ID: 1151880009

View in Genome Browser
Species Human (GRCh38)
Location 17:76889165-76889187
Sequence GAAGATGCAGGGCTGGCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 291}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151880003_1151880009 11 Left 1151880003 17:76889131-76889153 CCAGGTACACCGAGCTGTTTTGC 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1151880009 17:76889165-76889187 GAAGATGCAGGGCTGGCGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 291
1151880004_1151880009 2 Left 1151880004 17:76889140-76889162 CCGAGCTGTTTTGCAGATGCAGT 0: 1
1: 0
2: 1
3: 20
4: 229
Right 1151880009 17:76889165-76889187 GAAGATGCAGGGCTGGCGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 291
1151880000_1151880009 25 Left 1151880000 17:76889117-76889139 CCAGGTCTCCCATGCCAGGTACA 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1151880009 17:76889165-76889187 GAAGATGCAGGGCTGGCGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 291
1151879999_1151880009 26 Left 1151879999 17:76889116-76889138 CCCAGGTCTCCCATGCCAGGTAC 0: 1
1: 0
2: 3
3: 9
4: 148
Right 1151880009 17:76889165-76889187 GAAGATGCAGGGCTGGCGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 291
1151880001_1151880009 17 Left 1151880001 17:76889125-76889147 CCCATGCCAGGTACACCGAGCTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1151880009 17:76889165-76889187 GAAGATGCAGGGCTGGCGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 291
1151880002_1151880009 16 Left 1151880002 17:76889126-76889148 CCATGCCAGGTACACCGAGCTGT 0: 1
1: 0
2: 2
3: 17
4: 88
Right 1151880009 17:76889165-76889187 GAAGATGCAGGGCTGGCGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151880009 Original CRISPR GAAGATGCAGGGCTGGCGCA GGG Intronic
900161041 1:1223910-1223932 GGAGATGCAGCGCTGGATCATGG - Exonic
900183484 1:1322604-1322626 GAAGAAGCGGGGCGGGCGGAGGG + Intronic
900379220 1:2375562-2375584 GTACATGAAGGGCTGGGGCAGGG + Intronic
900539100 1:3193899-3193921 GGAGATGCTGGGCTGGGGCCAGG + Intronic
900592073 1:3464567-3464589 GCAGATGCAGGGCTGGCCCCAGG + Intronic
901075085 1:6549290-6549312 AAAAAAGCAGGGCTGGAGCATGG + Intronic
901131623 1:6965098-6965120 GAAGAAGCAGGGCCAGCGGAAGG + Intronic
901630545 1:10646062-10646084 GGAGGTGCAGGGCTAGCTCAGGG - Intronic
901932135 1:12602570-12602592 GAAGGAGAAGGGCTGGAGCAGGG + Intronic
902203761 1:14852513-14852535 GAAGAAGCAGGGAGGGGGCAGGG - Intronic
903020341 1:20389290-20389312 GGAGGAGCAGGGCTGGAGCAGGG + Intergenic
903515759 1:23909801-23909823 GGAGATGCAGGGCAGGCTCGGGG - Intronic
903950599 1:26993990-26994012 GGAGCTGCAGCGCTGGCGCCAGG + Exonic
904373643 1:30066255-30066277 GTGGAGGCAGGGCTGGGGCACGG - Intergenic
905042569 1:34972579-34972601 GAGGATGCATGGCTGGTGGAAGG + Intergenic
905249291 1:36637812-36637834 GGAGAGGCAGGTCTGGTGCAGGG - Intergenic
905380862 1:37560658-37560680 GAAGAGGCGGGGCTGGTGTAGGG - Intronic
906104868 1:43285669-43285691 GAAGCTGCAGGTCTGGCAGAGGG + Intergenic
