ID: 1151880010

View in Genome Browser
Species Human (GRCh38)
Location 17:76889166-76889188
Sequence AAGATGCAGGGCTGGCGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1122
Summary {0: 1, 1: 0, 2: 5, 3: 88, 4: 1028}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151880002_1151880010 17 Left 1151880002 17:76889126-76889148 CCATGCCAGGTACACCGAGCTGT 0: 1
1: 0
2: 2
3: 17
4: 88
Right 1151880010 17:76889166-76889188 AAGATGCAGGGCTGGCGCAGGGG 0: 1
1: 0
2: 5
3: 88
4: 1028
1151880001_1151880010 18 Left 1151880001 17:76889125-76889147 CCCATGCCAGGTACACCGAGCTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1151880010 17:76889166-76889188 AAGATGCAGGGCTGGCGCAGGGG 0: 1
1: 0
2: 5
3: 88
4: 1028
1151880003_1151880010 12 Left 1151880003 17:76889131-76889153 CCAGGTACACCGAGCTGTTTTGC 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1151880010 17:76889166-76889188 AAGATGCAGGGCTGGCGCAGGGG 0: 1
1: 0
2: 5
3: 88
4: 1028
1151880000_1151880010 26 Left 1151880000 17:76889117-76889139 CCAGGTCTCCCATGCCAGGTACA 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1151880010 17:76889166-76889188 AAGATGCAGGGCTGGCGCAGGGG 0: 1
1: 0
2: 5
3: 88
4: 1028
1151880004_1151880010 3 Left 1151880004 17:76889140-76889162 CCGAGCTGTTTTGCAGATGCAGT 0: 1
1: 0
2: 1
3: 20
4: 229
Right 1151880010 17:76889166-76889188 AAGATGCAGGGCTGGCGCAGGGG 0: 1
1: 0
2: 5
3: 88
4: 1028
1151879999_1151880010 27 Left 1151879999 17:76889116-76889138 CCCAGGTCTCCCATGCCAGGTAC 0: 1
1: 0
2: 3
3: 9
4: 148
Right 1151880010 17:76889166-76889188 AAGATGCAGGGCTGGCGCAGGGG 0: 1
1: 0
2: 5
3: 88
4: 1028

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151880010 Original CRISPR AAGATGCAGGGCTGGCGCAG GGG Intronic
900228800 1:1545520-1545542 AAGCTCCAGGCCGGGCGCAGTGG + Intronic
900266992 1:1762466-1762488 AAGACGTAGGCCGGGCGCAGTGG + Intronic
900592074 1:3464568-3464590 CAGATGCAGGGCTGGCCCCAGGG + Intronic
900653644 1:3744176-3744198 AATTTGCAGGCCGGGCGCAGTGG + Intergenic
900822453 1:4899896-4899918 GAGAGGCAGGGCTGGCCCGGTGG + Intergenic
901083362 1:6596110-6596132 AAGATGCAGGCCAGGCACTGTGG + Intronic
901218394 1:7567564-7567586 AGGAAGCTGGGCTGGCACAGGGG - Intronic
901233198 1:7652534-7652556 CAGATGCTGGGCTGTCTCAGAGG - Intronic
901423405 1:9165768-9165790 AAGATGGATGGCTGGAGCCGGGG - Intergenic
901479524 1:9515329-9515351 AAAATACAGGCCGGGCGCAGTGG + Intergenic
901932136 1:12602571-12602593 AAGGAGAAGGGCTGGAGCAGGGG + Intronic
902256712 1:15193842-15193864 AAAATGCTGGCCAGGCGCAGTGG - Intronic
902555439 1:17244115-17244137 AAGATGCAGTGCAGGCCCAGAGG - Exonic
902582185 1:17414905-17414927 AAAATCCAGGCCGGGCGCAGTGG - Intronic
902856726 1:19211544-19211566 AAGATGCAGGCTGGGCGCAGTGG - Intergenic
902861390 1:19248796-19248818 AAGACACAGGCCGGGCGCAGTGG - Intronic
902869154 1:19302978-19303000 AAAATCCAAGGCTGGCACAGTGG - Intergenic
902899508 1:19504555-19504577 AAAATACAGGACTGGCGCAGTGG - Intergenic
903202496 1:21753853-21753875 AAAAGACAGGGCTGGCGCAGTGG + Intronic
903398732 1:23022625-23022647 AAGAAGAAGGCCAGGCGCAGTGG - Intronic
903422508 1:23228321-23228343 AACATCCAGGCCAGGCGCAGTGG + Intergenic
903437795 1:23365104-23365126 AAGAGGCAGGCCGGGCGCGGTGG + Intronic
903460331 1:23516389-23516411 CAGAGTCAGGGCTGGGGCAGAGG + Exonic
903688673 1:25153185-25153207 AAGATGCAGGCCAGGCACAGTGG + Intergenic
904232575 1:29088332-29088354 AAGATGCTGGCCGGGTGCAGGGG - Intronic
904384850 1:30134580-30134602 AGGATTCAGGGCAGGAGCAGGGG - Intergenic
904475667 1:30763218-30763240 GAGGTTCAGGGCTGGTGCAGAGG - Intergenic
904578284 1:31520435-31520457 AAAATGTAGGCCAGGCGCAGTGG - Intergenic
904650056 1:31998734-31998756 AAAATGTAGGCCGGGCGCAGTGG + Intergenic
904763393 1:32821605-32821627 AAGAAACAGGCCAGGCGCAGTGG - Intronic
905374231 1:37507691-37507713 AGGATTCAGGCCGGGCGCAGTGG + Intronic
905551418 1:38843431-38843453 AAAATTCAGGCCGGGCGCAGTGG + Intronic
905676271 1:39827577-39827599 AAAATCCAGGCCTGGCGCAATGG + Intergenic
905705045 1:40049496-40049518 AAAAACCAGGCCTGGCGCAGTGG - Intronic
905705385 1:40052801-40052823 AAGATGCTGGCCAGGCGCGGTGG + Intronic
905753260 1:40484866-40484888 AAAAAGCAGGCCAGGCGCAGTGG - Intronic
905960247 1:42036567-42036589 AGGAGGGAGGGCTGGAGCAGAGG - Intergenic
905968038 1:42115963-42115985 AAGGAGCAGAGCTGGCACAGTGG + Intergenic
906049703 1:42859976-42859998 AAGATGCAGGCTGGGCACAGTGG - Intergenic
906171038 1:43725483-43725505 AGCATGCAGGCCAGGCGCAGCGG - Intronic
906339451 1:44966150-44966172 AAAATGAAGGCCGGGCGCAGTGG + Intronic
906509920 1:46405159-46405181 ACGATGGAGGCCTGGCGCTGAGG - Intronic
906673382 1:47676408-47676430 ATGATGGAGGGCTGGTGAAGCGG - Intergenic
907044916 1:51294779-51294801 AGGAGGCAGGGCCGGCCCAGGGG - Intronic
907126151 1:52052954-52052976 CAGATCTAGGCCTGGCGCAGTGG + Intronic
907163668 1:52391021-52391043 AAGATAACGGGCAGGCGCAGTGG + Intronic
907194540 1:52675860-52675882 AAGTCGCAGGCCAGGCGCAGTGG - Intergenic
907281307 1:53349056-53349078 CAGCTGCAGGGCCGGCGGAGAGG + Intergenic
907333455 1:53685990-53686012 TAGATGAAGGGCAGGGGCAGAGG - Intronic
907872032 1:58452219-58452241 AGGATGCAGGCCAGGTGCAGTGG - Intronic
907955733 1:59226542-59226564 ATCATGCAGGCCGGGCGCAGTGG + Intergenic
908137420 1:61147436-61147458 AAGATTCAGGTCAGGCGCAGTGG - Intronic
908390424 1:63678681-63678703 AAGTTGCAGGCCAGGCACAGTGG + Intergenic
908702180 1:66913693-66913715 AAGGTGGAGGCCGGGCGCAGTGG + Intronic
908744424 1:67361981-67362003 ACCATGCAGGCCTGGCGCGGTGG + Intronic
909011706 1:70342250-70342272 AAGAGACAGGCCTGGAGCAGTGG + Intronic
909943083 1:81633306-81633328 AACATGCTGGGCGGGCGCAGTGG + Intronic
909964305 1:81888737-81888759 AAAAAGCAGGCCGGGCGCAGTGG - Intronic
911010762 1:93278274-93278296 AAAATGCAGGCCGGGTGCAGTGG - Intronic
911317395 1:96371377-96371399 AAAATGCAGGCCGGGCGCGGTGG - Intergenic
911474614 1:98360192-98360214 AAGATGCAGGCTGGGCACAGTGG + Intergenic
912991211 1:114488474-114488496 AAGATGGAGGCCAGGCACAGTGG + Intronic
913104559 1:115600552-115600574 AAGATCCAGGCCTAGTGCAGTGG + Intergenic
913104885 1:115604787-115604809 AGGATACAGGCTTGGCGCAGTGG + Intergenic
913133918 1:115868837-115868859 AATATTCAGGCCAGGCGCAGTGG + Intergenic
913251798 1:116917896-116917918 AACATACAGGCCGGGCGCAGTGG - Intronic
913295256 1:117313174-117313196 AAGATCCTGGCCGGGCGCAGTGG + Intergenic
913303122 1:117394367-117394389 AAAATGAAGGCCAGGCGCAGTGG - Intronic
914709763 1:150202512-150202534 AACATCCAGGCCAGGCGCAGTGG + Intergenic
914897722 1:151691799-151691821 AAGATACAGGCCAGGCGCGGTGG - Intronic
915242851 1:154536088-154536110 AGGTTGCAGGCCGGGCGCAGTGG + Intronic
915448072 1:155985755-155985777 AACAGGCAGGCCTGGCGCGGTGG + Intronic
915481616 1:156190105-156190127 AATATGCAGGCCAGGCGCAGTGG - Intergenic
915864927 1:159489269-159489291 AAGATGAATGGGTGGTGCAGAGG - Intergenic
915945236 1:160145224-160145246 AAGATCCAGGCCAGGCACAGTGG + Intergenic
915977412 1:160400389-160400411 AAGGCGCAGGGCTGGGGGAGCGG + Intergenic
916176418 1:162043301-162043323 AAAAAGCAGGCCAGGCGCAGTGG + Intergenic
916225245 1:162483337-162483359 AAGATCCCTGGCGGGCGCAGTGG - Intergenic
916789455 1:168112568-168112590 AAAATTTAGGCCTGGCGCAGTGG + Intronic
916815284 1:168345693-168345715 AAAATTCTGGCCTGGCGCAGTGG - Intergenic
917106382 1:171496488-171496510 AAGAATCAGGCCAGGCGCAGTGG - Intronic
917268545 1:173248066-173248088 AAGTTCCAGGCCAGGCGCAGTGG + Intergenic
917420936 1:174863179-174863201 AAAATGCAGGCCAGGCACAGTGG - Intronic
918017364 1:180649136-180649158 AAGATGCAGGCCAGGCGCAGTGG + Intronic
918260197 1:182789241-182789263 AGTCTGCAGGGCTGGTGCAGCGG + Intergenic
919934058 1:202240083-202240105 AACATGCAGGCTGGGCGCAGTGG + Intronic
920437711 1:205958775-205958797 AAGCTGCAGGGCAGACCCAGGGG - Intergenic
920532736 1:206715936-206715958 AATATTCAGGTCAGGCGCAGTGG - Intronic
920572427 1:207027609-207027631 AAGGTGCAGGGATGGCAAAGGGG + Exonic
921073969 1:211685134-211685156 AAGATGTTGGCCAGGCGCAGTGG + Intergenic
921237150 1:213144787-213144809 AAGATTCAGGGCCAGTGCAGAGG + Intronic
921267739 1:213439079-213439101 AAGATTCTGGCCAGGCGCAGTGG - Intergenic
922801809 1:228367966-228367988 AGGGTGCATGGCTGGGGCAGTGG - Intronic
923603721 1:235424926-235424948 AAGATCCAGGCCAGGCGCGGCGG - Intronic
924075266 1:240327857-240327879 AAAATCCAGGCCAGGCGCAGTGG + Intronic
924420759 1:243907560-243907582 AAGATGCTGGCCAGGTGCAGTGG - Intergenic
924496154 1:244591399-244591421 CAGATGCAGGGCTTGGGGAGAGG - Intronic
1062987420 10:1781764-1781786 AAAATATAGGTCTGGCGCAGTGG - Intergenic
1063014926 10:2066541-2066563 AAAATACAGGCCGGGCGCAGTGG + Intergenic
1063027221 10:2192271-2192293 AAGACACAGGCCAGGCGCAGTGG - Intergenic
1063097707 10:2922877-2922899 GAGAGGCAGGCCGGGCGCAGTGG + Intergenic
1063270740 10:4507998-4508020 AAGAAGCTGGCCGGGCGCAGTGG + Intergenic
1063464883 10:6236670-6236692 CAGGTGCAGGGATGGAGCAGTGG + Intergenic
1063646080 10:7884673-7884695 AGGAGGCAGGCCAGGCGCAGCGG - Intronic
1064016896 10:11779839-11779861 AAAAAGCAGGTCTGGCGCAGTGG + Intergenic
1064036516 10:11917881-11917903 TACATGCAGGCCGGGCGCAGTGG + Intergenic
1064544702 10:16438594-16438616 AACAGGCAGGCCAGGCGCAGTGG - Intronic
1064669941 10:17702720-17702742 AAAATGCTGGCCAGGCGCAGTGG + Intronic
1065000663 10:21334975-21334997 AAAATGCAGGCCGGGTGCAGTGG - Intergenic
1065575014 10:27109037-27109059 AAGATCCAGGCCGGGCGCGGTGG + Intergenic
1065728867 10:28692510-28692532 AAGATCCAGGCCGGGCGCAGTGG + Intergenic
1065965067 10:30764174-30764196 AAGACGCAGCGTTGGTGCAGCGG + Intergenic
