076 11:112728798-112728820 AGTTGCTGCAGGGCTGGCCCAGG - Intergenic
1090019480 11:123114593-123114615 AGAAAATGCAGGGCTGGGAGTGG - Intronic
1090205260 11:124880300-124880322 AGAAGATGAAGGGCAGGCACAGG - Intronic
1091043230 11:132301696-132301718 AGAGGCTGCAGAGCTGGTGCAGG + Intronic
1091285207 11:134405062-134405084 GGAAGAAGAAGGGCTGGGGCAGG + Intronic
1095331934 12:40976772-40976794 AGACACTGCAGGGCTGGCCCTGG + Intronic
1096615208 12:52828802-52828824 AGAAGATGGAGGGGTGGGGAGGG - Intronic
1097157991 12:57026649-57026671 AGAAGAGGCAGGGCTGGGGAGGG + Intronic
1097269635 12:57766062-57766084 AGAAGCTGCAGCGCTCGGGCCGG + Exonic
1103437226 12:120936371-120936393 AGAAGAAGTGGGGCTGGAGCTGG - Intergenic
1103693106 12:122791794-122791816 AGGAGAGGCAAGGCTGGTGCAGG + Intronic
1104964296 12:132502143-132502165 AGGAAATGCGGGGCTGCCGCAGG - Intronic
1105814000 13:24016852-24016874 AGAGAATCCAGGGCTGGTGCAGG + Intronic
1106332828 13:28755005-28755027 AGAAGATGGCCGGCTGGCTCTGG - Intergenic
1106335248 13:28777859-28777881 AGGAGAGGCGGGGCTGGGGCTGG + Intergenic
1107959511 13:45545710-45545732 AGAAGCTGCAGCTCTGGGGCTGG - Intronic
1109101386 13:58188113-58188135 GGAAGATGCAAGGCTGGCACTGG + Intergenic
1111690506 13:91557512-91557534 AGAAGATGGAGCCCTGGGGCTGG - Intronic
1112380488 13:98884257-98884279 ATAATATGCAGGCCTGGCACAGG + Intronic
1112827980 13:103414053-103414075 AGAAGAAACAGGGGTGGAGCTGG - Intergenic
1113668629 13:112159773-112159795 AGAGGGGGCAGGGCTGGGGCGGG + Intergenic
1113958036 13:114109780-114109802 ACCAGAGGCGGGGCTGGCGCAGG + Intronic
1114631973 14:24164883-24164905 AGCAGATGCGGGCCTGGCCCAGG - Exonic
1115042548 14:28948955-28948977 AGAAGATGTGGGGCTGGGGGTGG - Intergenic
1115628787 14:35222491-35222513 TGGAGAGGCAGGGCTGGCACCGG - Intronic
1117434769 14:55705460-55705482 AGAAGATACAGCTCTTGCGCTGG - Intergenic
1118839519 14:69500398-69500420 AGAAGAGGAAGGGTTGGGGCAGG - Intronic
1119941605 14:78647286-78647308 AGAACATGAAGGGCAGGGGCGGG - Intronic
1121564070 14:94895516-94895538 AGAAGATGAAGGCCTGGAGACGG - Intergenic
1121964182 14:98289035-98289057 TGAAGAGGCAGGGTAGGCGCTGG - Intergenic
1122097506 14:99382242-99382264 AGAAGAAGCAGGGCTGGAATTGG - Intergenic
1122516729 14:102314292-102314314 TGCAGCTGCAGGGCGGGCGCGGG - Intergenic
1122974959 14:105167319-105167341 GGAAACTGCAGGGCAGGCGCAGG + Intronic
1123055105 14:105565892-105565914 TGAAGATGCAGGGCTGGGGTTGG + Intergenic
1123079553 14:105685736-105685758 TGAAGATGCAGGGCTGGGGTTGG + Intergenic
1123133981 14:106010813-106010835 AGAAGACACAGGGGTGACGCTGG + Intergenic
1124804020 15:32862916-32862938 GGAAGAGGCAGAACTGGCGCAGG - Intronic