906639340 1:47432356-47432378 GAAGAGGCAGGACTGGAGCAGGG + Intergenic
911112537 1:94206554-94206576 GATGATGTAGGCCTAGCGCAAGG + Intronic
913611550 1:120514204-120514226 GCAGATGCAGAGGTGGGGCAGGG - Intergenic
913983244 1:143542603-143542625 GCAGATGCAGAGGTGGGGCAGGG + Intergenic
914579642 1:149008035-149008057 GCAGATGCAGAGGTGGGGCAGGG + Intronic
914754898 1:150557088-150557110 GAGGCTGCAGGGCTGGCTCGGGG + Intronic
915447635 1:155983134-155983156 GAAGCTGAAGGTCTGTCGCAGGG + Intronic
917652447 1:177091698-177091720 GAGGATGGAGGGCTGGGGGATGG - Intronic
918459440 1:184760721-184760743 CAAGATTCAGGGCTGGGGCCAGG - Intergenic
918931869 1:190864743-190864765 GAAGATGCAGGTGTGGTGCTAGG - Intergenic
919859659 1:201731117-201731139 GAATATGCAGGGCAGGATCACGG + Intronic
920238974 1:204529640-204529662 GGAGATGCAGGGCAAGCGCCAGG - Intronic
920437712 1:205958776-205958798 GAAGCTGCAGGGCAGACCCAGGG - Intergenic
921936427 1:220800977-220800999 GATGGTGCAGGGCTGGGTCAAGG - Intronic
1065162061 10:22932832-22932854 TAAGAGGCAGAGCTGGCTCAAGG - Intronic
1065533761 10:26698323-26698345 GAGAATGCAGGGCTGGTGCTAGG + Intronic
1067660352 10:48232769-48232791 GAAGAGACAGAGCTGGAGCAAGG + Intronic
1067934947 10:50602225-50602247 GAAGAAGCAGAGATGGGGCAGGG - Intronic
1068264918 10:54633976-54633998 GGAGATTCATGGCTGGTGCATGG - Intronic
1069605539 10:69736763-69736785 GGGGATGCAGGGCTGGGGCCTGG - Intergenic
1070711076 10:78683649-78683671 GAAGTTGCATGGCTTGCCCAAGG - Intergenic
1072806225 10:98425485-98425507 GAAGAGGCAGGGCTGGCAGCAGG - Intronic
1073450231 10:103604751-103604773 GTAGGTACAGGGCTGGGGCAGGG - Intronic
1074853214 10:117455241-117455263 GAAGGTGCAGGGCTGGTGTTTGG + Intergenic
1076861497 10:133140222-133140244 GAAGGGGCAGGGCAGGGGCAGGG - Intergenic
1076861541 10:133140332-133140354 GAAGGGGCAGGGCAGGGGCAGGG - Intergenic
1076875267 10:133212795-133212817 GAGGAAGCAGGGCTTGGGCAGGG - Exonic
1077327476 11:1969977-1969999 GGAGCTGCAGGGCTGGGGCGAGG - Intronic
1077457555 11:2690022-2690044 GGAGAGGCAGGGCTGGCCCTCGG - Intronic
1077478239 11:2801048-2801070 GTGGGTGCAGGGCTGGGGCAGGG + Intronic
1078338807 11:10484693-10484715 TGAGATGCGGGGCCGGCGCAGGG + Intronic
1082739454 11:56894493-56894515 GCAGAGGCAAGGCTGGGGCAGGG + Intergenic
1083713114 11:64560684-64560706 GACGATGCCTGGCTGGCTCAAGG + Intronic
1084363285 11:68683056-68683078 GAAGGTGCAGGGCTGCAGCCTGG - Intergenic
1085276092 11:75301335-75301357 GAAGAGGCTGGGCTGGAGAATGG + Intronic
1085805660 11:79633627-79633649 GTACATGCAGGGCTAGTGCAGGG + Intergenic
1086416665 11:86595762-86595784 TAAGAGGCAAGGCTGGCACAGGG + Intronic
1087658411 11:100955422-100955444 GGAGATACAGGGCTGGGGTAGGG + Intronic
1088736075 11:112728797-112728819 GTTGCTGCAGGGCTGGCCCAGGG - Intergenic
1089337549 11:117735406-117735428 GAAGATGCAGCATTGGCTCAAGG + Intronic
1090205259 11:124880299-124880321 GAAGATGAAGGGCAGGCACAGGG - Intronic
1202810458 11_KI270721v1_random:25157-25179 GGAGCTGCAGGGCTGGGGCGAGG - Intergenic