1066456581 10:35577460-35577482 AAAATGCCGGCCGGGCGCAGTGG + Intergenic
1066555234 10:36605309-36605331 AACATGCAGGCCTGGTGCAATGG - Intergenic
1067108352 10:43380611-43380633 AAGATGCAGGCCAGGTGCTGTGG - Intergenic
1067120393 10:43467488-43467510 AAGTTGAAGGTCGGGCGCAGTGG - Intronic
1067728947 10:48795039-48795061 GAGATCCAGGGTTGGGGCAGTGG + Intronic
1068978419 10:63035656-63035678 AAGAATCAGGCCTGGCGCAGTGG + Intergenic
1069570920 10:69493900-69493922 GAGATGGAGGCCTGGCGCGGTGG - Intronic
1069751238 10:70746518-70746540 AAAAATCAGGGCAGGCGCAGCGG + Intronic
1069831422 10:71284499-71284521 AAGATGCATTGGTGGGGCAGAGG + Intronic
1069900258 10:71702771-71702793 ACTTTGCAGGGCTGGGGCAGGGG + Intronic
1070026340 10:72635894-72635916 AAAATGCAGGCCAGACGCAGAGG + Intergenic
1070108025 10:73455168-73455190 AAGATTAAGGCCAGGCGCAGTGG - Intronic
1070304190 10:75228540-75228562 AAAAAACAGGCCTGGCGCAGTGG - Intronic
1070570536 10:77637218-77637240 AAGCGGTGGGGCTGGCGCAGAGG + Intronic
1070817505 10:79334484-79334506 AAGCTACAGGCCTGGTGCAGTGG - Intergenic
1071519093 10:86318026-86318048 AGGATGCAGGTCAGGGGCAGTGG - Intronic
1071718227 10:88118167-88118189 AAGATGCAGAGGTGGTCCAGAGG + Intergenic
1072107205 10:92285616-92285638 AATATGAAGGGCTGGTGCTGTGG - Intronic
1072158021 10:92741483-92741505 CTGATGCAGGCCGGGCGCAGTGG + Intergenic
1072165555 10:92809453-92809475 AGGATGGAAGGCAGGCGCAGTGG + Intergenic
1072583718 10:96763015-96763037 AAGAAGCTGGGCAGGCGCGGTGG - Intergenic
1072593594 10:96850260-96850282 AAGATCAAGGCCGGGCGCAGTGG + Intronic
1072693014 10:97583986-97584008 AAGCTGCAGGGCTGGCTCAGAGG - Intergenic
1072766557 10:98099221-98099243 TTGATGCAGGCCGGGCGCAGTGG - Intergenic
1072804076 10:98413426-98413448 AAGAAGGAGGCCGGGCGCAGTGG + Intronic
1073158895 10:101372539-101372561 AAAATGCAGGCCAGGCACAGTGG - Intronic
1073525246 10:104175145-104175167 AATATACAGGCCTGGTGCAGTGG + Intronic
1073858398 10:107705867-107705889 GAGATGCAGGCCTGGTGCGGTGG - Intergenic
1073874803 10:107910101-107910123 AAGATGTAGGCCAGGCGCGGTGG + Intergenic
1074040807 10:109786405-109786427 AAGATGCAGTCCTGGCTCTGCGG + Intergenic
1074284815 10:112088231-112088253 AGGATGCAGGGCGGGCTCTGCGG + Intergenic
1074374732 10:112930485-112930507 AAGAAGCAGGCCAGGAGCAGTGG + Intergenic
1074733553 10:116403235-116403257 AAAATTAAGGGCGGGCGCAGTGG + Intergenic
1074857993 10:117487515-117487537 AAGAAGCAGGCCAGGCACAGTGG - Intergenic
1075036543 10:119074176-119074198 AAGTTCCAGGCCGGGCGCAGTGG + Intronic
1075623715 10:123946870-123946892 AAGAGGCAGGGATGTGGCAGAGG - Intergenic
1076485653 10:130815015-130815037 AAGAAGAAGGGCTGGCACGGTGG + Intergenic
1076861496 10:133140221-133140243 AAGGGGCAGGGCAGGGGCAGGGG - Intergenic
1076861540 10:133140331-133140353 AAGGGGCAGGGCAGGGGCAGGGG - Intergenic
1076884669 10:133256552-133256574 AAGAAGCTGGCCAGGCGCAGTGG + Intergenic
1077186533 11:1237965-1237987 GAGATGAGGGGCTGGCGTAGGGG + Intronic
1077604879 11:3602663-3602685 AAGATGCCGGGCAGGCACGGTGG - Intergenic
1077618233 11:3694759-3694781 ATGCTGCAGGGCTGATGCAGTGG + Intronic
1077625322 11:3766400-3766422 AACATGAAGGCCAGGCGCAGTGG + Intronic
1078163596 11:8863518-8863540 AAGAGGCAGGCCGGGCGCAGTGG - Intronic
1078207017 11:9239117-9239139 AGGATGTAGGCCGGGCGCAGTGG - Intronic
1078707736 11:13761371-13761393 AAGATGCAAGTCTGGAGCAATGG - Intergenic
1080126223 11:28737039-28737061 AATATCCAGGCCTGGCACAGTGG - Intergenic
1080227225 11:29974732-29974754 AAGATGCTGGCCGGGCGCGGTGG - Intergenic
1080731413 11:34958586-34958608 AAAAAGCAGGCCAGGCGCAGTGG - Intronic
1080838874 11:35966138-35966160 AAAATGCAGGCTGGGCGCAGTGG + Intronic
1081091002 11:38866524-38866546 AAAATGCAGGCTGGGCGCAGTGG - Intergenic
1081185062 11:40032394-40032416 AAAATGCAGAGCTGGCTAAGTGG + Intergenic
1081570575 11:44288173-44288195 AAGTTGCAGGCTGGGCGCAGTGG - Intronic
1081944160 11:46974238-46974260 ATGAAACAGGCCTGGCGCAGTGG + Intronic
1082017265 11:47499671-47499693 AAGAGGCAGGACTGGGGAAGGGG + Intronic
1082217881 11:49596760-49596782 AAAATGCCGGCCAGGCGCAGTGG + Intergenic
1082739455 11:56894494-56894516 CAGAGGCAAGGCTGGGGCAGGGG + Intergenic
1082953234 11:58840551-58840573 AAGATGCAGGCCAGGTGCAGTGG + Intronic
1083341658 11:61962218-61962240 GAGATGCAGGGCTGAGCCAGTGG - Intronic
1083435626 11:62641049-62641071 AACATGAAGGCCGGGCGCAGTGG + Intronic
1083564622 11:63702970-63702992 AAAGTGCAGGCCAGGCGCAGTGG - Intronic
1083845310 11:65328696-65328718 AAGCTACAGGCCAGGCGCAGTGG + Intergenic
1083849874 11:65358913-65358935 AAGCTGCAGGCCGGGCACAGTGG + Intergenic
1083943396 11:65910803-65910825 AGGATGCTGGCCAGGCGCAGTGG + Intergenic
1083948888 11:65942868-65942890 CAGGTGCTGGCCTGGCGCAGTGG + Intergenic
1084201320 11:67560327-67560349 AAGATGCAGGCCGGGCGCGGTGG + Intergenic
1084292578 11:68183945-68183967 AAGATCCAGGCTGGGCGCAGTGG - Intronic
1084376953 11:68784148-68784170 AAGAATCAGGCCGGGCGCAGTGG - Intronic
1084384589 11:68835223-68835245 TAGAGGCAGGGCAGGCACAGTGG - Intronic
1084420092 11:69056178-69056200 GAGCGGCAGGGCTGGCGCTGAGG - Intronic
1084970634 11:72769892-72769914 AAGGTGCAGAGCTAGCTCAGTGG - Intronic
1085129578 11:74026680-74026702 TAGATTCAGGCCGGGCGCAGTGG + Intronic
1085269115 11:75259748-75259770 AAGAACCAGGGCTGGGGCTGGGG + Intergenic
1085561823 11:77478787-77478809 AAGATCTAGGCCAGGCGCAGTGG + Intergenic
1085577936 11:77623974-77623996 AAGATGCAGGCCAGGCCCGGTGG + Intronic
1085676226 11:78521458-78521480 ATGACACAGGCCTGGCGCAGTGG - Intronic
1086259076 11:84916056-84916078 AAGAAGCAGGCCGGGCGCGGTGG + Intronic
1086856762 11:91874766-91874788 ACAATGCAGGCCGGGCGCAGTGG - Intergenic
1086964590 11:93014558-93014580 TACATGCTGGCCTGGCGCAGTGG - Intergenic
1087993938 11:104780308-104780330 AAAATTCAGGCCTGGTGCAGTGG - Intergenic
1088385760 11:109253436-109253458 AAAATGCAGGCCAGGCACAGTGG - Intergenic
1089575638 11:119440901-119440923 AAGAAGGAGGCCGGGCGCAGTGG - Intergenic
1089586943 11:119515769-119515791 AAAATGCAGGCCAGGCGCGGTGG - Intergenic
1089593559 11:119560453-119560475 AAGACCCAGGGCAGGTGCAGTGG - Intergenic
1089799651 11:121014975-121014997 AATATTGAGGCCTGGCGCAGTGG - Intergenic
1090080447 11:123608992-123609014 AAGCTGCAGGGCTGGTGAAAAGG - Intronic
1090716500 11:129436568-129436590 CAGCTGCAGGGCAGGCACAGAGG - Intronic
1091023501 11:132122189-132122211 AAGATGTAGGGCTGGGGCGCTGG + Intronic
1091297162 11:134482116-134482138 AAGATGCAGGGCTGGAGTCCAGG + Intergenic
1091370016 11:135049939-135049961 AACAGGCAGGGCTGAGGCAGTGG - Intergenic
1091859862 12:3771275-3771297 CAGATGTAGGCCAGGCGCAGTGG + Intergenic
1092141493 12:6186781-6186803 AAAATACAGGGCGGGCGCATTGG + Intergenic
1092150737 12:6246617-6246639 ACCATGTGGGGCTGGCGCAGTGG - Intergenic
1092221071 12:6714199-6714221 AAGATACAGGTCGGGTGCAGTGG - Intergenic
1092758142 12:11784140-11784162 AAGATACAGGCCAGGCACAGTGG + Intronic
1092993741 12:13928022-13928044 AAGTTGGAGGCCAGGCGCAGTGG + Intronic
1093000735 12:13993321-13993343 AAAATGCAGGCCGGGCACAGTGG + Intergenic
1093021287 12:14206613-14206635 AAGATGCAGGTCGGGGGCGGTGG + Intergenic
1093375068 12:18415958-18415980 AAAAAGCCGGGCGGGCGCAGTGG + Intronic
1093455497 12:19361040-19361062 ATGATGCAGGCCGGGCACAGTGG - Intronic
1093578211 12:20760901-20760923 AAGTTTCTGGCCTGGCGCAGTGG + Intergenic
1094605713 12:31947284-31947306 AGGATGGAGGCCTGGTGCAGTGG - Intergenic
1095936560 12:47689752-47689774 AAGAAGCAGGCCGGGCGCAGTGG + Intronic
1096190141 12:49611571-49611593 AAAATGTAGGCCGGGCGCAGTGG + Intronic
1096471713 12:51882061-51882083 AAGATTGAGGCCAGGCGCAGTGG + Intergenic
1096561007 12:52435981-52436003 AAGATTCAGGCCAGGCGCGGTGG - Intergenic
1096685813 12:53287650-53287672 AAGATGTTGGCCTGGCACAGTGG - Intronic
1096736238 12:53657344-53657366 AAAATGGAGGTCTGGCGCGGTGG + Intronic
1096833900 12:54335963-54335985 AATATGGAGGCCAGGCGCAGTGG - Intronic
1096918014 12:55054271-55054293 AGAATGCAGGCCAGGCGCAGTGG + Intergenic
1096993187 12:55821559-55821581 AAGATTCAGGCCGGGCACAGTGG + Exonic
1097286087 12:57878691-57878713 AAGTTGCTGGCCTGGTGCAGTGG + Intergenic
1097294288 12:57946151-57946173 AATGAGCTGGGCTGGCGCAGTGG - Intronic
1097768098 12:63548447-63548469 AAGAAGCAGGGTGGGCTCAGTGG - Intergenic
1097815463 12:64068720-64068742 AATATGCAGGGTGGGCACAGTGG + Intronic
1097852509 12:64426693-64426715 AAGATGGAGGCCTGGCGCGGTGG + Intronic
1098912133 12:76219633-76219655 AAGAACCAGGCCAGGCGCAGTGG - Intergenic
1099247854 12:80215452-80215474 AACATGCAGGCCGGGCGCGGTGG - Intronic
1100361847 12:93886446-93886468 AAGAGGCAGGCTGGGCGCAGTGG - Intronic
1100477228 12:94945711-94945733 AAGATTCAAGCCTGGCACAGTGG + Intronic
1100655346 12:96638523-96638545 AGGATGCAGGCCAGGTGCAGTGG - Intronic
1100970159 12:100061368-100061390 TATATGCAGGGCCGGCGCGGTGG + Intronic
1101936063 12:109058281-109058303 AAGATGGAGGCCGGGTGCAGTGG + Intronic
1102170479 12:110838699-110838721 AAGAATCAGGCCGGGCGCAGCGG - Intergenic
1102210792 12:111125464-111125486 AATATCCAGGCCGGGCGCAGTGG - Intronic
1102233189 12:111277536-111277558 ATGAAGCAGGGCTGGGGGAGAGG - Intronic
1102302707 12:111782595-111782617 AAAATACAGGCCAGGCGCAGTGG + Intronic
1102391358 12:112551531-112551553 AAGAGGCTGGCCGGGCGCAGTGG + Intergenic
1102520007 12:113472223-113472245 AAGTTCCAGGGATGGCGAAGGGG - Intronic
1103309512 12:119993248-119993270 AAGGTGCCGGCCCGGCGCAGTGG - Intronic
1103437325 12:120937018-120937040 AAAATTCAGGCCGGGCGCAGTGG - Intergenic
1103619091 12:122175125-122175147 AAGTTTCTAGGCTGGCGCAGTGG - Intronic