1125435891 15:39645328-39645350 AGAAGAGGCAGGGCTCCCACTGG - Intronic
1125731962 15:41897544-41897566 AGACGCTGCAGGGCTGGAGCAGG + Exonic
1127662738 15:61115435-61115457 AGAAGAAGCAGGGCTGTGGCCGG - Intronic
1129050149 15:72774411-72774433 ATAAGAGGCAGTGCTGGGGCTGG - Intronic
1129255364 15:74331169-74331191 AGCAGAGGCTGGGCTGGCCCAGG - Intronic
1131519629 15:93103888-93103910 AGAAGAGGAAGTGCTGGCTCTGG + Intergenic
1131538571 15:93257134-93257156 AGAAGTAGCAGAGCTGGGGCTGG - Intergenic
1132746799 16:1439571-1439593 ATGAGATGCAGGGATGGGGCCGG - Intronic
1132796647 16:1727741-1727763 GGAAGCTGCACTGCTGGCGCGGG - Intronic
1132977503 16:2717888-2717910 AGAAGGTGCAGGGCAGGCAAAGG + Intronic
1133752492 16:8735760-8735782 GGAAGCTGCAGGCCAGGCGCTGG - Exonic
1135776675 16:25262579-25262601 AGAAGATCTAGGCCGGGCGCAGG - Intergenic
1136777044 16:32877558-32877580 AGAGGCTGGAGGGCTGGGGCTGG - Intergenic
1137071430 16:35907954-35907976 AGAAGATGGAGGGGAGGCTCAGG + Intergenic
1138089403 16:54161914-54161936 AGAAGATGCAGGGAAGGCCCAGG - Intergenic
1139971375 16:70777689-70777711 AGAAGATGCGGAGGTGGGGCAGG + Intronic
1141720373 16:85752224-85752246 AGAAGGGGCAGGCCTGGGGCAGG + Intergenic
1141823560 16:86463878-86463900 TGAAGGTACAGGGCTGGCCCAGG + Intergenic
1141900987 16:86990249-86990271 TGAAAATGCAGAGCTGGCGGTGG - Intergenic
1142341761 16:89528036-89528058 AGAAGATGGAGGGTTGGGGCAGG + Intronic
1142341831 16:89528414-89528436 AGAAGATGGAGGTTTGGGGCAGG + Intronic
1142341842 16:89528476-89528498 AGAAGATGGAGGGTTGGGGCAGG + Intronic
1142341852 16:89528533-89528555 AGAAGATGGAGGGTTGGGGCAGG + Intronic
1142511166 17:394500-394522 AGGAGGTGCAGGCCTGGGGCAGG - Intergenic
1143055106 17:4156591-4156613 AGAAGGGGCAGGGCAGGGGCTGG + Intronic
1143503089 17:7350249-7350271 TGAAGGGGCGGGGCTGGCGCTGG + Intronic
1144484262 17:15651860-15651882 AGAAGTTTCAGGGCTGGACCTGG - Exonic
1144630897 17:16871943-16871965 AGAGGATGCCTGGCTGGTGCGGG + Intergenic
1144650417 17:17003532-17003554 AGAGGATGCCTGGCTGGTGCGGG - Intergenic
1145207323 17:20991511-20991533 AGCAGAGGCAGCGCTGTCGCCGG + Intergenic
1147721625 17:42543197-42543219 ACCAGATGAAGGGCTGGCCCTGG - Exonic
1148991868 17:51673173-51673195 AGAGGATCCAGGGCTGGCTGGGG - Intronic
1149088554 17:52750882-52750904 AGAAGAGGCAGGGCTCCCACAGG - Intergenic
1149849805 17:60027579-60027601 AGCAGAAGCAGGACTGGCACAGG + Intergenic
1149860363 17:60118945-60118967 AGCAGAAGCAGGACTGGCACAGG - Intergenic
1150510059 17:65742194-65742216 AGAAGATGCAGAGGTGAGGCAGG + Intronic
1151757317 17:76082198-76082220 AGAAGAAACAGGTCTGGGGCAGG + Intronic
1151880008 17:76889164-76889186 AGAAGATGCAGGGCTGGCGCAGG + Intronic