1091474010 12:753867-753889 GGGGATGCTGGGCTGGGGCAGGG - Exonic
1091658465 12:2363132-2363154 GAGGATGCAGGACTGGCTCTTGG - Intronic
1092244414 12:6855527-6855549 GTAGGAGCAGGGCTGGGGCAAGG + Intronic
1097157992 12:57026650-57026672 GAAGAGGCAGGGCTGGGGAGGGG + Intronic
1101678057 12:106937686-106937708 GATGATTCAAGGCTGGGGCAGGG + Intergenic
1102590928 12:113956283-113956305 GAAAATACAGGGCTGGGGCCAGG + Intronic
1102603506 12:114051337-114051359 GTAGTTGCAGTGCTGGCACATGG + Intergenic
1103693107 12:122791795-122791817 GGAGAGGCAAGGCTGGTGCAGGG + Intronic
1104522501 12:129488300-129488322 GAAGCTGCAGGGCTGGTGCCAGG - Intronic
1106587246 13:31068229-31068251 GAAGATCCAGGGCTGGCCAGAGG - Intergenic
1113217066 13:108054386-108054408 GAAGATGAGGGGCTGGAACAAGG + Intergenic
1113604559 13:111596051-111596073 GAAGAAACAGGGCTTGCACAGGG + Intronic
1113958038 13:114109781-114109803 CCAGAGGCGGGGCTGGCGCAGGG + Intronic
1115050923 14:29062064-29062086 GAAGATGGAGGGCAGGAGGAGGG - Intergenic
1117799144 14:59425757-59425779 GAAGCTGCAGGGCTGGAGGGAGG - Intergenic
1118839518 14:69500397-69500419 GAAGAGGAAGGGTTGGGGCAGGG - Intronic
1119156787 14:72418838-72418860 TAAGAGGCAAGGCTGGCGCCTGG + Intronic
1119706975 14:76789021-76789043 GAAGAGGCTGGGGTGGGGCAAGG + Exonic
1119933193 14:78567426-78567448 GAAGATCCAGAGATGGAGCAGGG - Intronic
1120095198 14:80380536-80380558 GAAGAAGCAGAGCTGGGGTATGG - Intronic
1121446722 14:93983502-93983524 TGAGATGCAGGGTTGGCTCAAGG + Intergenic
1123055106 14:105565893-105565915 GAAGATGCAGGGCTGGGGTTGGG + Intergenic
1123079554 14:105685737-105685759 GAAGATGCAGGGCTGGGGTTGGG + Intergenic
1202921248 14_KI270723v1_random:31992-32014 GCAGATCCAGGGCTGGAACACGG - Intergenic
1124241435 15:28031437-28031459 GAGGCTGCAGGCCTGGCCCAAGG + Intronic
1124625731 15:31306585-31306607 GGAGAGGCAGGGCAGGCCCAGGG + Intergenic
1125796227 15:42406035-42406057 GAAGAGGCAAGTCTGGTGCATGG - Intronic
1127239700 15:57099144-57099166 GTAGAGGCAGGGCAGGGGCATGG - Intronic
1129255363 15:74331168-74331190 GCAGAGGCTGGGCTGGCCCAGGG - Intronic
1129476267 15:75786282-75786304 GGAGCTGCAGGGCTGTCGGAGGG + Intergenic
1129798673 15:78397115-78397137 GAGCAAGCAGGGCTGGGGCATGG + Intergenic
1130133205 15:81160729-81160751 GACGATGCAGGGATGGAGGAAGG - Intronic
1130834892 15:87640493-87640515 GAAGATGCTGTGCAGGCACAAGG - Intergenic
1131300432 15:91194979-91195001 GAAGATGAAGGCATGGAGCAGGG + Intronic
1132457121 16:30106-30128 GATGAGGCTGGGCTGGCACATGG - Intergenic
1132796646 16:1727740-1727762 GAAGCTGCACTGCTGGCGCGGGG - Intronic
1132858383 16:2057766-2057788 AGAGATGCAGGGCTGAGGCAGGG - Intronic
1132858463 16:2058026-2058048 AAAGATGCAGGGCCGAGGCAGGG - Intronic
1132858483 16:2058087-2058109 AGAGATGCAGGGCTGAGGCAGGG - Intronic
1132977504 16:2717889-2717911 GAAGGTGCAGGGCAGGCAAAGGG + Intronic
1133752491 16:8735759-8735781 GAAGCTGCAGGCCAGGCGCTGGG - Exonic
1133775690 16:8893614-8893636 CTAGCTGCAGGGCTGGTGCACGG + Exonic
1134058295 16:11183531-11183553 GTAGACCCAGGGCTGGAGCAGGG - Intergenic