1103651831 12:122438904-122438926 AAGGTAGAGGGCTGGTGCAGTGG - Intergenic
1103665990 12:122566226-122566248 AAGATTTAGGCCGGGCGCAGTGG - Intronic
1103710344 12:122907880-122907902 AAAATACAGGCCGGGCGCAGGGG - Intergenic
1104995732 12:132654358-132654380 AAGAAACAGGCCAGGCGCAGTGG - Intronic
1105501759 13:20979099-20979121 AAAATGCTGGCCAGGCGCAGTGG - Intronic
1105504058 13:20994952-20994974 AAGATGGCAGGATGGCGCAGTGG + Intronic
1105646064 13:22318744-22318766 AAGATGCAGGGTATGGGCAGTGG - Intergenic
1105828006 13:24139778-24139800 AACATGCAGGCCGGGCGCGGTGG + Intronic
1106283950 13:28302792-28302814 GGGCTGCAGGGCTGGCCCAGTGG + Exonic
1106463463 13:29992635-29992657 AAGTTGCAGGCCAGGCACAGTGG + Intergenic
1106632546 13:31491386-31491408 AAGAAACTGGGCTTGCGCAGTGG + Intergenic
1106658085 13:31768816-31768838 AAGAAGTAGGACTGGTGCAGGGG - Intronic
1106741808 13:32652448-32652470 AAAATACAGGCCAGGCGCAGTGG + Intronic
1106779475 13:33042967-33042989 AAGATGCTGGCCGGGCACAGTGG - Intronic
1107442106 13:40436979-40437001 AAGAGACAGGACAGGCGCAGTGG - Intergenic
1107502812 13:40997861-40997883 AAGAAGCAGGCCAGGCGCAGTGG + Intronic
1107944269 13:45403648-45403670 AAGATGCAGGCCAGGCACGGTGG + Intronic
1108084140 13:46767291-46767313 CAGATCCAGGCCAGGCGCAGTGG - Intergenic
1108697673 13:52917126-52917148 GAAATGCAGGCCGGGCGCAGTGG + Intergenic
1108907492 13:55497120-55497142 CATAGCCAGGGCTGGCGCAGTGG + Intergenic
1110768593 13:79308287-79308309 AACATACAGGTCAGGCGCAGTGG - Intergenic
1110929670 13:81199233-81199255 AAGATTCAGGGCTGGGGCCCAGG + Intergenic
1111120701 13:83844996-83845018 AAAATGCAGGCCAGGTGCAGTGG - Intergenic
1111135040 13:84030221-84030243 AAATTGCAGGCCGGGCGCAGTGG - Intergenic
1111247684 13:85562432-85562454 GATAGGCAGGCCTGGCGCAGTGG + Intergenic
1112002924 13:95228485-95228507 AAGATCAAGGCCAGGCGCAGTGG + Intronic
1112408949 13:99145765-99145787 AAAATGCAGGCCGGGTGCAGTGG + Intergenic
1112501098 13:99943827-99943849 AAGAAGCTGGCCTGGCGCGGTGG - Intergenic
1112610380 13:100949354-100949376 AGAATTCAGGGCAGGCGCAGTGG - Intergenic
1113006030 13:105703127-105703149 AAAAATCAGGGCTGGTGCAGTGG + Intergenic
1113529541 13:111012038-111012060 TAGAATCAGGGCTGGTGCAGAGG + Intergenic
1113580503 13:111425502-111425524 GAGCTGCCGGTCTGGCGCAGAGG + Intergenic
1115210647 14:30964630-30964652 GAGATGCAGGCTTGGCACAGTGG + Intronic
1115251579 14:31354084-31354106 AAAATGCCGGCCAGGCGCAGTGG - Intronic
1115595043 14:34901248-34901270 AAGATGCAGGCCAGGCGCGGTGG + Intergenic
1115595381 14:34904051-34904073 AATTTGTAGGCCTGGCGCAGTGG + Intergenic
1115866877 14:37757558-37757580 AAGAAGAAGGCCAGGCGCAGTGG - Intronic
1116803561 14:49468151-49468173 AGGATACAGGCCTGGTGCAGAGG - Intergenic
1117137755 14:52754173-52754195 AAAATTCAGGCCGGGCGCAGTGG - Intronic
1117267038 14:54100113-54100135 TAGATTCAGGCCGGGCGCAGTGG - Intergenic
1117550063 14:56826006-56826028 AAACTCCAGGCCTGGCGCAGTGG - Intergenic
1118163282 14:63312041-63312063 AAACTGCATGGCTGGCTCAGAGG - Intergenic
1118210348 14:63760527-63760549 GAGGTACAGGCCTGGCGCAGTGG - Intergenic
1118647643 14:67855183-67855205 AAGATGCTGGCCAGGCGCGGTGG - Intronic
1118760185 14:68876278-68876300 AAGATTCAGGCCAGGCACAGTGG - Intronic
1118854814 14:69612250-69612272 AAGCTGCGGGGCTTGCGCTGGGG + Intronic
1118860891 14:69662069-69662091 AAGAAGGAGGCCAGGCGCAGTGG - Intronic
1118953472 14:70457386-70457408 AGGATGCAGGGCTGACCCTGTGG - Exonic
1118978341 14:70696323-70696345 AAGATGAAGGGATGGAGGAGAGG - Intergenic
1119010794 14:70985499-70985521 AACCTTCAGGCCTGGCGCAGTGG - Intronic
1119034090 14:71215390-71215412 AGGATGCTGGGGTGGCTCAGTGG + Intergenic
1119156788 14:72418839-72418861 AAGAGGCAAGGCTGGCGCCTGGG + Intronic
1119303798 14:73591257-73591279 AAAAAGCAGGCCGGGCGCAGCGG + Intergenic
1119602182 14:75983579-75983601 TAGAGGCAGGGGTGGGGCAGTGG + Intronic
1119661870 14:76457960-76457982 CAGATTCAGGCCAGGCGCAGTGG - Intronic
1119678182 14:76572073-76572095 AAGATGCAGGCTGGGAGCAGTGG - Intergenic
1119714287 14:76847759-76847781 AAAATGGAGGCCTGGCACAGTGG + Intronic
1120634302 14:86931989-86932011 AAGATGCAGGCCGGGCGCGGTGG - Intergenic
1120883243 14:89431496-89431518 AACATGCTGGCCAGGCGCAGTGG - Intronic
1121093366 14:91198632-91198654 AACATGCAGGCTGGGCGCAGTGG - Intronic
1121446723 14:93983503-93983525 GAGATGCAGGGTTGGCTCAAGGG + Intergenic
1121542834 14:94741484-94741506 GAGATGCAGGCCGGGCACAGTGG + Intergenic
1121625479 14:95382868-95382890 AGGATGCTGGGCTGTGGCAGAGG - Intergenic
1121770489 14:96531286-96531308 AAAATACAGGTCTGGCACAGTGG - Intronic
1122213135 14:100186042-100186064 AGGATGCAGGCCAGGCGCGGTGG - Intergenic
1122221987 14:100245221-100245243 AAGAAACAGGACAGGCGCAGTGG - Intronic
1122301772 14:100735476-100735498 TAGTGGCAGGGCTGGCACAGAGG - Exonic
1122569740 14:102688251-102688273 AAAATGCTGGCCGGGCGCAGTGG - Intronic
1122673892 14:103394019-103394041 AAAATGCAGGCCGAGCGCAGTGG - Intronic
1123031101 14:105451471-105451493 AACATGCTGGGCGGGAGCAGAGG + Intronic
1123791166 15:23721894-23721916 AAAATTCAGGCCGGGCGCAGTGG - Intergenic
1124335362 15:28851727-28851749 AAATTGCAGGCCAGGCGCAGTGG - Intergenic
1124338473 15:28874789-28874811 CACATGCAGGCCAGGCGCAGTGG - Intergenic
1124932830 15:34138750-34138772 AAAATTCAGGCCAGGCGCAGTGG - Intergenic
1124992873 15:34693138-34693160 AAGATGGAGGGCTGGAGAGGAGG - Intergenic
1125309128 15:38359461-38359483 AAGATGAAGGCCAGGTGCAGTGG - Intergenic
1125650029 15:41308982-41309004 AAATTACAGGCCTGGCGCAGTGG - Intergenic
1125657747 15:41372053-41372075 CAGATACAGGCCGGGCGCAGTGG - Intronic
1125703762 15:41712503-41712525 ATGATGAAGGCCAGGCGCAGTGG - Intronic
1125847124 15:42866955-42866977 AAGATCTAGGCCGGGCGCAGTGG + Intronic
1126653648 15:50952934-50952956 AAGATGGTGGCCTGGTGCAGTGG + Intronic
1126771723 15:52063349-52063371 AAAATGCAGGTCAGGTGCAGTGG - Intronic
1127204947 15:56706185-56706207 AAGATGGAGGACAGGCACAGTGG + Intronic
1127433765 15:58936499-58936521 AAAATGTAGGCCGGGCGCAGAGG - Intronic
1127459423 15:59184292-59184314 GAGATCCAGGCCAGGCGCAGTGG - Intronic
1127782491 15:62329467-62329489 AAGATACAGGGCGGGCACGGTGG - Intergenic
1127798268 15:62456412-62456434 AAAATGCAGGGCTGGACCTGAGG + Intronic
1127908974 15:63400118-63400140 AAAATGTAGGCCGGGCGCAGTGG + Intergenic
1128098915 15:64981574-64981596 AGGATCCAGGCCGGGCGCAGTGG - Intronic
1128151436 15:65365781-65365803 AAGAGGCAGGCCGGGCACAGTGG + Intronic
1128162782 15:65435351-65435373 AATATGCAGGTCGGGCACAGTGG + Intergenic
1128314332 15:66650788-66650810 TAGGTCCAGGGCTGGAGCAGTGG - Intronic
1128596751 15:68959137-68959159 AAAATGGAGGCCGGGCGCAGTGG + Intronic
1128683987 15:69670430-69670452 AGGAGGCAGGGATGGGGCAGAGG + Intergenic
1128940530 15:71784381-71784403 AAAATGGAGGCCAGGCGCAGTGG - Intergenic
1129156944 15:73724063-73724085 CAGATGCAGGCCAGGTGCAGTGG - Intergenic
1129255362 15:74331167-74331189 CAGAGGCTGGGCTGGCCCAGGGG - Intronic
1129319277 15:74764980-74765002 AAAATCCAGGCCGGGCGCAGTGG + Intergenic
1129419801 15:75415562-75415584 AGGATGCAGGCTGGGCGCAGTGG + Intronic
1129486987 15:75883588-75883610 AAAATGCAGGCCAGGCACAGTGG - Intronic
1130603316 15:85293000-85293022 AAAATTCAGGCCAGGCGCAGTGG - Intergenic
1130615134 15:85399207-85399229 TAGATGCAGGCCGGGCGCGGTGG + Intronic
1130993529 15:88891165-88891187 GAGATGCAGGCCGGGTGCAGTGG - Intronic
1131111813 15:89769113-89769135 AAGAAGCAGGCCAGGCGCAGTGG - Intronic
1131202300 15:90409523-90409545 AAAATTAAGGCCTGGCGCAGTGG - Intronic
1131223601 15:90605966-90605988 AACATGGAGGCCTGGCGCAGTGG + Intronic
1131256154 15:90863762-90863784 AAAAATCAGGGCAGGCGCAGTGG + Intergenic
1131840467 15:96431205-96431227 AAAATTCAGGCCGGGCGCAGTGG - Intergenic
1131926621 15:97391631-97391653 AATAAGCAGGCCGGGCGCAGTGG + Intergenic
1132010696 15:98273560-98273582 CAGATGCAGGCCAGGCGCAGTGG - Intergenic
1132754874 16:1478684-1478706 CACATGCAGGCCAGGCGCAGTGG + Intergenic
1132859850 16:2064824-2064846 AAGATGAAGGCCGGGCACAGTGG + Intronic
1132884474 16:2176600-2176622 AAGGTCCAGGGCTGGTTCAGGGG - Exonic
1132977505 16:2717890-2717912 AAGGTGCAGGGCAGGCAAAGGGG + Intronic
1133217172 16:4299662-4299684 AAGAAACAGGCCTGGCGCGGTGG + Intergenic
1133745160 16:8680713-8680735 AAAATGGAGGTCGGGCGCAGTGG - Intronic
1133775691 16:8893615-8893637 TAGCTGCAGGGCTGGTGCACGGG + Exonic
1134182762 16:12061108-12061130 AAGAAGCAGGGCTTGAGGAGGGG - Intronic
1134396546 16:13870214-13870236 AAGATGCTGGCCAGGCGCAGTGG + Intergenic
1134637134 16:15800916-15800938 AATAGGCAGGCCGGGCGCAGTGG + Intronic
1134829324 16:17310561-17310583 AAAAGGCAGGCCCGGCGCAGTGG + Intronic
1135483735 16:22845139-22845161 AAGATTTAGGCCAGGCGCAGTGG - Intronic
1135507761 16:23053439-23053461 CAGAGGCAGGGCAGGTGCAGAGG - Intergenic
1135537584 16:23305953-23305975 AAGTTTCAGGCCAGGCGCAGTGG + Intronic
1135618062 16:23929002-23929024 TGGATACAGGCCTGGCGCAGTGG - Intronic
1135762784 16:25150629-25150651 AAGATGCGGGCCAGGCACAGTGG - Intronic
1135776673 16:25262577-25262599 AAGATCTAGGCCGGGCGCAGGGG - Intergenic
1135832457 16:25788123-25788145 AAGATGCCAGGCCGGTGCAGTGG + Intronic
1136232749 16:28896696-28896718 AAAATGAAGGCCAGGCGCAGTGG - Intronic
1136360542 16:29776521-29776543 AAAATGCAGGCCAGGCACAGTGG + Intergenic
1136363088 16:29794000-29794022 AAGTTGCAGGGATGGAGGAGTGG + Intronic
1136550402 16:30979715-30979737 GGGCCGCAGGGCTGGCGCAGGGG - Exonic
1136737499 16:32477122-32477144 AAGAGGCAGGGCCGGGCCAGGGG + Intergenic
1136911722 16:34149402-34149424 AAAATGAAGGCCAGGCGCAGTGG - Intergenic