1152229136 17:79105989-79106011 AGAACGTGCAGGGCTGCCCCTGG - Intronic
1152261545 17:79269927-79269949 AGATGCTGCAGGGCAGGCACAGG - Intronic
1152284077 17:79402505-79402527 AGAAGCTGTAGGGCTCCCGCTGG + Intronic
1152514701 17:80816529-80816551 GGAAGGAGCAGGGCTGCCGCTGG + Intronic
1152594068 17:81229657-81229679 AGCAGCTGCTGGGCTGGTGCTGG + Intronic
1152822620 17:82445036-82445058 AGCAGTTGCAGGGCTGGCCTGGG - Intronic
1153854892 18:9136470-9136492 CGAAGAGGCAGGGCAGGCGCCGG - Intronic
1157721640 18:49929789-49929811 AGAAGATGCTGAGATGGCTCAGG - Intronic
1161421801 19:4179963-4179985 AGGTGATTCAGGGCTGGGGCAGG + Intronic
1161707718 19:5829811-5829833 AGCAGTTTCAGGGCTGCCGCTGG + Intergenic
1163225340 19:15956697-15956719 ACAAGAAGTAGGGCTGGCCCTGG - Intergenic
1163758795 19:19121761-19121783 TGAAGAAGCAGGGCTGGGACTGG - Exonic
1164463159 19:28465432-28465454 AGAGGATGCAGGGCAGGCACAGG + Intergenic
1164734522 19:30531042-30531064 AGAAGATGAAGGGCTATCGTGGG - Intronic
1165751699 19:38264394-38264416 GGAAGAGGCGGGGCTTGCGCGGG - Intronic
1165833622 19:38741919-38741941 AGAAGATGCAGGGCCGGACTCGG + Intronic
1166261169 19:41642184-41642206 AGCTGATCCAGGGCTGGGGCAGG + Intronic
1167036572 19:46998546-46998568 AGAAGTTGCAGAGCTGGGACTGG - Intronic
1167157132 19:47745687-47745709 ATAAGAAGCGGGGCTGGCGGCGG + Exonic
1167304124 19:48696984-48697006 GGAAGGGGCAGGGCCGGCGCTGG + Intronic
1167410044 19:49339112-49339134 AGAAAAGGCTGGGCTGGCTCTGG + Intronic
1168339411 19:55614830-55614852 AGATGCCGCAGGGCAGGCGCAGG - Exonic
925981743 2:9182614-9182636 AGAAAGAGCAGGGCTGGAGCCGG - Intergenic
926159993 2:10481189-10481211 TGAAGATGCAGGCCTGGTGTGGG - Intergenic
926687390 2:15708815-15708837 AGCAGAGGCAGGGCTGGAGTTGG - Intronic
926743348 2:16130243-16130265 AGGAGAGGCAGGGATGGCCCTGG - Intergenic
927222694 2:20728643-20728665 AGAGGAGGCAGGGGTGGCACTGG + Intronic
928083870 2:28333506-28333528 AGCAGAAGCAGGGCTGGCCCAGG - Intronic
929189262 2:39124281-39124303 AAAAGCTGAGGGGCTGGCGCGGG - Intronic
931262691 2:60633954-60633976 AGAAGATGCAGGACGGGGTCCGG + Intergenic
932056102 2:68445753-68445775 ACAAGGTGCAGTGCTGGGGCTGG + Intergenic
936516785 2:113186000-113186022 GGACGATGCAGGGCTGGGCCTGG - Exonic
937271399 2:120655081-120655103 CCAGGAGGCAGGGCTGGCGCTGG + Intergenic
937364188 2:121249013-121249035 AGCAGCTGGAGGGCTGGCGGTGG - Exonic
938518201 2:132037946-132037968 AGAAGAAGGAGGGCGGGGGCGGG - Intergenic
940026104 2:149210211-149210233 AGAAGATGCATGGCTGTTTCTGG + Intronic
941503903 2:166315789-166315811 AGAAGATGCAATGATGGGGCAGG + Intronic
943719650 2:191190473-191190495 ACAAGATACAGTGCTGGCACTGG + Intergenic