1134182763 16:12061109-12061131 GAAGAAGCAGGGCTTGAGGAGGG - Intronic
1134233744 16:12449606-12449628 GGAGATGCACAGCTGGAGCACGG - Intronic
1135776674 16:25262578-25262600 GAAGATCTAGGCCGGGCGCAGGG - Intergenic
1136548032 16:30966204-30966226 GAAGAAGCAGAGCTGGCAGAGGG + Exonic
1136550403 16:30979716-30979738 GGGGCCGCAGGGCTGGCGCAGGG - Exonic
1137071431 16:35907955-35907977 GAAGATGGAGGGGAGGCTCAGGG + Intergenic
1137384641 16:48030215-48030237 GAAGAAGCAGGGATGGGGCCAGG - Intergenic
1139971376 16:70777690-70777712 GAAGATGCGGAGGTGGGGCAGGG + Intronic
1141823561 16:86463879-86463901 GAAGGTACAGGGCTGGCCCAGGG + Intergenic
1143092136 17:4455253-4455275 GAAGAGGCAGGGCTGTCGTCCGG + Intronic
1143452136 17:7042623-7042645 GAAGCTGCAAGGCGGGCGCCAGG + Exonic
1143503090 17:7350250-7350272 GAAGGGGCGGGGCTGGCGCTGGG + Intronic
1143616126 17:8050886-8050908 GACTATGCAGGCCAGGCGCAGGG + Intergenic
1145017880 17:19410957-19410979 GTAGAGGCAGTGCTGGCCCATGG + Intergenic
1145102466 17:20088429-20088451 TGAGAGGCAGGGCTGGCCCAAGG + Intronic
1146372608 17:32275002-32275024 CAAGATGCAGAGCGGGTGCATGG - Intronic
1146790911 17:35750095-35750117 GAAGTGGCAGGGCTGGCGCCTGG + Exonic
1148185968 17:45643900-45643922 GAAGACACAAGGCTGGCGGAAGG - Intergenic
1148484016 17:47978933-47978955 GAAGATGCAGGGGGGAGGCATGG + Intronic
1148650823 17:49249139-49249161 GAACATGCATGGCTGAGGCAGGG + Intergenic
1148690578 17:49524710-49524732 GAAGATGAAGGGTGGGGGCAAGG + Intergenic
1151757318 17:76082199-76082221 GAAGAAACAGGTCTGGGGCAGGG + Intronic
1151880009 17:76889165-76889187 GAAGATGCAGGGCTGGCGCAGGG + Intronic
1152261544 17:79269926-79269948 GATGCTGCAGGGCAGGCACAGGG - Intronic
1152961110 18:80627-80649 GATGAGGCTGGGCTGGCACATGG - Intergenic
1154175742 18:12086633-12086655 GAAGGTCCAGGGCAGACGCAGGG - Intergenic
1154439912 18:14380358-14380380 GAAGAAGCAGGGCTGGTACTAGG - Intergenic
1157192045 18:45589816-45589838 GAAGTGGCAAGGCTGGGGCAGGG + Intronic
1157949822 18:52023487-52023509 GAAGATGGAGGGTTGGAGAAGGG + Intergenic
1160224431 18:77001234-77001256 GACCATGCAGGGCTGGGGCTTGG + Intronic
1160696990 19:489540-489562 GAGGATGCGGGGCTGGGCCAAGG - Intronic
1161145979 19:2678399-2678421 GAAGCTGCTGGGCTTGGGCACGG + Intronic
1161641375 19:5425544-5425566 GGAGAAGCAGGGGTGGAGCAAGG - Intergenic
1161662522 19:5555720-5555742 GAAGCTGCAGGGCAAGCGCATGG - Intergenic
1162913569 19:13862830-13862852 TAAGAGGCAGGGCTGGGGCCAGG - Intronic
1163667566 19:18610463-18610485 GAAGTTGCAGGCCTGCCCCAGGG + Intronic
1163758794 19:19121760-19121782 GAAGAAGCAGGGCTGGGACTGGG - Exonic
1166211099 19:41306931-41306953 GAAGCTGAGGGGCTGGAGCAGGG - Exonic
1166919566 19:46220119-46220141 GCAGACTCAGGGCTGTCGCATGG + Intergenic
1167197977 19:48043890-48043912 GAAGATGCAGGCGGGGCCCATGG + Exonic
1167304125 19:48696985-48697007 GAAGGGGCAGGGCCGGCGCTGGG + Intronic
1167506794 19:49875179-49875201 GAAGAGGCAGGGCTGGGACCTGG + Intronic
1167759263 19:51434403-51434425 GGAGAAGCTGGGCTGGGGCATGG - Intergenic