1136934393 16:34445404-34445426 AAGATGTGGGCCAGGCGCAGTGG - Intergenic
1136970179 16:34966410-34966432 AAGATGTGGGCCAGGCGCAGTGG + Intergenic
1137643774 16:50057003-50057025 AATATGCAGGTCAGGTGCAGTGG + Intergenic
1137650803 16:50118664-50118686 AACATGCAGGCCGGGCGCAGCGG - Intergenic
1138023239 16:53503211-53503233 CAGGGGCAGGGCTGGCGCTGCGG - Exonic
1138269281 16:55683322-55683344 AAAAACCAGGCCTGGCGCAGTGG + Intronic
1138276443 16:55738296-55738318 AAGATGCAGGGCAGGCTACGTGG - Intergenic
1138353858 16:56362379-56362401 AAGATGCCCTGCTGGCTCAGGGG + Exonic
1138453220 16:57106070-57106092 CTGCTGCTGGGCTGGCGCAGAGG + Intronic
1138555539 16:57769321-57769343 AACATGCAGGCCAGGCGCGGTGG - Intronic
1138603957 16:58075394-58075416 AAGATGCTGGGTGGGCGCAGTGG + Intergenic
1138819441 16:60241186-60241208 AGGATGCTGGGCAGGCACAGTGG - Intergenic
1139231899 16:65291527-65291549 AAGAAACAGGCCAGGCGCAGTGG + Intergenic
1139370598 16:66466854-66466876 GAGATGCAGGCTGGGCGCAGTGG - Intronic
1139554562 16:67698764-67698786 AAAATGCAGGCCGGGCACAGTGG - Intronic
1139555921 16:67710276-67710298 AAAATACAGGGCTGGCGTGGTGG - Intronic
1139720759 16:68851443-68851465 AAGATGCAGGCCGGGCGTGGTGG - Intronic
1139971377 16:70777691-70777713 AAGATGCGGAGGTGGGGCAGGGG + Intronic
1140115445 16:72037492-72037514 AGGATGCAGGCTGGGCGCAGTGG + Intergenic
1140297059 16:73718899-73718921 ATGATTCAGGCCAGGCGCAGTGG - Intergenic
1140760573 16:78105172-78105194 ATGATGCAGGCCGGGTGCAGTGG + Intronic
1140886817 16:79251593-79251615 AAGACTTAGGCCTGGCGCAGTGG - Intergenic
1141107574 16:81246114-81246136 GAGATGGAGGCCGGGCGCAGTGG - Intronic
1141439223 16:84018598-84018620 AAGAGGCAGGCATGGGGCAGGGG - Intronic
1141537615 16:84693478-84693500 TAGAATCAGGCCTGGCGCAGTGG - Intergenic
1141980769 16:87548719-87548741 AAGATGGAGGCCGGGTGCAGCGG + Intergenic
1142140957 16:88472637-88472659 AAAATTCAGGCCGGGCGCAGTGG - Intronic
1142154038 16:88525129-88525151 AAGAGGCAGGGGTGGCCCAGAGG + Intronic
1142225931 16:88877674-88877696 CAGAGGCAGGGGTGGGGCAGAGG - Intronic
1142334560 16:89479343-89479365 AATATCTAGGCCTGGCGCAGTGG + Intronic
1203015572 16_KI270728v1_random:352455-352477 AAGAGGCAGGGCCGGGCCAGGGG - Intergenic
1203033907 16_KI270728v1_random:625613-625635 AAGAGGCAGGGCCGGGCCAGGGG - Intergenic
1142981639 17:3675836-3675858 AAGATCCAGGCTGGGCGCAGTGG - Intronic
1143086812 17:4422221-4422243 AAGATGCAGGCCAGACGCAGTGG + Intergenic
1143118533 17:4593732-4593754 ATGAGGCAGGGCTGGGTCAGAGG + Intronic
1143169805 17:4922087-4922109 AAAATTCAGGGCCGGTGCAGTGG + Intergenic
1143440713 17:6971410-6971432 AAGATTCAGGCCGGGCGCGGTGG + Intronic
1143457302 17:7076597-7076619 AGCATGCAGGCCGGGCGCAGTGG - Intronic
1143807681 17:9442693-9442715 AAGATACAGGCCGGGCACAGTGG - Intronic
1143987393 17:10926661-10926683 ATGATGCAGCACTGGGGCAGAGG - Intergenic
1144506934 17:15839820-15839842 AAGCAGCAGGCCGGGCGCAGTGG - Intergenic
1145036346 17:19543395-19543417 ATGATGTAGGCCGGGCGCAGTGG - Intronic
1145102467 17:20088430-20088452 GAGAGGCAGGGCTGGCCCAAGGG + Intronic
1146274700 17:31509412-31509434 AAGCTGCAGGGCGGGAGCAGTGG + Intronic
1146727431 17:35167730-35167752 AGGAAGCAGGACTGGGGCAGAGG - Intronic
1146790912 17:35750096-35750118 AAGTGGCAGGGCTGGCGCCTGGG + Exonic
1147169450 17:38609453-38609475 CAGAAGCAGGCCTGGGGCAGCGG - Intergenic
1147227391 17:38990007-38990029 AAGATGCTGGCCGGGCGCGGTGG - Intergenic
1147352871 17:39865688-39865710 AAGTTGTAGGCCAGGCGCAGTGG + Intergenic
1147671400 17:42178857-42178879 ACGCTGCAGGGCTGGCTCACTGG + Exonic
1147677498 17:42218356-42218378 ATGATGAGGGGCTGGTGCAGGGG + Intronic
1147688543 17:42301227-42301249 ACGATGAGGGGTTGGCGCAGGGG - Intronic
1147804536 17:43121086-43121108 AAGGTCCAGGCCGGGCGCAGTGG + Intronic
1148220579 17:45858875-45858897 AAGAAGCAGGCCGGGTGCAGTGG + Intergenic
1148257597 17:46149286-46149308 AAGAGGCAGGCTGGGCGCAGTGG - Intronic
1148263909 17:46208881-46208903 ATGATGCAGCCCGGGCGCAGTGG + Intronic
1148343119 17:46885291-46885313 AAAATGCTGGCCAGGCGCAGTGG - Intronic
1148371016 17:47100070-47100092 AAGCGGCAGGGCTGGGGGAGAGG - Intergenic
1148607068 17:48938207-48938229 AAAATGCAGGTTGGGCGCAGTGG + Intronic
1148611237 17:48965970-48965992 ATGATACAGGCCAGGCGCAGTGG + Intronic
1148650824 17:49249140-49249162 AACATGCATGGCTGAGGCAGGGG + Intergenic
1149173343 17:53840156-53840178 AAGCTGCAGGCCAGGCGCAGTGG + Intergenic
1149681718 17:58512271-58512293 AAGTTGGAGGCCGGGCGCAGTGG - Intronic
1149719061 17:58824893-58824915 AAGAAGCAGGCTGGGCGCAGTGG - Intronic
1149906622 17:60532535-60532557 AAGATCCAGGCCAGGCGCAGTGG + Intergenic
1149915959 17:60609589-60609611 AACATCCAGGGCTGACACAGTGG - Intronic
1150149324 17:62796277-62796299 ATGATGTAGGCCGGGCGCAGTGG - Intronic
1150335067 17:64325099-64325121 AATTTGCCGGGCGGGCGCAGTGG + Intronic
1150362533 17:64549466-64549488 ATGATTCAGGCCTGGTGCAGTGG + Intronic
1151113350 17:71704912-71704934 AAGATACAGGCCGGGCGCGGTGG + Intergenic
1151591004 17:75044627-75044649 AAAATGCAGGCCGGGCGCGGTGG - Intronic
1151735063 17:75934588-75934610 AAGATGCTGGCCGGGCGCGGTGG + Intronic
1151801356 17:76381795-76381817 AAGCAGCAGGCCGGGCGCAGTGG - Intronic
1151828185 17:76535247-76535269 AGGGTGCTGGCCTGGCGCAGTGG + Intronic
1151841588 17:76622084-76622106 GAAATGCAGGCCAGGCGCAGTGG - Intergenic
1151880010 17:76889166-76889188 AAGATGCAGGGCTGGCGCAGGGG + Intronic
1152277458 17:79366642-79366664 CAGATGCTGGGCTGGCGGCGAGG - Intronic
1152418113 17:80176085-80176107 AAGATCCAGGCTTGGTGCAGTGG - Intronic
1152858882 17:82683931-82683953 AAGATACTGGCCGGGCGCAGCGG + Intronic
1153283158 18:3433044-3433066 AAGAAGAAGGCCAGGCGCAGTGG - Intronic
1153671411 18:7415764-7415786 AAGATGCAGGCCAGGCATAGTGG - Intergenic
1153880226 18:9415956-9415978 AAGCTACAGGCCTGGTGCAGTGG - Intergenic
1154050904 18:10956681-10956703 AACATCCAGGCCAGGCGCAGTGG + Intronic
1154064171 18:11091096-11091118 AATATTCAGGCCCGGCGCAGTGG + Intronic
1155287321 18:24303286-24303308 AAGCTTGAGGCCTGGCGCAGTGG - Intronic
1156643778 18:39135138-39135160 ATGATACAGGCCGGGCGCAGTGG + Intergenic
1157223212 18:45841559-45841581 AAGGTGCAGGGGTGGCGGTGGGG + Intronic
1157817400 18:50739954-50739976 AAAATGCAGGCCAGGCACAGTGG + Intergenic
1158459797 18:57636110-57636132 AAGGTGCTGGCCTGGCGCGGTGG - Intergenic
1158593192 18:58794625-58794647 AAAATCCAGGCCAGGCGCAGTGG + Intergenic
1158738379 18:60110399-60110421 ATGATGCTGGCCGGGCGCAGTGG - Intergenic
1159018710 18:63125140-63125162 AAGATGTAGCTCTGGCCCAGTGG - Exonic
1159278721 18:66255589-66255611 CAGTTTCAGGCCTGGCGCAGTGG + Intergenic
1159596806 18:70390137-70390159 AAAATCAAGGCCTGGCGCAGTGG - Intergenic
1159817084 18:73087997-73088019 AGGACCCAGGCCTGGCGCAGTGG + Intergenic
1160478884 18:79220051-79220073 AGGCTGCTGGGCTGGTGCAGAGG + Intronic
1160522340 18:79515055-79515077 AAAATGCAGGCCAGGCACAGTGG + Intronic
1160989305 19:1854058-1854080 AATCTGCAGGGATGGGGCAGGGG + Exonic
1161073845 19:2275618-2275640 AGGAGGCAGGGCTGGGGCTGAGG - Exonic
1161359582 19:3840153-3840175 AAGATGCAGGGCCTGGGCAGAGG - Intronic
1161369349 19:3901707-3901729 AACATGCTGGGCGGGCGCGGTGG + Intronic
1161715670 19:5874918-5874940 AAGAGGCAGAGCTGTCGCAGAGG + Intronic
1161835510 19:6643421-6643443 AAGATGTGGGCCAGGCGCAGTGG - Intergenic
1161857290 19:6773133-6773155 CAGGTCCAGGGCTGGCCCAGGGG + Intronic
1161870683 19:6867442-6867464 AAGATGGAGGCCAGGCGCGGTGG + Intergenic
1161947353 19:7445908-7445930 AAAAAGCAGGCCAGGCGCAGTGG - Intronic
1162043817 19:7985779-7985801 GAAATGCAGGGCTGTCCCAGAGG + Intronic
1162073509 19:8169215-8169237 AAGAAGCAGGTCAGGCACAGTGG + Intronic
1162077814 19:8200230-8200252 AAAATGCAGGCCAGGCGCGGTGG + Intronic
1162131066 19:8526563-8526585 AAGAAGGAGGGCTGGGGCGGTGG - Exonic
1162422080 19:10571376-10571398 AAAATACAGGCCGGGCGCAGTGG + Intergenic
1162484336 19:10949767-10949789 AAGAAGAAGGCCGGGCGCAGTGG + Intergenic
1162485193 19:10956034-10956056 AAGAAGAAGGCCGGGCGCAGTGG + Intergenic
1162606839 19:11715534-11715556 AAGATCCTGGCCGGGCGCAGTGG - Intergenic
1162777141 19:12986653-12986675 AAGAAACAGGCCGGGCGCAGTGG - Intergenic
1162845237 19:13387241-13387263 AAAATGGAGGCCGGGCGCAGTGG - Intronic
1162895745 19:13763970-13763992 AACATGCAGGACAGGCGCTGTGG - Intergenic
1162955521 19:14095801-14095823 AAGATGAAGGCCAGGCGCGGTGG - Intronic
1163181017 19:15601860-15601882 AAAATTCAGGCCAGGCGCAGTGG - Intergenic
1163250602 19:16124437-16124459 CAGATGCAGGGCTGGGCCTGGGG + Intronic
1163271117 19:16254507-16254529 AAGAAGAAGGCCAGGCGCAGTGG - Intergenic
1163335909 19:16671494-16671516 AAGATGACGGCCAGGCGCAGTGG - Intronic
1163816630 19:19469657-19469679 AAGATTCAGGCTGGGCGCAGTGG + Intronic
1164283494 19:23789963-23789985 AAGCTGGGGGGCAGGCGCAGTGG - Intronic
1164435998 19:28229954-28229976 AAGCTGCAGGCCGGGCACAGTGG - Intergenic
1164449489 19:28348239-28348261 AAGATGCAGGCCTGGTGTGGTGG + Intergenic
1164612727 19:29643902-29643924 AGCATGCAGGCCGGGCGCAGTGG + Intergenic
1164985907 19:32648511-32648533 AAGATTCAGGCCAGGCGCGGTGG + Intronic
1164995087 19:32715327-32715349 AACATACAGGCCAGGCGCAGTGG - Intergenic
1165206907 19:34197376-34197398 AAAATCCAGGCCAGGCGCAGTGG - Intronic
1165318532 19:35072332-35072354 GAGGGGCAGGGCTGGCGCTGGGG + Intergenic
1165478305 19:36045554-36045576 AATATTCAGGCCTGGCACAGTGG - Intronic
1165535252 19:36438863-36438885 AAGATGGAGGCCAGGCACAGCGG + Intergenic
1165559150 19:36664298-36664320 ATAATGCAGGCCAGGCGCAGGGG + Intronic
1165708761 19:37994885-37994907 AAGCTCCATGGCTGGTGCAGAGG + Intronic