946796806 2:223362944-223362966 AGCAGATTCAGGGCTGGTGAGGG - Intergenic
947716193 2:232339993-232340015 AGAAGAGCCAGGGGTGGCCCTGG + Intronic
948049616 2:234969691-234969713 AGAGGAGGCAGGGCAGGAGCAGG - Intronic
948725241 2:239930252-239930274 TGGAGAAGCAGGGCTGGCGGAGG - Intronic
948795445 2:240400062-240400084 GGGAGGTGCAGGGCAGGCGCAGG + Intergenic
1168750935 20:280576-280598 AGAAGTGGCAGGGCTGGAACTGG + Intronic
1168807563 20:681415-681437 AGCAGAAGCAGGGCTGGAACTGG - Intergenic
1172844656 20:37922706-37922728 AGGAGATTCAGGGCTGGACCAGG + Intronic
1172943783 20:38672869-38672891 AGAAGATGCAGGGCCAGCTGAGG - Intergenic
1173006245 20:39141813-39141835 AGAGCATGAAGGGCTGGTGCGGG + Intergenic
1173649735 20:44655573-44655595 AGAGGCTGGAGGGCTGGGGCAGG - Intergenic
1173822120 20:46026283-46026305 ACAAGATGCAGGGCTAGGGAGGG - Intronic
1174368110 20:50068522-50068544 GAAAGAGGCAGGGCTGGCGTGGG + Intergenic
1175437941 20:58967858-58967880 AGGTGGTGCAGGGCTGGAGCTGG - Intergenic
1175472129 20:59237880-59237902 AGAGGAAGCAGGGCAGGGGCTGG - Intronic
1175972212 20:62692248-62692270 AGAAGGTGCGGGGCTGGGGCGGG + Intergenic
1176150836 20:63589995-63590017 AGAGGCCGCAGGGCTGGCTCGGG - Exonic
1176165538 20:63671400-63671422 AGAAAAGGCAGGGGTGGGGCTGG + Intronic
1177631347 21:23732943-23732965 AGAACATGCAGTGCTGTGGCAGG - Intergenic
1178478081 21:32955542-32955564 AGCAGAGGCAAGCCTGGCGCTGG - Intergenic
1179428770 21:41304314-41304336 AGAGGACGCGGGGCTGGCGTGGG + Intronic
1179974232 21:44854763-44854785 AGAAGGAGCAGGGCCGGTGCTGG + Intronic
1180051284 21:45332064-45332086 GGCAGAGGCAGGGCTGGAGCAGG + Intergenic
1180225674 21:46390792-46390814 AGCAAAGGCAGAGCTGGCGCTGG + Exonic
1180854913 22:19039553-19039575 AGAACATTCAGGGCTGCAGCTGG + Intronic
1180958007 22:19749829-19749851 AGAGGATCCAGGGATGGCCCAGG + Intergenic
1183320304 22:37161306-37161328 AGAAGAAACAGGGCTGGCAGAGG - Intronic
1183617332 22:38953733-38953755 AGAAGGTGGGGGGCTGGCCCTGG + Intronic
1184289931 22:43493232-43493254 AGAAGATGGAGGTTTGGCGAGGG - Intronic
1184974363 22:48050743-48050765 AGAAGCTGCATGGCTGGACCTGG + Intergenic
1185271821 22:49933368-49933390 ATGAGTTGCAGGGCTGGAGCGGG - Intergenic
950119287 3:10471009-10471031 AGAACAACCAGGGCTGCCGCAGG - Intronic
950257829 3:11520541-11520563 GGAAGATGCCGTGCTGGCCCTGG + Intronic
950550092 3:13661167-13661189 AGCAGATGTGGGGCTGTCGCAGG + Intergenic
952820313 3:37480806-37480828 AGATGATGCAGGTCTGGACCAGG - Intronic
953201186 3:40780054-40780076 AGAGGAGGCAGGGCTGACTCTGG - Intergenic
955110054 3:55940110-55940132 AGAACATGCAGGTCAGGAGCAGG - Intronic
956415588 3:69025298-69025320 AGGAAATGCTGGGCTGGAGCAGG - Intronic