925069586 2:956150-956172 GTAGGTGCAGGGCAGGGGCAGGG - Intronic
925723534 2:6851502-6851524 GAGGCTGCAGGGCCGGGGCATGG - Exonic
926159992 2:10481188-10481210 GAAGATGCAGGCCTGGTGTGGGG - Intergenic
927159118 2:20241781-20241803 GAAGCTCCAGGGCTGGCTCCAGG + Intergenic
931542972 2:63350290-63350312 GAGGGTGCAGGGCTGGGGGAGGG + Intronic
932493595 2:72135983-72136005 GAAGATGCAGGGAAGTCACAGGG - Intronic
933609352 2:84417525-84417547 GGAGATGCAGAGCTGTGGCAGGG + Intergenic
933708578 2:85309085-85309107 GAGGAGGCAGGGCTGTCACAGGG - Exonic
935051476 2:99528684-99528706 GAAGAGGCAGGGAGGGAGCAAGG - Intergenic
936516784 2:113185999-113186021 GACGATGCAGGGCTGGGCCTGGG - Exonic
937153680 2:119703184-119703206 GAAAATGCAGGGCTGGGCCCAGG - Intergenic
938408220 2:131044475-131044497 GCAGAAGCAGCGCTGGCTCAAGG + Exonic
938555239 2:132417695-132417717 GAAGATGCTGGACTGGAACACGG - Exonic
941196632 2:162460316-162460338 GAAGATGCTGAGCTGCCGTATGG + Intronic
943129089 2:183835467-183835489 GAAGATGCTGGGCTGGTCAAAGG - Intergenic
943703802 2:191014184-191014206 GAAAAGGCAGCGCTGGCGCCCGG + Exonic
946171272 2:217897357-217897379 GAAGTGGCAGAGCTGGCACAGGG - Intronic
946172772 2:217905394-217905416 GGACATGCAGGGCTGCCCCAGGG + Intronic
948900514 2:240954553-240954575 GAGGGTGCTGGGCTGGCTCACGG - Intronic
1169390428 20:5186215-5186237 GAAGAAGGAGGACTGGCCCAAGG - Intronic
1169421828 20:5466590-5466612 GAAGGTGCAGGGCTTGCTTATGG - Intergenic
1172844657 20:37922707-37922729 GGAGATTCAGGGCTGGACCAGGG + Intronic
1172943782 20:38672868-38672890 GAAGATGCAGGGCCAGCTGAGGG - Intergenic
1174414292 20:50356950-50356972 GACAATTGAGGGCTGGCGCAAGG + Intergenic
1175315261 20:58042930-58042952 GCAGATGTGGGGCTGGGGCAAGG + Intergenic
1175940068 20:62533728-62533750 GAAGATGCAGGGGTGGTTGAGGG + Intergenic
1175972213 20:62692249-62692271 GAAGGTGCGGGGCTGGGGCGGGG + Intergenic
1176005840 20:62861870-62861892 GAGGGGGCGGGGCTGGCGCAGGG - Intergenic
1176141117 20:63545505-63545527 CAAGATTCGGGGCTGGGGCACGG + Intronic
1176455833 21:6909413-6909435 GAAGAAGCAGGGCTGGTACTAGG + Intergenic
1176834006 21:13774461-13774483 GAAGAAGCAGGGCTGGTACTAGG + Intergenic
1177484800 21:21743481-21743503 GAAGATGCAGGAAGGGCTCATGG + Intergenic
1178434581 21:32547007-32547029 AGAGAGACAGGGCTGGCGCAGGG + Intergenic
1178726661 21:35058438-35058460 GAATATGCTGGGCTGGTGTATGG + Intronic
1179913949 21:44464494-44464516 TGAGAGGCAGGGCTGGCTCACGG - Intergenic
1180051285 21:45332065-45332087 GCAGAGGCAGGGCTGGAGCAGGG + Intergenic
1180214886 21:46317680-46317702 CAGGATGCAGGGCTGGCGAAAGG + Intronic
1180231340 21:46428511-46428533 GAAGCTGCAGCACTTGCGCACGG + Exonic
1180637472 22:17272528-17272550 GGGGAAGCAGGGCTGGCCCAGGG - Intergenic
1183320303 22:37161305-37161327 GAAGAAACAGGGCTGGCAGAGGG - Intronic
1183384682 22:37508216-37508238 GGAGATGCAGAGCTGGGGAAGGG - Intronic
1183476719 22:38039641-38039663 GTGGAGGCAGGGCTGGTGCAGGG - Intronic