1165826607 19:38709313-38709335 GGGAGGCAGGGCTGGCCCAGAGG - Intronic
1165891871 19:39117494-39117516 AAGATGCAGGCCGGGCGTGGTGG - Intergenic
1165959960 19:39525619-39525641 AAGCAGCAGGGCGGGCGCGGTGG + Intergenic
1166186904 19:41145775-41145797 AAAATGTAGTGCAGGCGCAGTGG - Intergenic
1166212336 19:41315012-41315034 AGGGTGCAGGCCAGGCGCAGTGG + Intronic
1166530930 19:43543103-43543125 AAGATACAGGTGTGGCTCAGAGG + Exonic
1166892816 19:46004225-46004247 AAGTTGCAGGCTGGGCGCAGTGG - Intronic
1166941809 19:46371574-46371596 CATAAGCAGGGCAGGCGCAGCGG + Intronic
1167182771 19:47918033-47918055 GAGAAACATGGCTGGCGCAGTGG - Intergenic
1167184736 19:47933785-47933807 GAGAAACATGGCTGGCGCAGTGG - Intergenic
1167186061 19:47944526-47944548 GAGAAACATGGCTGGCGCAGTGG - Intergenic
1167344427 19:48936407-48936429 AAGATGCCGGCCGGGCGCGGTGG + Intronic
1167542487 19:50098320-50098342 GAGAAACAAGGCTGGCGCAGTGG + Intergenic
1167542924 19:50101385-50101407 GAGAAACAAGGCTGGCGCAGTGG + Intergenic
1167543360 19:50104449-50104471 GAGAAACAAGGCTGGCGCAGTGG + Intergenic
1167646634 19:50709426-50709448 ACCATGCAGGCCGGGCGCAGTGG - Intronic
1167952764 19:53040598-53040620 AAGATGTGGGCCAGGCGCAGTGG + Intergenic
1168060151 19:53887208-53887230 AACATGCAGGCCAGGCACAGTGG + Intronic
1168077030 19:53986449-53986471 AAGCTGAAGGCCGGGCGCAGTGG + Exonic
1168138155 19:54365501-54365523 AAGAAACAGGCCAGGCGCAGTGG + Intronic
925069585 2:956149-956171 TAGGTGCAGGGCAGGGGCAGGGG - Intronic
926040726 2:9670848-9670870 AAGGTGTAGGCCGGGCGCAGTGG + Intergenic
926042521 2:9685256-9685278 AAGATACTGGCCGGGCGCAGTGG + Intergenic
926159991 2:10481187-10481209 AAGATGCAGGCCTGGTGTGGGGG - Intergenic
926329010 2:11809701-11809723 AAGATCTAGGCCGGGCGCAGTGG - Intronic
926822324 2:16866103-16866125 AAGATTGAGGCCGGGCGCAGTGG + Intergenic
927116616 2:19909749-19909771 AAAAAGCAGGCCAGGCGCAGTGG - Intergenic
927336520 2:21930940-21930962 CAGATGCAGGGGAGGCTCAGTGG - Intergenic
927376273 2:22418264-22418286 AGAATGCAGGCCGGGCGCAGTGG + Intergenic
927535319 2:23852629-23852651 AAAATTCAGGCCAGGCGCAGTGG + Intronic
927540898 2:23910463-23910485 AGTATGCAGGCCGGGCGCAGTGG - Intronic
927752223 2:25679467-25679489 AGGAGGTAGGCCTGGCGCAGTGG - Intergenic
928514209 2:32030341-32030363 AAAAATCAGGCCTGGCGCAGGGG + Intronic
928579396 2:32691584-32691606 GAGATGCAGGCCAGGCGCGGTGG - Intronic
928701911 2:33906973-33906995 AACATTAAGGCCTGGCGCAGTGG - Intergenic
928848663 2:35713692-35713714 AAGATTCAGGGTTGGCGGGGTGG - Intergenic
928996405 2:37296608-37296630 AAGAGTCAGGCCGGGCGCAGTGG + Intronic
929157145 2:38798656-38798678 AAGATTCGGGCCAGGCGCAGTGG + Intronic
929189260 2:39124279-39124301 AAGCTGAGGGGCTGGCGCGGGGG - Intronic
929305993 2:40362180-40362202 AAGATGTAGGCCAGGCGCAGTGG - Intronic
929678173 2:43959615-43959637 AAAATACAGGCCAGGCGCAGTGG + Intronic
929706938 2:44223520-44223542 AAAATGCAGGCCGGGCGCGGTGG + Intronic
930700992 2:54457226-54457248 GAGCTGAAGGGCGGGCGCAGCGG - Intronic
931661443 2:64567795-64567817 AAGGTTCAGGCCAGGCGCAGTGG + Intronic
931747760 2:65305270-65305292 ATGAAGCAGGCCTGGGGCAGTGG - Intergenic
932056104 2:68445755-68445777 AAGGTGCAGTGCTGGGGCTGGGG + Intergenic
932637044 2:73399136-73399158 AAAATCCAGGCCAGGCGCAGTGG - Intronic
932768091 2:74483687-74483709 AAGATGGAGGCCGGGCGCGGTGG + Intronic
933005068 2:76981777-76981799 AAGATGCTGGCCTGGTGCTGTGG - Intronic
933382411 2:81566561-81566583 AATATGCAGGCCGGGCGCGGTGG + Intergenic
933609353 2:84417526-84417548 GAGATGCAGAGCTGTGGCAGGGG + Intergenic
933721726 2:85401467-85401489 CAGAAGCAGGGCTGGCTCTGAGG + Intronic
933929137 2:87130737-87130759 AAGTTGGTGGCCTGGCGCAGTGG - Intergenic
934188632 2:89766235-89766257 AAGAGGCAGGGCCGGGCCAGGGG + Intergenic
934535835 2:95132580-95132602 AACATGCAGGCCAGGCACAGTGG + Intronic
935251199 2:101262932-101262954 AAGATACAGGCTGGGCGCAGTGG + Intronic
936043287 2:109166189-109166211 AAGATGCAGGCCAGGCACGGTGG + Intronic
936446302 2:112598208-112598230 AAAATGTAGGCCAGGCGCAGTGG + Intergenic
937040585 2:118817655-118817677 AGGATGCAGGACTGGCCCTGAGG - Intergenic
937342581 2:121100797-121100819 GAGATGCACGGCTGGAGCTGGGG - Intergenic
937833367 2:126446587-126446609 GTGATGCAGGGCTGGAACAGAGG + Intergenic
938539382 2:132273749-132273771 AAAATGAAGGCCGGGCGCAGTGG + Intergenic
938967240 2:136399375-136399397 CAGATCCAGGCCTGGCACAGTGG - Intergenic
939921884 2:148126105-148126127 AAGAAGCAGGCTGGGCGCAGTGG + Intronic
940603331 2:155888451-155888473 AAAATGTAGGCCTGGCGCGGTGG + Intergenic
942070020 2:172308074-172308096 AAGAGGCTGGGCTGGGGAAGAGG - Intergenic
942183664 2:173403959-173403981 TAGCTGCAGGCCTGGCGCAGTGG - Intergenic
942312043 2:174664918-174664940 AAGATCCAGGCCTGGCGCGGTGG - Intronic
942467478 2:176223947-176223969 TAGAAGCAGGCCAGGCGCAGTGG - Intergenic
942675286 2:178420631-178420653 AGGAAGCAGGGCTGGGGAAGAGG + Intergenic
943026902 2:182640730-182640752 AATATGCAGGCCGGGTGCAGTGG + Intergenic
943797278 2:192012188-192012210 AATATGTAGGCCAGGCGCAGTGG - Intronic
944614262 2:201443911-201443933 AAAATCCAGGGCGGCCGCAGTGG + Intronic
945074356 2:206022909-206022931 AGGATCCAGGCCGGGCGCAGTGG + Intronic
945092857 2:206192128-206192150 AAAAAGTAGGCCTGGCGCAGTGG - Intronic
945387919 2:209225913-209225935 AAAATGCAGGCCAGGCACAGTGG + Intergenic
946158313 2:217821188-217821210 ATGATGCAGGTCTGGGGCAGAGG + Intronic
946754385 2:222929492-222929514 AAGATTCTGGCCGGGCGCAGTGG + Intronic
946843738 2:223840926-223840948 AAGAGGCAGGCCGGGCACAGTGG + Intergenic
947201689 2:227620066-227620088 AAAATGCAGGGCTGGAGCTGTGG + Intronic
947714428 2:232332634-232332656 AGGAGGCAGGACTGGGGCAGGGG - Intronic
947733633 2:232444013-232444035 AGGAGGCAGGACTGGGGCAGGGG - Intergenic
947747673 2:232517393-232517415 GAGATGCAGCCCTGGAGCAGGGG + Intergenic
947811379 2:233006101-233006123 ACAATGCAGGCCAGGCGCAGTGG - Intronic
947908473 2:233784860-233784882 AAAATGTAGGCCAGGCGCAGTGG + Intronic
948048474 2:234961557-234961579 AACATGGAGGCCGGGCGCAGTGG - Intronic
948955575 2:241287707-241287729 TAGCTGCAGGCCAGGCGCAGTGG - Intronic
1168806956 20:677074-677096 GAGATGCAAGGCTGGTGGAGTGG + Intergenic
1169272994 20:4215140-4215162 AAAATTCAGGCCAGGCGCAGTGG + Intergenic
1170016838 20:11791074-11791096 AAGATGTTGGCCTGGTGCAGTGG - Intergenic
1170913640 20:20600812-20600834 AAAATGTAGGGCGGGCGCAGTGG + Intronic
1171036312 20:21715050-21715072 AAGAAGCGGGACTGGAGCAGAGG - Exonic
1171095985 20:22332623-22332645 AAAATGGAGGGCTGGCACAGAGG - Intergenic
1171336743 20:24392277-24392299 AAGATGCTGAGGTGGCTCAGAGG - Intergenic
1172016859 20:31880772-31880794 AAGATGGAGGCTGGGCGCAGTGG - Intronic
1172159997 20:32861022-32861044 ACGATGCAGGCCAGGCACAGTGG - Intronic
1172213836 20:33220109-33220131 AAAAATCAGGGCGGGCGCAGTGG + Intronic
1172303074 20:33863348-33863370 CAGATGCAGGGCTGGGGGTGGGG - Intergenic
1172351567 20:34246743-34246765 AAGATGAAGGCCCGGCACAGGGG - Intronic
1172359761 20:34303704-34303726 AAGTTGCAGGCCAGGCGCGGTGG + Intronic
1172444131 20:34984435-34984457 CAGAGGCCGGGCTGGGGCAGAGG + Intronic
1172680780 20:36712881-36712903 AAGAAACAGGGCAGGTGCAGTGG - Intronic
1172740359 20:37161697-37161719 AGGATGCAGGCTGGGCGCAGTGG + Intronic
1172774073 20:37397171-37397193 CAGCTGCAGGGCTGGAGAAGCGG - Intronic
1172844658 20:37922708-37922730 GAGATTCAGGGCTGGACCAGGGG + Intronic
1172863575 20:38077203-38077225 AAGGTCCAGGCCTGGTGCAGTGG - Intronic
1172943781 20:38672867-38672889 AAGATGCAGGGCCAGCTGAGGGG - Intergenic
1173173270 20:40744232-40744254 CAGAGGCAGGGCTGGGGCAGCGG - Intergenic
1173645077 20:44628235-44628257 AGGATGGAGGCCAGGCGCAGTGG + Intronic
1173793296 20:45841681-45841703 AGGCTGCAGGTCTGGCCCAGGGG + Exonic
1173979711 20:47214333-47214355 AAGCTGCAGGGAGGCCGCAGAGG - Intronic
1174022923 20:47546000-47546022 AATATACAGGCCTGGCACAGTGG - Intronic
1174185255 20:48701927-48701949 AAGAGGCTGGCCGGGCGCAGTGG + Intronic
1174288235 20:49487263-49487285 AATATACAGGCCGGGCGCAGTGG - Intergenic
1174335828 20:49859951-49859973 CAGATCCAGGGCTGGGGCAATGG - Intronic
1174343391 20:49912164-49912186 AAAATGCAGGCCAGGCGCGGTGG + Intronic
1174510129 20:51045028-51045050 AAGAAGGAGGCCAGGCGCAGTGG - Intergenic
1174620871 20:51873633-51873655 AAGATGAAGGCCAGGTGCAGTGG - Intergenic
1174807977 20:53621074-53621096 AAAATTCAGGCCAGGCGCAGTGG - Intergenic
1174980503 20:55389021-55389043 AAGATACAGGCTGGGCGCAGTGG + Intergenic
1175274638 20:57759808-57759830 CAGATGAGGGGCTGGTGCAGTGG - Intergenic
1176005839 20:62861869-62861891 AGGGGGCGGGGCTGGCGCAGGGG - Intergenic
1176031721 20:63016079-63016101 CAGATGCAGGGGTGGAGCACCGG - Intergenic
1176207911 20:63900288-63900310 AAAATTCTGGGCTGGTGCAGTGG + Intronic
1176379253 21:6103560-6103582 GAAATGGAGGGCAGGCGCAGTGG + Intergenic
1177435175 21:21042469-21042491 AATATGAAGGTCAGGCGCAGTGG - Intronic
1177801869 21:25835848-25835870 AATTTGCAGGCCAGGCGCAGTGG + Intergenic
1178089884 21:29151055-29151077 AAAATGCAGGCCAGGCGCCGTGG - Intronic
1178434582 21:32547008-32547030 GAGAGACAGGGCTGGCGCAGGGG + Intergenic
1178594397 21:33939952-33939974 ATGATGCTGGCCGGGCGCAGTGG + Intergenic
1178783075 21:35624400-35624422 GAGATGCAGGTCAGGTGCAGTGG - Intronic
1178847805 21:36187886-36187908 AAGAAGCAGGCCAGGCGCAGTGG - Intronic
1178919549 21:36729612-36729634 AAGAGGGAGGGCTGGGGCTGGGG - Intronic
1178930316 21:36812769-36812791 AAAAATCAGGGCTGGCGCGGTGG + Intronic
1178935475 21:36858073-36858095 AAGATCCTGGCCAGGCGCAGTGG - Intronic