956651460 3:71508386-71508408 AGCAGATGCTAGGCAGGCGCTGG + Intronic
959574706 3:107922109-107922131 AGAAGAGGCTAGGCTGGTGCTGG - Intergenic
959590583 3:108075618-108075640 AAAAGATGCATGGCTAGGGCAGG - Intronic
961030522 3:123599277-123599299 AGAAGAGGCAGGTCTTGCGGGGG + Intergenic
961362374 3:126376047-126376069 AGAAGAGGCAGGGCCGGAGATGG + Intergenic
961431330 3:126885916-126885938 AGAAGTAGAAGGGCTGGTGCTGG + Intronic
962747058 3:138404759-138404781 AGAAGATGGAGGGATGTCACGGG - Exonic
963197537 3:142549617-142549639 AGAAGCTGCAGGGCTTGCTTTGG + Exonic
963774440 3:149423658-149423680 AGAAGGGGCAGGGCTGGAGAAGG + Intergenic
963951064 3:151201511-151201533 AGGAGATTGAGGGCTGGCACTGG + Intronic
968480373 4:830506-830528 GGGAGAGGCAGGGCTGGCCCAGG + Intergenic
968585704 4:1414977-1414999 AGAAAATGTAGGGGCGGCGCGGG - Intergenic
968758477 4:2428668-2428690 GTGAGATGCAGGCCTGGCGCAGG - Intronic
969352268 4:6604556-6604578 AGAAGGTGCAGGGTAGGTGCTGG + Intronic
969507680 4:7598292-7598314 AGGAGGTGGAGGGCTGGGGCTGG + Intronic
969717516 4:8874975-8874997 AGAGGATGCACGGCAGGCGCAGG - Intergenic
969732136 4:8963756-8963778 GCGGGATGCAGGGCTGGCGCGGG - Intergenic
969791729 4:9497841-9497863 GCGGGATGCAGGGCTGGCGCGGG - Intergenic
972518603 4:39832592-39832614 AGAAGTTTGAGGGCTGGGGCAGG + Intronic
974103807 4:57445152-57445174 AGAACAGGCAGGGCTGGCTGGGG + Intergenic
975059841 4:69984366-69984388 AGAAGCTGCAGAGCTGCTGCTGG + Intergenic
975254503 4:72216928-72216950 AGGACTTGCAGGGCTGGCCCTGG - Intergenic
975801519 4:78063586-78063608 AGCAGATGCATGGCTTGCCCAGG + Intronic
976207238 4:82634832-82634854 AGAAGATGCAGGGCAAGAGGAGG + Intronic
976270999 4:83230221-83230243 AGAATAAGAAGGGCTGGCCCAGG - Intergenic
976563904 4:86531890-86531912 AGAAGCTCCAGGGCAGGCACTGG + Intronic
977808783 4:101335319-101335341 AGAAGAGGCAGGTTTGGCTCTGG + Intronic
978301202 4:107270754-107270776 AGGACTTGCAGGGCTGGCCCTGG - Intronic
984134012 4:175913699-175913721 AGGAGATGAAGGGATGGGGCAGG - Intronic
984191099 4:176606725-176606747 AGAGGATGAAGGGCTTTCGCTGG + Intergenic
984719543 4:182956938-182956960 CCAAGATGCAGGGATGGGGCAGG - Intergenic
987280852 5:16412227-16412249 AGCAGATGCAGGGCTGAGGTAGG + Intergenic
991456756 5:66812077-66812099 ACATGATGCAAGGCTGGCGCGGG + Intronic
994670033 5:102754125-102754147 AGAGGGGGCTGGGCTGGCGCTGG + Intronic
994790973 5:104224597-104224619 AGAAGGGGCAGGGCTCCCGCTGG + Intergenic
996478693 5:123949400-123949422 AGCAGCTGCGGGGGTGGCGCTGG - Intergenic
998134867 5:139669305-139669327 AGGGGATGCAGGGCTGGAGGGGG - Intronic
998262747 5:140643654-140643676 CGAGGATGCAGGACTGGAGCTGG + Exonic