1183605629 22:38865599-38865621 AAAGAGCCAGGGCTGGGGCAGGG + Exonic
1183726822 22:39594546-39594568 GAAGGAGCAGGGCTGGGGCCAGG + Intronic
1185338832 22:50282770-50282792 GAAGATGCCGGGGTTGGGCACGG + Exonic
950119286 3:10471008-10471030 GAACAACCAGGGCTGCCGCAGGG - Intronic
950550093 3:13661168-13661190 GCAGATGTGGGGCTGTCGCAGGG + Intergenic
953135583 3:40178967-40178989 GAAGACGCAGGGCTGGTGACTGG - Intronic
954090820 3:48282678-48282700 CTACATGCAGAGCTGGCGCATGG + Intronic
955110053 3:55940109-55940131 GAACATGCAGGTCAGGAGCAGGG - Intronic
955953473 3:64265021-64265043 GAAGATGTAGGGGTAGCGGAGGG - Intronic
958747980 3:98160947-98160969 TAATTTGCAGGGCTGGAGCAAGG - Intergenic
959590582 3:108075617-108075639 AAAGATGCATGGCTAGGGCAGGG - Intronic
961362002 3:126373935-126373957 GAGGAAGCAGAGCTGGTGCAGGG - Intergenic
963774441 3:149423659-149423681 GAAGGGGCAGGGCTGGAGAAGGG + Intergenic
964730957 3:159864226-159864248 GAATATGCAAGGCTGGCACTTGG - Intronic
967188539 3:186965756-186965778 GAAGAGGCAGGGCTGGCACCTGG - Intronic
967645098 3:191913204-191913226 GAAGATTCAGAGTTGGCTCAAGG - Intergenic
968480374 4:830507-830529 GGAGAGGCAGGGCTGGCCCAGGG + Intergenic
968555911 4:1246377-1246399 GACGGTGCAGGCCTGGCCCAGGG - Intronic
968573824 4:1355770-1355792 GAAGGGGCAGGGCTGCCGCGAGG + Intronic
968758476 4:2428667-2428689 TGAGATGCAGGCCTGGCGCAGGG - Intronic
969732135 4:8963755-8963777 CGGGATGCAGGGCTGGCGCGGGG - Intergenic
969791728 4:9497840-9497862 CGGGATGCAGGGCTGGCGCGGGG - Intergenic
970402571 4:15731867-15731889 GAGGCTGCAGGGCTGGAGGAGGG - Exonic
971354149 4:25879427-25879449 GAGGATGCTGGGGTGGCGGAGGG - Intronic
972737172 4:41853960-41853982 GAAGATGGAGGGTTGGGGGAGGG + Intergenic
975514597 4:75232631-75232653 GTAGAGGAAGGGCTGGTGCATGG - Intergenic
975843488 4:78501107-78501129 GAGGATGAAGGGCTGGGGGAGGG - Intronic
976207239 4:82634833-82634855 GAAGATGCAGGGCAAGAGGAGGG + Intronic
976270998 4:83230220-83230242 GAATAAGAAGGGCTGGCCCAGGG - Intergenic
978761698 4:112360075-112360097 GAAGATGCAGGGATGGGGTCAGG - Intronic
981171998 4:141636404-141636426 GAACTTGCAGGGCAAGCGCAAGG - Intergenic
984134011 4:175913698-175913720 GGAGATGAAGGGATGGGGCAGGG - Intronic
985658399 5:1143743-1143765 GAAGGTGCAGGGCTTGCAGAGGG - Intergenic
985860168 5:2464506-2464528 GAAGAAGCAGGACAGGGGCAGGG - Intergenic
986078800 5:4367199-4367221 AAAGATGAAGGGCTTGCGTAAGG - Intergenic
987280853 5:16412228-16412250 GCAGATGCAGGGCTGAGGTAGGG + Intergenic
989999322 5:50874744-50874766 GAAGATAGTGGGCTGACGCATGG - Intergenic
990748143 5:58982286-58982308 GACCTTGCAGGGCTGGGGCAAGG - Intronic
990818010 5:59807236-59807258 GAAGAGGCAGGACTGGAGAAGGG - Intronic
993839641 5:92862030-92862052 TAAGATGCAGGCCAGGAGCAAGG + Intergenic
993842825 5:92901520-92901542 GAAGCTGCATGGCTGGAGGAAGG - Intergenic
995027537 5:107441384-107441406 TAATATTCAGGGCTGGAGCAAGG + Intronic
996001906 5:118374538-118374560 GAAATAGCAGGGCTGGCACAAGG + Intergenic
997293323 5:132753325-132753347 CAAGAGGCAGGCCTGGCTCAGGG + Exonic