1179509657 21:41864127-41864149 AAAATGCAGGCCAGGCGCGGTGG - Intronic
1179584680 21:42367026-42367048 AAATTGTAGGCCTGGCGCAGTGG + Intergenic
1179664047 21:42897658-42897680 AAGATTTAGGCCGGGCGCAGTGG - Intronic
1179744220 21:43434677-43434699 GAAATGGAGGGCAGGCGCAGTGG - Intergenic
1179909783 21:44441644-44441666 CAGAGGCAGGGCTGGCGGGGAGG + Intronic
1180018756 21:45105387-45105409 AAGAAGCAGGCCGGGTGCAGTGG - Intronic
1180030916 21:45207001-45207023 AGGAGGCAGAGCTGACGCAGGGG - Intronic
1180051286 21:45332066-45332088 CAGAGGCAGGGCTGGAGCAGGGG + Intergenic
1180514535 22:16129358-16129380 AAGATGCAGGCCGGGTGCAGTGG - Intergenic
1180630595 22:17226913-17226935 ATGATTCAGGCCGGGCGCAGTGG + Intergenic
1180637471 22:17272527-17272549 GGGAAGCAGGGCTGGCCCAGGGG - Intergenic
1180715523 22:17869350-17869372 AAGATGCATGGCTGGCTTGGAGG + Intronic
1180872134 22:19152195-19152217 AAGAGGCAGGGCACACGCAGAGG - Intergenic
1180972893 22:19824820-19824842 ATGAAGCAGGGCTGCGGCAGTGG + Intronic
1181615544 22:24051812-24051834 AACATGTAGGGCTAGCACAGAGG + Intronic
1181620196 22:24085844-24085866 TAGATGCAGGTCTGCCACAGAGG - Intronic
1181661675 22:24354991-24355013 AAGATCCAGGCCAGGCGCAGTGG + Intronic
1181954107 22:26575706-26575728 AAGATGCAGGCCGGGCGCAGTGG + Intronic
1182002490 22:26931410-26931432 AAGATGAAGGCCAGGTGCAGTGG - Intergenic
1182254800 22:29030727-29030749 GAGAAGCAGGGCTGGTGGAGGGG + Intronic
1182535766 22:31001750-31001772 CAGATTCAGGCCGGGCGCAGTGG + Intergenic
1182600598 22:31460657-31460679 AAAATAGAGGACTGGCGCAGTGG + Intronic
1182612793 22:31563278-31563300 ATGATGCAGGCCAGGCGCGGTGG - Intronic
1182669735 22:31985625-31985647 AAAACGCAGGCCGGGCGCAGTGG - Intergenic
1182984272 22:34701718-34701740 AAGATGCAGGCCGGGCACGGTGG + Intergenic
1183126896 22:35791095-35791117 AAAAAGTAGGCCTGGCGCAGTGG + Intronic
1183163260 22:36128824-36128846 AAGAGGCCAGGCAGGCGCAGTGG + Intergenic
1183384681 22:37508215-37508237 GAGATGCAGAGCTGGGGAAGGGG - Intronic
1183443529 22:37837699-37837721 AGTATGCAAGGCTGGTGCAGTGG + Intronic
1183476718 22:38039640-38039662 TGGAGGCAGGGCTGGTGCAGGGG - Intronic
1183556087 22:38528349-38528371 AAGATTCAGGCCAGGCGCAGTGG - Intronic
1183773365 22:39946146-39946168 TAGATGCAGGCCGGGCGCTGTGG - Intronic
1183798337 22:40139617-40139639 AAAATGCAGGCCAGGCACAGTGG - Intronic
1183805788 22:40209731-40209753 AGAATGCAGGCCAGGCGCAGTGG + Intronic
1183827714 22:40401531-40401553 CAGAGGCAGGCCAGGCGCAGTGG - Intronic
1183883018 22:40852028-40852050 AAGAATCAGGCCGGGCGCAGTGG - Intronic
1183905415 22:41036609-41036631 AAGTTGTAGGTCGGGCGCAGCGG - Intergenic
1183906327 22:41043395-41043417 AAGATGCAGGCCGGGCACAGTGG + Intergenic
1184114662 22:42415584-42415606 AAGGTGCAGGCCGGGCGCGGTGG - Intronic
1184120596 22:42447300-42447322 AATATTGAGGCCTGGCGCAGTGG + Intergenic
1184128847 22:42505310-42505332 AAGGGGCATGGCTGGAGCAGGGG - Intergenic
1184132350 22:42524465-42524487 AATATTGAGGCCTGGCGCAGTGG + Intergenic
1184137642 22:42558625-42558647 AAGGGGCATGGCTGGAGCAGGGG - Intronic
1184353367 22:43960439-43960461 AAGAAACAGGTCAGGCGCAGTGG + Intronic
1184496666 22:44846252-44846274 AAGGTGCAGGGCTGAGGCGGTGG - Intronic
1184518444 22:44977871-44977893 AACATGCAGGCCAGGTGCAGTGG - Intronic
1184621916 22:45686530-45686552 GAGATGCAGGCCAGGCGCAGTGG + Intronic
1184689581 22:46111350-46111372 AGGAAGCAGGCCGGGCGCAGTGG + Intronic
1184782770 22:46657387-46657409 AAGAGGCAGGGATGGGGCAGAGG + Intronic
1184910952 22:47533779-47533801 AAAATCCAGGCCGGGCGCAGTGG - Intergenic
1184925114 22:47631194-47631216 AAGAAGGAAGGCTGGTGCAGAGG + Intergenic
1185265303 22:49899183-49899205 ATGATGCAGGCCGGGCACAGTGG + Intergenic
1185363539 22:50423624-50423646 GACATGCAGGGCTGGCTGAGGGG - Intronic
949152611 3:788842-788864 ACGATACAGGCCAGGCGCAGTGG + Intergenic
949665798 3:6337984-6338006 AAGATCCAGGTCGGGCGCAGTGG - Intergenic
950087608 3:10271589-10271611 ACAATGCAGGCCAGGCGCAGTGG - Intronic
950244052 3:11399058-11399080 CAGATGCAGGCTGGGCGCAGTGG + Intronic
950519784 3:13491034-13491056 AAGAAACAGGCCAGGCGCAGTGG - Intronic
950976857 3:17255749-17255771 AAGATTTAGGCCGGGCGCAGTGG + Intronic
952394587 3:32909912-32909934 AAGAAATAGGGCCGGCGCAGTGG - Intergenic
953139415 3:40213688-40213710 AAGAAACAAGGGTGGCGCAGTGG - Intronic
953613961 3:44473168-44473190 AAAATGCAGGCCGGGCGCAGTGG + Intronic
953630035 3:44606251-44606273 AATATGCAGGCTGGGCGCAGTGG - Intronic
953655602 3:44850972-44850994 AAAAAGCAGGCCTGGCACAGTGG + Intronic
954090821 3:48282679-48282701 TACATGCAGAGCTGGCGCATGGG + Intronic
954241318 3:49296042-49296064 CAGATGCAGGCCGGGCACAGTGG + Intronic
954258689 3:49423467-49423489 AAGGGGCAGGGCGGGCGCGGTGG + Exonic
954314408 3:49793359-49793381 AAGTTGAGGGGCTGGCTCAGAGG - Intronic
954671330 3:52292791-52292813 CAGCTGCAGGGCTCGGGCAGGGG + Exonic
954738472 3:52727259-52727281 TAGATGTAGGTCAGGCGCAGTGG - Intronic
954870981 3:53767275-53767297 AACATGGAGGTCTGGCGCAGTGG + Intronic
955137961 3:56238563-56238585 AGTCTGCAGGGCTGGCCCAGGGG + Intronic
955359120 3:58257648-58257670 ATGATGAAGGCCAGGCGCAGTGG - Intronic
955512817 3:59698442-59698464 AACCTGCAGGGCTGGCCAAGCGG + Intergenic
957241776 3:77669645-77669667 AAAATGGAGGCCTGGCGCAGTGG + Intergenic
957282495 3:78171745-78171767 AAAGTGCAGGCCGGGCGCAGTGG + Intergenic
957431403 3:80112895-80112917 AAGATACAGGCCGGGCGCGGTGG - Intergenic
957631943 3:82727367-82727389 AAGATCAAGGCCAGGCGCAGTGG + Intergenic
958028253 3:88074626-88074648 AAGACACAGGCCGGGCGCAGTGG - Intronic
959060283 3:101610271-101610293 AAGACACAGGCCAGGCGCAGTGG - Intergenic
959590581 3:108075616-108075638 AAGATGCATGGCTAGGGCAGGGG - Intronic
960372640 3:116859960-116859982 AAGATACAGGTCAGGCGCGGCGG - Intronic
960656816 3:120013880-120013902 AAGATGTTGGCCGGGCGCAGTGG + Intronic
960848511 3:122027475-122027497 AAGTTTCAGGCCAGGCGCAGTGG - Intergenic
960858561 3:122128141-122128163 AAGATGGCGGCCGGGCGCAGTGG + Intergenic
961773183 3:129265106-129265128 CAGATGGAGGCCGGGCGCAGTGG - Intronic
961856260 3:129874567-129874589 AACATACAGGGCAGGTGCAGTGG + Intronic
962762980 3:138534069-138534091 AAAATTCAGGCCGGGCGCAGTGG - Intronic
963136743 3:141912546-141912568 AAGAACCAGGCCAGGCGCAGTGG - Intronic
963774442 3:149423660-149423682 AAGGGGCAGGGCTGGAGAAGGGG + Intergenic
964798183 3:160522743-160522765 AAGTTGCTGGCCGGGCGCAGTGG - Intronic
965388055 3:168070104-168070126 AAAATCCAGGCCTGGTGCAGTGG + Intronic
965942237 3:174199132-174199154 AATATGCAGGACGGGCGCGGTGG - Intronic
966503972 3:180678639-180678661 AAATTGCAGGCCGGGCGCAGTGG - Intronic
966779122 3:183568371-183568393 AAAATACAGGCCGGGCGCAGTGG - Intergenic
966857846 3:184207801-184207823 AGGATACAGGGCTGGCACAGTGG + Intronic
966880947 3:184350722-184350744 AAGTAGCAGAACTGGCGCAGTGG - Intronic
966980997 3:185135331-185135353 AAGAACCAGGCCAGGCGCAGTGG + Intronic
967052651 3:185799110-185799132 AAGCTGCAGGCCGGGCACAGTGG + Intronic
967057541 3:185842851-185842873 AATATGCAGGCCGGGCGCGGTGG + Intergenic
967743371 3:193027694-193027716 AAGATGCAGTGGGAGCGCAGAGG - Intergenic
968023803 3:195420628-195420650 AAATTGCAGGCCGGGCGCAGTGG - Intronic
968068174 3:195770486-195770508 AAAATGCAGGCCTGGGACAGGGG - Intronic
968078844 3:195833026-195833048 AAGATTCAGGCCAGGCACAGTGG - Intergenic
968210651 3:196845892-196845914 AAAATTCAGGCCGGGCGCAGTGG - Intergenic
968316331 3:197728974-197728996 AAGATTCAGGCCGGGCGCGGTGG + Intronic
968477152 4:817264-817286 AAAATTCAGGCCGGGCGCAGTGG + Intronic
968480375 4:830508-830530 GAGAGGCAGGGCTGGCCCAGGGG + Intergenic
968569585 4:1332425-1332447 AAAATGCAGGCCGGGTGCAGCGG + Intronic
968613214 4:1566403-1566425 AAGCTGCAGGGCAGGCAGAGGGG + Intergenic
968758475 4:2428666-2428688 GAGATGCAGGCCTGGCGCAGGGG - Intronic
969090864 4:4693080-4693102 GAGGTGCAGGCCAGGCGCAGTGG + Intergenic
969140707 4:5069103-5069125 CAGATGCAGGGTTGGAGCTGTGG + Intronic
969462494 4:7336169-7336191 AGGACGCAGGGCAGGGGCAGCGG - Intronic
970171560 4:13295733-13295755 CAGATGGGGGGCTGGAGCAGAGG - Intergenic
970758258 4:19451861-19451883 AAGATGTTGGCCTGGCACAGTGG + Intergenic
971221466 4:24711359-24711381 AAGATGTGGGGCAGGTGCAGTGG + Intergenic
971302190 4:25450937-25450959 GAGCCGAAGGGCTGGCGCAGTGG - Intergenic
971347848 4:25827664-25827686 ATGATCCAGGGCTGGGGCCGGGG - Intronic
971362765 4:25952392-25952414 ATGATGCAGGGCGTGCGCGGTGG + Intergenic
971392363 4:26197963-26197985 ATGAGGCAGGCCGGGCGCAGTGG + Intronic
971488521 4:27187142-27187164 AAGAGGTTGGGCTGGCACAGTGG + Intergenic
972331271 4:38066617-38066639 TACATGGAGGCCTGGCGCAGTGG - Intronic
972529112 4:39945912-39945934 AAAAAGCAGGACAGGCGCAGTGG + Intronic
972738431 4:41867099-41867121 AAGATGCAGAGCTGCCTCGGTGG + Intergenic
972910467 4:43810290-43810312 CAGATGCAGGTCGGGTGCAGTGG + Intergenic
974420640 4:61668729-61668751 AAAATGGAGGCCTGGCACAGTGG + Intronic
974790603 4:66683262-66683284 AAAATTTAGGCCTGGCGCAGGGG - Intergenic
974928133 4:68326944-68326966 AAAATGGAGGCCGGGCGCAGTGG + Intronic
975380362 4:73693282-73693304 CAGAGGCAGGGCTGGTACAGGGG - Intergenic
975830871 4:78367115-78367137 AAGATTCAGGCCTGGCACAGTGG + Intronic
975893847 4:79062318-79062340 AAGATGAGGGCCCGGCGCAGTGG - Intergenic
976187207 4:82453916-82453938 AAAATGCAGGCCGGGTGCAGTGG + Intronic
976207240 4:82634834-82634856 AAGATGCAGGGCAAGAGGAGGGG + Intronic
976257829 4:83117438-83117460 AACATCCAGGCCGGGCGCAGTGG + Intronic
976410797 4:84711563-84711585 AATATACAGGCCAGGCGCAGGGG + Intronic