1000180991 5:158811121-158811143 TCAAGTTGCAGGGCTGGCACAGG + Intronic
1002637689 5:180616270-180616292 AGGAGAGGGAGGGCTGGCACAGG - Intronic
1004883146 6:20028248-20028270 AGGAGATGCAGGGCTGTGGAGGG - Intergenic
1005713358 6:28523608-28523630 GGAAGAGGCAGGGCTGGTGGAGG + Intronic
1006025266 6:31142771-31142793 AGAGGAAACAGGGCTGGCACAGG + Intronic
1006028365 6:31161763-31161785 AGAAGGTGAGGGGCTGGGGCCGG - Exonic
1006177050 6:32128754-32128776 CCAGGATGCAGGGCTGGCTCAGG - Exonic
1008507472 6:52245210-52245232 AGAAGATGCTTAGCTGGCGTTGG - Intergenic
1013318072 6:108960337-108960359 AGAAGAGGCAGGGCTGCAGCTGG - Intronic
1014207121 6:118668177-118668199 AGAATATGCAGTGCTTGTGCAGG + Intronic
1017157101 6:151332329-151332351 ATAAGATGCAGGGCTGGGCCGGG - Intronic
1017315906 6:153031097-153031119 AGATGTTGCAGGGCTGGAGCAGG + Intronic
1018277358 6:162147048-162147070 AAAAGATGCAGGGCTGGGTCCGG + Intronic
1018380469 6:163254069-163254091 TGCAGAGGCAGGGCTGGCCCTGG - Intronic
1018408720 6:163517975-163517997 AGAATATGTAGGGCAGGGGCAGG - Intronic
1019151776 6:170011196-170011218 AGAAGATGCCAGGCCGGGGCTGG + Intergenic
1019444551 7:1064641-1064663 GGTGGATGCAGGGCTGGCTCTGG - Intronic
1019742353 7:2681107-2681129 TGAGGATGCAGGGCTGGAGCGGG + Intronic
1021619536 7:22537634-22537656 AGAAAATGCAGGTCTCGGGCCGG - Intronic
1022029312 7:26478014-26478036 AGAAGATGCAGGGCTGGGTGTGG + Intergenic
1022412602 7:30150732-30150754 AGCAGGGGCAGGGCTGGCCCAGG + Intronic
1023838614 7:44082769-44082791 AGGAGAGGCTGGGCTGGAGCGGG + Intergenic
1024260986 7:47573627-47573649 AGAGGATGCTGGGCTGGGGGAGG - Intronic
1026831703 7:73614290-73614312 AAAAGAAGCAGAGCTGGGGCTGG - Intronic
1026892691 7:73991805-73991827 AGAAGTGGCAGGGCTGTCACTGG + Intergenic
1027191754 7:76000675-76000697 TGGATATGCAGGGCTGGCCCAGG - Intronic
1027232453 7:76280664-76280686 GGCAGAGGCAGGGCAGGCGCGGG + Intronic
1028371727 7:90099969-90099991 AGAAAATGCAGGTCTCGGGCCGG + Intergenic
1032301027 7:130687165-130687187 AGAAGATTCAGGGCTGGGCATGG - Exonic
1033758348 7:144415785-144415807 AGAGGATGCTGGGCAGGTGCTGG + Intergenic
1033987948 7:147249664-147249686 AGAAGATTCAGAGCTGGAGTTGG + Intronic
1034492196 7:151399404-151399426 AGTAAAGACAGGGCTGGCGCAGG - Intronic
1035678764 8:1472269-1472291 ACCAGATGCAGGGCCGGAGCAGG + Intergenic
1038256902 8:25958623-25958645 AGAAGAAGCTGGGCTGGAGTTGG - Intronic
1038536848 8:28359711-28359733 AGAAGCTGCAGGTCTGCTGCAGG - Exonic
1040292468 8:46132469-46132491 AGAAGCTCCAGGGCTGTCCCGGG - Intergenic
1042219581 8:66460333-66460355 CCAAGATGCAGGGCTGGTGTTGG + Exonic
1042886595 8:73559391-73559413 AGGATAAGCAGGGCTGGCACTGG + Intronic
1048284157 8:133128692-133128714 AGAAGATTCAGATCTGGCCCTGG + Intronic