999967319 5:156823320-156823342 GAGGATGCAGGGATGGTACATGG - Intergenic
1000048497 5:157541536-157541558 GAAGATGCAGGTTTTGCTCAGGG - Intronic
1000180992 5:158811122-158811144 CAAGTTGCAGGGCTGGCACAGGG + Intronic
1001066355 5:168537883-168537905 GAAGATGCAGAGCATGAGCAGGG + Intergenic
1001629442 5:173163852-173163874 CAAGAAACAGGGCTAGCGCAAGG - Exonic
1002637688 5:180616269-180616291 GGAGAGGGAGGGCTGGCACAGGG - Intronic
1002812511 6:645832-645854 GCTGATGCAGGGCTGAGGCAGGG + Intronic
1003112559 6:3261780-3261802 GTAGATGGAGGGCTGGCCCACGG - Intronic
1003417934 6:5929700-5929722 GCAGTTTCAGGGCTGCCGCATGG - Intergenic
1005713359 6:28523609-28523631 GAAGAGGCAGGGCTGGTGGAGGG + Intronic
1006177049 6:32128753-32128775 CAGGATGCAGGGCTGGCTCAGGG - Exonic
1006899301 6:37489810-37489832 GAAGAGGCATGCCTGGCTCAGGG + Intronic
1007164961 6:39822692-39822714 AAAGATGCAGGGCTGGTAAATGG + Intronic
1008128115 6:47691249-47691271 GGAGATTCAGGGTTGGCCCAAGG + Intronic
1008208055 6:48687061-48687083 GAAGGGGCAGGGCAGGCACATGG - Intergenic
1013197942 6:107862404-107862426 GATGATACAGAGCTGGGGCAGGG - Intergenic
1013318071 6:108960336-108960358 GAAGAGGCAGGGCTGCAGCTGGG - Intronic
1014320219 6:119918730-119918752 CAAGCTGCAGGCCTGGCACAGGG - Intergenic
1017971256 6:159314604-159314626 GAACAAGCAGGGATGGAGCAGGG + Intergenic
1018068961 6:160144194-160144216 AAAGAAGCAGGGCTGGGGCAAGG + Intronic
1018443597 6:163834895-163834917 GCAGGTGCAGGGCTAGCGAAAGG - Intergenic
1018700359 6:166421538-166421560 GGAGGTGCAGGGCTGGCCTATGG - Intronic
1019742354 7:2681108-2681130 GAGGATGCAGGGCTGGAGCGGGG + Intronic
1022669968 7:32446578-32446600 GAAGATGGAGGGAGGGAGCATGG + Intergenic
1024273598 7:47660056-47660078 GAAGGAGCAGGGATGGTGCAGGG - Exonic
1026412063 7:70133598-70133620 GAAGAAGCCTGGCTGGTGCAGGG + Intronic
1027191753 7:76000674-76000696 GGATATGCAGGGCTGGCCCAGGG - Intronic
1027232454 7:76280665-76280687 GCAGAGGCAGGGCAGGCGCGGGG + Intronic
1029114963 7:98232042-98232064 GAGGAGGCAGGGCTGGGGTAGGG + Intronic
1029338045 7:99919164-99919186 GAAGACGCAGCGCCGGCGCCTGG - Exonic
1032000881 7:128264751-128264773 GGAGATGCAGGCCTGGCTCATGG + Intergenic
1032401430 7:131626993-131627015 GAATGTGCAGGGCTAGCACAGGG + Intergenic
1034405363 7:150899255-150899277 AAATATGCTGGGTTGGCGCAGGG - Intergenic
1034553811 7:151837399-151837421 AAAGAGGCAGTGCTGGCCCACGG + Intronic
1035521818 8:280685-280707 GAAGATGCAAGGCTGGGGAGTGG - Intergenic
1036221751 8:6926855-6926877 AGAGCTGCAGGGCTGGGGCAAGG - Intergenic
1036716008 8:11124794-11124816 ATTGATGCTGGGCTGGCGCAGGG + Intronic
1037637307 8:20711520-20711542 GAAGAGGCAGAGGTGGGGCATGG + Intergenic
1038493964 8:27988911-27988933 GAGGATGCAGGGCTGGCAGGTGG + Intronic
1038536847 8:28359710-28359732 GAAGCTGCAGGTCTGCTGCAGGG - Exonic
1041278507 8:56188274-56188296 GAAGATGCAGGGAGGGGACAGGG + Intronic
1042606324 8:70550274-70550296 GAAGAAGCAGGCATGGCACATGG + Intergenic
1045178957 8:99759216-99759238 CAAGATCCAGGGCTTGTGCATGG - Intronic