976733712 4:88289111-88289133 AAGCTTCAGGCCAGGCGCAGTGG + Intergenic
977055057 4:92181872-92181894 TAGTTGCAGGGCTGGGGCAAAGG + Intergenic
977566688 4:98587600-98587622 AAGGTGCTGGCCGGGCGCAGTGG + Intronic
977599499 4:98920580-98920602 AAAATGCAGGCCAGGCACAGTGG - Intronic
977705109 4:100061883-100061905 AAGGTCCTGGGCTGGAGCAGGGG - Intergenic
978457280 4:108908132-108908154 TAGATGCAAGGCTTGAGCAGGGG - Intronic
980543563 4:134227963-134227985 AAAATGCAGGCCCGGCGCGGTGG + Intergenic
980936596 4:139231840-139231862 ATGATGCAGGCCAGGCGCGGTGG - Intergenic
981097016 4:140792466-140792488 AGTATGCAGGCCGGGCGCAGTGG + Intergenic
981990430 4:150913178-150913200 AAAATGCAGGTCAGGTGCAGTGG + Intronic
982112790 4:152071928-152071950 GAGAGGCAGGGGTGGCTCAGTGG - Intergenic
982176968 4:152715067-152715089 AAGATGCAGGCCTGCCAAAGCGG + Intronic
982236010 4:153251689-153251711 AATATGCAGGCCAGGTGCAGTGG + Intronic
982274468 4:153625122-153625144 AAAATGGAGGCCGGGCGCAGTGG + Intronic
982686375 4:158494755-158494777 AAGATGCAGGCTGGGCACAGTGG + Intronic
982744724 4:159094754-159094776 AAAATGCAGGCCGGGCGCGGTGG - Intergenic
982744747 4:159094886-159094908 AAAATGCAGGCCGGGCGCGGTGG - Intergenic
982755896 4:159218466-159218488 AAGTTGTTGGCCTGGCGCAGTGG + Intronic
983094872 4:163549993-163550015 AAAATGCAGGCCGGGCGCAGTGG + Intronic
983190049 4:164745580-164745602 AAAAGGCAGGCCAGGCGCAGTGG - Intergenic
983249827 4:165331014-165331036 AAGATGTAGGCTGGGCGCAGTGG + Intronic
983723484 4:170888850-170888872 AAGATGCAGTGCCTGAGCAGTGG - Intergenic
984139901 4:175991360-175991382 AAGATTTAGGCCAGGCGCAGTGG - Intronic
984302473 4:177939845-177939867 AAGTTGCAGGCCAGGCACAGTGG - Intronic
984798535 4:183689913-183689935 AAGATACAGGCGGGGCGCAGTGG + Intronic
984807355 4:183763881-183763903 AGGCTTCAGGCCTGGCGCAGCGG - Intergenic
984890322 4:184486360-184486382 AAAATGCTGGCCGGGCGCAGTGG + Intergenic
984997053 4:185444238-185444260 AAGATACAGGCCGGGCGCGGTGG - Intronic
985066875 4:186131058-186131080 AAGAGGAAGGGCAGGCGCAGTGG + Intronic
985248591 4:188000692-188000714 AGGACACAGGCCTGGCGCAGTGG + Intronic
985260699 4:188112301-188112323 AAGAATCAGGCCAGGCGCAGTGG + Intergenic
985658398 5:1143742-1143764 AAGGTGCAGGGCTTGCAGAGGGG - Intergenic
985666138 5:1182435-1182457 AACATTCAGGCCAGGCGCAGTGG - Intergenic
985988770 5:3538469-3538491 AGGATGCAGGGGTGGGGCTGTGG - Intergenic
986103940 5:4641981-4642003 AACATGCCGGCCTGGCGCAGTGG + Intergenic
986320869 5:6632250-6632272 AAGATGGAGGGGGGGCGCGGAGG + Intronic
987081674 5:14430997-14431019 AAAATTCAGGCCAGGCGCAGTGG - Intronic
987360020 5:17098294-17098316 AAGGTGAAGGTCGGGCGCAGTGG - Intronic
987375853 5:17233839-17233861 AAAATACAGGCCGGGCGCAGTGG + Intronic
987912780 5:24170214-24170236 CAGGGGCAGGGCTGGCGCTGCGG + Intronic
988096548 5:26619315-26619337 AAAGTTCTGGGCTGGCGCAGTGG - Intergenic
989140721 5:38198801-38198823 AAGGTGCAGGCCAGGCGCGGTGG + Intergenic
989640007 5:43575023-43575045 AAGATGTAGGCCAGGTGCAGTGG - Intergenic
991252852 5:64583098-64583120 AAGAGGTAGGCCAGGCGCAGTGG + Intronic
991324152 5:65411123-65411145 AAGAAGCAGGCCAGGCTCAGTGG - Intronic
991345262 5:65659005-65659027 AAGATGTAGGCCAGGCACAGTGG - Intronic
991574934 5:68092889-68092911 AAGAAGCAGGCCGGGCTCAGTGG - Intergenic
991582284 5:68168654-68168676 CAGATATAGGGCAGGCGCAGTGG - Intergenic
992003666 5:72458301-72458323 AAGATGCTGGCCGGGCGCGGTGG - Intronic
992087109 5:73287798-73287820 AAGATGGAGGCCAGGCACAGTGG + Intergenic
992250201 5:74868293-74868315 GAGAATCAGGCCTGGCGCAGTGG - Intergenic
992430358 5:76704725-76704747 CAAATGCAGGGCTGGCTCCGTGG - Intronic
992709096 5:79431041-79431063 CACATGCTGGCCTGGCGCAGTGG + Intronic
992739158 5:79755572-79755594 ATGATGCTGGCCGGGCGCAGTGG - Intronic
993070995 5:83163232-83163254 CTGATGCAGGCCAGGCGCAGTGG - Intronic
993127354 5:83851574-83851596 CAGATGCAGGCCGGGTGCAGTGG - Intergenic
993515971 5:88835522-88835544 AAAATACAGGCCTGGCGCAGTGG + Intronic
993839642 5:92862031-92862053 AAGATGCAGGCCAGGAGCAAGGG + Intergenic
993889043 5:93450773-93450795 AAGATACAGGCCAGGTGCAGTGG + Intergenic
994088239 5:95783407-95783429 AAAAAGAAGGGCCGGCGCAGTGG - Intronic
994340762 5:98625111-98625133 AAAATACAGGCCAGGCGCAGTGG + Intergenic
995233581 5:109799465-109799487 AAAAAGCAGGCCAGGCGCAGTGG + Intronic
995286533 5:110395264-110395286 CTGATGCAGGCCTGGGGCAGTGG - Intronic
995789398 5:115868592-115868614 TAGATGCTGGCCAGGCGCAGTGG + Intronic
997133494 5:131300495-131300517 ATGTTGTAGGCCTGGCGCAGTGG + Intronic
997753452 5:136372307-136372329 TAGATACAGGTCAGGCGCAGTGG + Intronic
997806952 5:136927564-136927586 AAGATGTATGGCAGGGGCAGTGG + Intergenic
997956388 5:138281730-138281752 AAAATGCAGGCCAGGCGCGGTGG + Intergenic
998460951 5:142309611-142309633 AAGATGCTGGCCAGGCGCGGTGG + Intergenic
998807779 5:145935632-145935654 AAGAGGCTGGCCAGGCGCAGTGG - Intergenic
999084694 5:148877124-148877146 AATAAGTAGGCCTGGCGCAGTGG + Intergenic
999459193 5:151743041-151743063 AAGAGACAGGGGTGACGCAGGGG + Intronic
999599897 5:153251022-153251044 AAGATCCAGGCCGGGCGCGGTGG - Intergenic
999698997 5:154211036-154211058 AAGATGCAAGGCTGGTACAGAGG - Intronic
999994532 5:157079576-157079598 AAAATTCAGGCCAGGCGCAGTGG + Intergenic
1000717220 5:164660357-164660379 AAAATGTAGGCCAGGCGCAGTGG + Intergenic
1000960573 5:167596504-167596526 AAAATGCAGGCCGGGCGCGGTGG + Intronic
1000990496 5:167906943-167906965 AGGACGCAGGCCGGGCGCAGTGG + Intronic
1001066356 5:168537884-168537906 AAGATGCAGAGCATGAGCAGGGG + Intergenic
1001519926 5:172384129-172384151 AAGACACAGGCCGGGCGCAGTGG - Intronic
1001585832 5:172833563-172833585 AACATGCAGGGTTGTGGCAGAGG - Intergenic
1001761504 5:174211732-174211754 CACCTGCAGGGCTGGCCCAGAGG - Intronic
1002164547 5:177336324-177336346 AGGTGGCAGGGCTGGCACAGAGG + Intronic
1002260549 5:177991081-177991103 AAAAATCAGGCCTGGCGCAGTGG + Intergenic
1002487024 5:179545933-179545955 AAAATGCTGGCCGGGCGCAGTGG + Intergenic
1002490157 5:179570029-179570051 AAAATACAGGCCGGGCGCAGTGG - Intronic
1002611580 5:180422368-180422390 AAAATGGAGGCCAGGCGCAGTGG + Intergenic
1002684624 5:180999510-180999532 AAAATACAGGACAGGCGCAGTGG + Intronic
1002967794 6:1984459-1984481 AAGAAACAGGGCTGGCCCTGAGG + Intronic
1003112558 6:3261779-3261801 TAGATGGAGGGCTGGCCCACGGG - Intronic
1003550171 6:7096125-7096147 AATATGAAGGGCTGGTGCAGTGG + Intergenic
1003773860 6:9337947-9337969 TAGATCCAGGCCGGGCGCAGTGG + Intergenic
1004500737 6:16207791-16207813 AAGATTCAGGACGGGCGCAGTGG + Intergenic
1005291490 6:24383976-24383998 AAGAAACAGGCCGGGCGCAGTGG + Intergenic
1005629388 6:27693464-27693486 AAGAAGAAGGCCTGGCGCGGTGG - Intergenic
1005713360 6:28523610-28523632 AAGAGGCAGGGCTGGTGGAGGGG + Intronic
1005727789 6:28666439-28666461 ATGATGCAGGCCTGGAGCGGTGG - Intergenic
1005751522 6:28887124-28887146 AAGAAGCAGGCCAGGCGCGGTGG + Intergenic
1006097929 6:31667417-31667439 AAGATACAGGCCGGGCGCAATGG - Intronic
1006263048 6:32893422-32893444 AACGTGTAGGACTGGCGCAGAGG + Intergenic
1006871034 6:37252178-37252200 AAAATCCAGGCCAGGCGCAGTGG - Intronic
1006890420 6:37422523-37422545 ACGATGCAGGCCAGGCGCGGTGG - Intergenic
1006899302 6:37489811-37489833 AAGAGGCATGCCTGGCTCAGGGG + Intronic
1006991953 6:38222544-38222566 AAAATCAAGGTCTGGCGCAGTGG - Intronic
1007391372 6:41551391-41551413 AAGGTGCAGGGCTGTGCCAGAGG - Intronic
1007470963 6:42090078-42090100 AAAAAGCAGGCCGGGCGCAGTGG + Intergenic
1007911859 6:45523556-45523578 ATCATGCAGGCCGGGCGCAGTGG - Intronic
1008711076 6:54227894-54227916 GAGATCCAGGCCGGGCGCAGTGG + Intronic
1008759335 6:54834910-54834932 AAAAAGCAGGCCGGGCGCAGTGG - Intergenic
1010065628 6:71679620-71679642 AAGAAGCAGGCCGGGTGCAGTGG - Intergenic
1010256932 6:73769175-73769197 AAAGTACAGGCCTGGCGCAGTGG - Intronic
1010495177 6:76526017-76526039 AAGATCTAGGCCGGGCGCAGTGG + Intergenic
1011605774 6:89103616-89103638 AAAATTCAGGCCAGGCGCAGTGG - Intronic
1011633391 6:89348946-89348968 AAAACGCAGGCCTGGTGCAGTGG + Intronic
1012286522 6:97396178-97396200 AAGGTGCAGGCCGGGCGCGGCGG - Intergenic
1012463771 6:99493784-99493806 AACATACAGGCCAGGCGCAGTGG - Intronic
1012867386 6:104634378-104634400 GAGAGGCAGGGCTGGCACAGTGG - Intergenic
1012886874 6:104856720-104856742 AAGTTGGAGGCCGGGCGCAGTGG - Intronic
1014022546 6:116607949-116607971 AATATCCAGGTCAGGCGCAGTGG + Intergenic
1014026280 6:116650133-116650155 AAGAAGCAGGCCGGGCGCCGTGG + Intronic
1014031192 6:116706874-116706896 ATTATGCAGGCCGGGCGCAGTGG + Intronic
1014436875 6:121430274-121430296 AACATGCAGGTCGGGCGCGGTGG - Intergenic
1014799901 6:125767155-125767177 AAAATTCCGGCCTGGCGCAGTGG + Intergenic
1014981139 6:127947875-127947897 AAGAGGCAGGCCGGGTGCAGTGG + Intergenic
1015212607 6:130715209-130715231 AAGAAGGTGGGCTGGCTCAGCGG + Intergenic
1016915941 6:149244559-149244581 AAGATACAGGCTGGGCGCAGTGG + Intronic
1017248262 6:152251469-152251491 AAAATGCAGGCCGGGCGCGGTGG + Intronic
1017304986 6:152906875-152906897 AAGAGGCCGGGCGGGCGCAGTGG - Intergenic
1017616428 6:156251508-156251530 GAGAGACAGGGCTGGCGCGGGGG + Intergenic
1018026661 6:159812185-159812207 AAGTGGCAGGCCGGGCGCAGTGG - Intronic
1018382690 6:163273178-163273200 ATGATGCAGGCCGGGCGCGGTGG - Intronic
1018523964 6:164686436-164686458 AAAATGTAGGCCGGGCGCAGTGG - Intergenic
1019188173 6:170233311-170233333 AAAATGCAGGCCTGGTGCAGTGG - Intergenic
1019262068 7:87345-87367 CAGATGCAGGGCCTGGGCAGTGG - Intergenic
1019286847 7:227972-227994 ACGTTGAAGAGCTGGCGCAGAGG + Exonic
1019373387 7:675658-675680 AAAATGCAGGCCGGGCGCAGTGG + Intronic