1049071300 8:140357901-140357923 AGGAGCTGCACGGCTGTCGCAGG + Intronic
1049149353 8:141024346-141024368 AGAAGGAGCAGGGCTGGCCCAGG + Intergenic
1049175460 8:141189785-141189807 AGGAGGTTCAGGGGTGGCGCAGG + Intronic
1049253077 8:141599439-141599461 AGAAGAGGCAGGCTTGGGGCTGG + Intergenic
1049358017 8:142198325-142198347 AGCAGCTGCTGGGCTGGGGCAGG + Intergenic
1049662096 8:143824117-143824139 GGAGGGTGCAGGGCTGGTGCGGG + Intronic
1050478264 9:6063362-6063384 GGAAGATGCAAGGCTGGGGGAGG - Intergenic
1052647616 9:31255415-31255437 ACAGGATGCGGGGCTGGCGGGGG + Intergenic
1053136108 9:35651017-35651039 AGGAGCTGCAGGAGTGGCGCAGG - Intergenic
1053311439 9:37023341-37023363 AGAAGATGCAGGGCCAGAGCTGG - Intronic
1054872522 9:70061329-70061351 AGAAGTGGCAGGGCTGGGGCAGG + Intronic
1056831863 9:89923613-89923635 AGACGATGCAGGGCTCGCACTGG + Intergenic
1057308422 9:93925954-93925976 AGAAAGGGCAGGGCTGGGGCGGG - Intergenic
1058718191 9:107740539-107740561 AGGAGAGGCAGGGCTGAGGCAGG + Intergenic
1058896684 9:109406385-109406407 AGCAGATAAAGGGCTGGAGCAGG + Intronic
1058982575 9:110183935-110183957 AGAAAAAGCAGACCTGGCGCAGG - Intergenic
1059437074 9:114283501-114283523 AGGAGAAGGAGGGCTGGGGCAGG + Intronic
1060274450 9:122171846-122171868 AGATGATGGAGGGCTGGAACAGG - Intronic
1060521289 9:124295415-124295437 ACAAGAAGCGGGGCTGGGGCTGG + Intronic
1061093247 9:128438918-128438940 AGAAGACGCAGAGCTGCTGCGGG - Intergenic
1061894021 9:133637625-133637647 CCAAGATGCAGAGCTGGAGCCGG - Intronic
1062088823 9:134663354-134663376 AGAGGGTGAAGGGCTGGGGCTGG + Intronic
1062542781 9:137048926-137048948 AGAAGAAGGTGGGCTGGGGCGGG - Exonic
1062612526 9:137381542-137381564 GGAGGAGGCAGGGCTGGGGCGGG - Intronic
1187226028 X:17375930-17375952 TGAAGGTGCAGGGACGGCGCGGG - Exonic
1187366057 X:18666682-18666704 AGAAGATGCTGGCTTGGCCCAGG + Intronic
1187427902 X:19195325-19195347 AGAAGATGATGGGCTCGCTCAGG + Intergenic
1190321903 X:49184665-49184687 AGGAGTTGCAGGGCTGGCCCCGG + Exonic
1190480275 X:50870414-50870436 GGAAGAGGCAGGGCTGGAGCTGG - Intergenic
1190744584 X:53314716-53314738 AGACCATGCAGGGCAGGCGGAGG + Intronic
1196857384 X:119996905-119996927 AGGAGCTGCAGAGCTGGTGCGGG - Intergenic
1197415346 X:126166339-126166361 AGGAGCTGCTGGGCTGGCGTGGG + Intergenic
1200091798 X:153639473-153639495 AGGAGTTGGAGGGTTGGCGCAGG + Intergenic
1200102813 X:153696482-153696504 AGAGGCTGCAGGGCTGGGGCTGG + Exonic
1200141750 X:153906019-153906041 CGAAGATGAAGAGCTGGGGCAGG - Exonic
1200267823 X:154655263-154655285 AGAGGCTGCAGGGCTGGGGCTGG + Intergenic
1201065775 Y:10092799-10092821 AGCAGAGGCAGGGCGGGGGCGGG + Intergenic