1046823511 8:118661622-118661644 GAAGATGCAGGGGAGAGGCAGGG + Intergenic
1047340098 8:123972839-123972861 GAAGGTGCAGAGCTGGTGCCAGG - Intronic
1047828353 8:128603759-128603781 GAAGAGTGAGGGCTGGTGCATGG + Intergenic
1049071301 8:140357902-140357924 GGAGCTGCACGGCTGTCGCAGGG + Intronic
1049149354 8:141024347-141024369 GAAGGAGCAGGGCTGGCCCAGGG + Intergenic
1049175461 8:141189786-141189808 GGAGGTTCAGGGGTGGCGCAGGG + Intronic
1049662097 8:143824118-143824140 GAGGGTGCAGGGCTGGTGCGGGG + Intronic
1050478263 9:6063361-6063383 GAAGATGCAAGGCTGGGGGAGGG - Intergenic
1050819200 9:9856273-9856295 GATGGTGCAGGGCTGGGCCATGG + Intronic
1054452641 9:65411524-65411546 GACGGTGCAGGGCAGGCCCAAGG + Intergenic
1055667630 9:78568572-78568594 GCAGAGTCAGGGCTGGCACAGGG - Intergenic
1056752657 9:89363435-89363457 GATGATGCAGAGCTGGAGGAAGG - Intronic
1057911304 9:99022399-99022421 GGAGAAGCAGGTCTGGGGCATGG - Intronic
1058234812 9:102476572-102476594 GAAGAAGCAGGGATGCTGCAAGG + Intergenic
1059437075 9:114283502-114283524 GGAGAAGGAGGGCTGGGGCAGGG + Intronic
1060225187 9:121786141-121786163 GAAGATGCAGGGCAGGACCCAGG - Intergenic
1060274449 9:122171845-122171867 GATGATGGAGGGCTGGAACAGGG - Intronic
1061225640 9:129279372-129279394 GAAGATGCAGGGCTGCTGTGAGG - Intergenic
1061255737 9:129453579-129453601 GAAGATGAAGGGATGGGGGATGG + Intergenic
1061255807 9:129453774-129453796 GAAGATGGAGGGATGGGGGATGG + Intergenic
1061391782 9:130320830-130320852 GACGATGCAGGGCAGGGACACGG - Intronic
1062047100 9:134429405-134429427 CCAGAGGCAGGGCTGGCACAGGG - Intronic
1062387512 9:136318844-136318866 ACAGACGCAGGGCGGGCGCAGGG + Intergenic
1062612525 9:137381541-137381563 GAGGAGGCAGGGCTGGGGCGGGG - Intronic
1062737051 9:138143359-138143381 GATGAGGCTGGGCTGGCACATGG + Intergenic
1203772198 EBV:55123-55145 GGAGGTGCAGGCCTGGCGCCTGG - Intergenic
1187366058 X:18666683-18666705 GAAGATGCTGGCTTGGCCCAGGG + Intronic
1190480274 X:50870413-50870435 GAAGAGGCAGGGCTGGAGCTGGG - Intergenic
1190927909 X:54925071-54925093 GAAGGGGCAGTGCTGGCGGATGG + Intronic
1191012868 X:55778891-55778913 GAAGATGGAGGGTTGGGGGAGGG - Intergenic
1191062211 X:56310645-56310667 GAAGCTGCACTGCTGGCCCAAGG + Intergenic
1194394396 X:93363341-93363363 GAAGGTGCAGGGTTGGAGTAGGG + Intergenic
1196054130 X:111336620-111336642 GAAGATACACAGCTGGCTCATGG + Intronic
1197504620 X:127286290-127286312 TAACTTGCAGGGCTGGGGCAAGG - Intergenic
1197918607 X:131563412-131563434 GAAGGTGAAGGGCAGGGGCAAGG - Intergenic
1199679456 X:150215240-150215262 GGAGATGCAGGGATGGGGCCTGG - Intergenic
1199695771 X:150341809-150341831 GGAGATGCAGGGATGGGGCCTGG + Intergenic
1200091799 X:153639474-153639496 GGAGTTGGAGGGTTGGCGCAGGG + Intergenic
1200102814 X:153696483-153696505 GAGGCTGCAGGGCTGGGGCTGGG + Exonic
1200267824 X:154655264-154655286 GAGGCTGCAGGGCTGGGGCTGGG + Intergenic
1200399238 X:156009620-156009642 GATGAGGCTGGGCTGGCACATGG + Intronic
1200461286 Y:3457814-3457836 GACTTTGCAGGGCTGGGGCAAGG - Intergenic