1019436262 7:1023780-1023802 AGAAGGCAGGGCTGGAGCAGCGG + Intronic
1019582427 7:1772057-1772079 AACATGCAGGGCGGGCGCGGTGG + Intergenic
1019585751 7:1802336-1802358 CAGTTGCAGGCCAGGCGCAGTGG + Intergenic
1019622539 7:1999649-1999671 ATGATGTAGGGCTGGGGCAGTGG - Intronic
1020146964 7:5651932-5651954 AAAATGCAGGCCAGGCGCAGTGG - Intronic
1020233418 7:6337407-6337429 AAAATACTGGGCGGGCGCAGTGG - Intronic
1020254325 7:6494028-6494050 AAAAAGCAGGCCAGGCGCAGTGG + Intergenic
1021366442 7:19785346-19785368 AAAATTCAGGCCAGGCGCAGTGG + Intergenic
1022001627 7:26231669-26231691 AAGATGCAGGCCAGACACAGTGG + Intergenic
1022684654 7:32585055-32585077 AAGAAACAGGCCAGGCGCAGTGG - Exonic
1023363925 7:39444294-39444316 CAGATGAAGGCCGGGCGCAGTGG + Intronic
1023540659 7:41261809-41261831 AACATTCAGGCCGGGCGCAGCGG - Intergenic
1024710616 7:52011024-52011046 AAGATACAGGGCAAGAGCAGAGG - Intergenic
1025114703 7:56247755-56247777 AACATGGAGGGCAGGCGCAGTGG - Intergenic
1026054422 7:66972082-66972104 AATCTGCAGGCCGGGCGCAGTGG - Intergenic
1026062051 7:67035401-67035423 ATGATTCAGGCCAGGCGCAGTGG - Intronic
1026332430 7:69364297-69364319 AAAAAGGAGGCCTGGCGCAGTGG + Intergenic
1026716297 7:72792040-72792062 ATGATTCAGGCCAGGCGCAGTGG + Intronic
1026821471 7:73552489-73552511 AAAATACAGGCCAGGCGCAGCGG + Intronic
1026832042 7:73616207-73616229 GAGATGCAGTGCTGCCACAGAGG + Intronic
1026850431 7:73719904-73719926 ACGAGACAGGGCTGGGGCAGAGG - Intergenic
1027235520 7:76295458-76295480 AAAATGCAGGCTGGGCGCAGTGG - Intergenic
1027520310 7:79198600-79198622 AAGAGGTAGGCCGGGCGCAGTGG + Intronic
1029051405 7:97692688-97692710 AAGCTGGAGGCCAGGCGCAGTGG + Intergenic
1029131182 7:98332520-98332542 AGTATACAGGCCTGGCGCAGTGG + Intronic
1029428243 7:100511170-100511192 GACATGCAGGCCAGGCGCAGTGG + Intergenic
1029467904 7:100737417-100737439 AGGATCCAGGGCGGGCGCGGTGG + Intronic
1029568463 7:101355371-101355393 TAGCTGCAGGCCAGGCGCAGTGG - Intergenic
1029926314 7:104322645-104322667 AAGATTCAGGGTGGGCGCAGTGG + Intergenic
1030022211 7:105286972-105286994 AGGATGCAGGCCGGGCGCGGTGG + Intronic
1030287810 7:107844617-107844639 AAGTTGCAGGCCAGGCACAGTGG - Intergenic
1030330407 7:108264261-108264283 AAGATGCAGACCAGGCGCAGAGG - Intronic
1030610573 7:111684547-111684569 AATATGTAGGCCGGGCGCAGTGG - Intergenic
1030938077 7:115611503-115611525 AAAATGGAGGCCAGGCGCAGTGG + Intergenic
1031442055 7:121806715-121806737 AACATGCAGGCCTGGCGTGGTGG - Intergenic
1032000882 7:128264752-128264774 GAGATGCAGGCCTGGCTCATGGG + Intergenic
1032022064 7:128412811-128412833 AAAATACAGGCCAGGCGCAGTGG - Intergenic
1032195941 7:129788574-129788596 AAGATCCAGACCAGGCGCAGTGG - Intergenic
1032201712 7:129826662-129826684 GAGAAGCAGGCCTGGCGCGGTGG - Intergenic
1032401431 7:131626994-131627016 AATGTGCAGGGCTAGCACAGGGG + Intergenic
1032616207 7:133473993-133474015 AAGACCCAGGCCAGGCGCAGTGG - Intronic
1032795919 7:135276134-135276156 CAGATGCAGGGCTGGGTCGGAGG + Intergenic
1032937752 7:136753278-136753300 AAACTGCCGGCCTGGCGCAGTGG + Intergenic
1033099420 7:138457785-138457807 CAGATGCTGGCCGGGCGCAGTGG - Intergenic
1033315794 7:140296463-140296485 AAAATGGAGGCCAGGCGCAGTGG + Intronic
1033454306 7:141488723-141488745 AAAATGCAGGCCGGGCGCGGTGG - Intergenic
1034405362 7:150899254-150899276 AATATGCTGGGTTGGCGCAGGGG - Intergenic
1034525487 7:151657868-151657890 ATGATGGAGGGCAGGTGCAGTGG + Intronic
1034553812 7:151837400-151837422 AAGAGGCAGTGCTGGCCCACGGG + Intronic
1035100800 7:156394755-156394777 CAGAGGCAGGGCTGGTCCAGGGG + Intergenic
1035687526 8:1536592-1536614 AGGATGCAGGGCTGGCCCCATGG - Intronic
1035949398 8:4003104-4003126 AAGATACAGGCTTGGCGCGGTGG + Intronic
1036098969 8:5756478-5756500 AAGATGTGGGCCGGGCGCAGTGG + Intergenic
1036218735 8:6902744-6902766 AACAGGGAGGGCGGGCGCAGGGG - Intergenic
1036646152 8:10612355-10612377 AAGACTCAGGGCTGGAGAAGCGG + Exonic
1036716009 8:11124795-11124817 TTGATGCTGGGCTGGCGCAGGGG + Intronic
1036730385 8:11257758-11257780 AAGAATCAGGTCTGGCGCAGTGG - Intergenic
1036786725 8:11692789-11692811 AGGAAGCGGGGCCGGCGCAGCGG + Intronic
1037325126 8:17681219-17681241 AAAATGCAGGCCGGGCGCTGTGG - Intronic
1037848723 8:22308363-22308385 ATGATGCAGGGCAGGCGTGGTGG + Intronic
1038215436 8:25557848-25557870 AAGGTGAAAGGCTGGTGCAGCGG + Intergenic
1038227280 8:25669146-25669168 AGGTTGCAGGCCAGGCGCAGTGG + Intergenic
1038468124 8:27785412-27785434 AAGAGACAGGCCAGGCGCAGTGG + Intronic
1038558659 8:28548451-28548473 AAAATTCAGGCCAGGCGCAGTGG - Intronic
1038578488 8:28726239-28726261 TAAATGCAGGCCGGGCGCAGTGG - Intronic
1039293994 8:36128934-36128956 AAAATGGAGGCCTGGCGCAGTGG + Intergenic
1040421982 8:47249341-47249363 AAACTGCAGGCCAGGCGCAGTGG - Intergenic
1040456089 8:47599206-47599228 AAGATGCTGGTGTGGGGCAGAGG + Intronic
1040489428 8:47906058-47906080 AAAATGCTGGCCAGGCGCAGTGG + Intronic
1041015677 8:53591096-53591118 AAGCTGCAGGCCGGGTGCAGTGG - Intergenic
1041283795 8:56239096-56239118 ATGATGGAGGCCTGGAGCAGAGG + Intergenic
1042079442 8:65034986-65035008 AAATTTTAGGGCTGGCGCAGTGG - Intergenic
1042221438 8:66478372-66478394 AAGCAGCAGGCCGGGCGCAGTGG - Intronic
1042491764 8:69407630-69407652 AAGATACAGGCCGGGCGCGGTGG + Intergenic
1042836046 8:73079858-73079880 CAGGTGCTGGGCTGGCGCTGGGG - Intronic
1043823372 8:84895797-84895819 AAAATACAGGCCTGGCACAGTGG - Intronic
1044682192 8:94792567-94792589 GAGATGGAGGCCAGGCGCAGTGG + Exonic
1044688524 8:94853021-94853043 AAGATGAAGGCCAGGTGCAGTGG + Intronic
1045118327 8:99008013-99008035 AACTTGCAGGCCAGGCGCAGTGG - Intergenic
1045178956 8:99759215-99759237 AAGATCCAGGGCTTGTGCATGGG - Intronic
1045187800 8:99856551-99856573 AAGAAACAGGCCGGGCGCAGTGG + Intronic
1045567418 8:103335205-103335227 GATATGCAGGCCGGGCGCAGTGG + Intergenic
1045781109 8:105864640-105864662 AAGATGCCGGCCTGGCGCAGTGG + Intergenic
1046497454 8:115033866-115033888 ATCATGCAGGCCGGGCGCAGTGG + Intergenic
1047098399 8:121648988-121649010 AAGCTGGAGGCCAGGCGCAGTGG - Intergenic
1047295987 8:123570903-123570925 AACTGGCATGGCTGGCGCAGTGG - Intergenic
1048336185 8:133504147-133504169 ATGATGCAGGACTGGAGGAGGGG - Intronic
1048737559 8:137518685-137518707 AAGTTTCAGGCCAGGCGCAGTGG - Intergenic
1049071302 8:140357903-140357925 GAGCTGCACGGCTGTCGCAGGGG + Intronic
1049168957 8:141146131-141146153 AATATCCAGGGCGGGCGCGGTGG - Intronic
1049194460 8:141307947-141307969 AAGGTGCGGGGCTGGGGCTGCGG + Intronic
1049303103 8:141882134-141882156 CAGATGCTGGGCTGGGGAAGAGG + Intergenic
1050459521 9:5865543-5865565 TATATGCAGGCCGGGCGCAGTGG + Intergenic
1050478262 9:6063360-6063382 AAGATGCAAGGCTGGGGGAGGGG - Intergenic
1050685350 9:8162416-8162438 AAGATCTAGGCCAGGCGCAGTGG - Intergenic
1050786794 9:9413399-9413421 AAGCTGCAGGCCGGGCGCGGTGG - Intronic
1050931570 9:11334916-11334938 AATATGCAGGACTTTCGCAGAGG + Intergenic
1051797430 9:20888422-20888444 AAAATGAAGGCCAGGCGCAGTGG - Intronic
1052647618 9:31255417-31255439 AGGATGCGGGGCTGGCGGGGGGG + Intergenic
1052709578 9:32037127-32037149 AAGAGACAGGCCGGGCGCAGTGG + Intergenic
1052987611 9:34499590-34499612 GAGAGGCAGGGCTGGAACAGAGG + Intronic
1053227565 9:36373976-36373998 AAAAGGCAGGCCGGGCGCAGTGG - Intronic
1053549453 9:39060590-39060612 AAGATGTTGGCCGGGCGCAGTGG + Intergenic
1053550060 9:39068110-39068132 AAATTTCAGGGCGGGCGCAGTGG + Intergenic
1053813568 9:41880664-41880686 AAGATGTTGGCCGGGCGCAGTGG + Intergenic
1054359436 9:64099534-64099556 TTGATGGAGGCCTGGCGCAGTGG + Intergenic
1054617028 9:67306775-67306797 AAGATGTTGGCCGGGCGCAGTGG - Intergenic
1054724364 9:68635384-68635406 AAGTTGCAGGCCAGGCGCAGTGG - Intergenic
1054890740 9:70248822-70248844 AAAACCCAGGCCTGGCGCAGTGG - Intergenic
1055472842 9:76630811-76630833 AAAATGCAGGCCGGGTGCAGAGG - Intronic
1056248914 9:84728239-84728261 TAGATTCAGGGCTGGTGCACTGG + Intronic
1056427326 9:86490276-86490298 AAGATTCTTGGCTGGAGCAGTGG - Intergenic
1056626502 9:88257811-88257833 AACATGTAGGCCAGGCGCAGTGG - Intergenic
1056649575 9:88446693-88446715 AGCAAGCCGGGCTGGCGCAGTGG - Intronic
1057159311 9:92875510-92875532 GTGATGCAGGCCTGGCTCAGGGG - Intronic
1057167083 9:92936988-92937010 AAAATACAGGCCAGGCGCAGTGG - Intergenic
1057460019 9:95252760-95252782 AAAATGCAGGCCTGGAACAGTGG + Intronic
1057521005 9:95760325-95760347 AAGATGCAGGTCGGGCGCGGTGG + Intergenic
1057586481 9:96333182-96333204 AAAATTCAGGCCAGGCGCAGTGG - Intronic
1057614744 9:96579298-96579320 GAGATACAGGCCAGGCGCAGTGG + Intronic
1057830562 9:98403006-98403028 AACATGTAGGCCAGGCGCAGTGG + Intronic
1058048050 9:100378434-100378456 AAGTTGTAGGCCAGGCGCAGTGG - Intergenic
1058059319 9:100477912-100477934 GAAATGCAGGCCGGGCGCAGTGG - Intronic
1058225647 9:102358886-102358908 AAAATGAAGGCCTGGTGCAGTGG - Intergenic
1058371149 9:104269161-104269183 AAGGTTCAGGCCAGGCGCAGTGG - Intergenic
1058525206 9:105850430-105850452 ATGATGCAGTGCTGGCACAAAGG + Intergenic
1058998724 9:110325804-110325826 AAGTTGCAGGCCGGGCGCGGTGG - Intronic
1059437076 9:114283503-114283525 GAGAAGGAGGGCTGGGGCAGGGG + Intronic
1060261073 9:122073983-122074005 ATGATGCTGGCCGGGCGCAGTGG + Intronic
1060521291 9:124295417-124295439 AAGAAGCGGGGCTGGGGCTGGGG + Intronic
1060533214 9:124361174-124361196 AAGAAGCAGGGGTGGCCCGGGGG - Intronic
1061177899 9:129008488-129008510 CAGAAGCAGGGCTGGGGGAGGGG + Exonic
1061258519 9:129466618-129466640 AAGATGTAGGCCAGACGCAGTGG + Intergenic
1061431014 9:130531093-130531115 ATGATGCAGGCCGGGCGCGGCGG - Intergenic
1061460518 9:130734500-130734522 AAGATTCAGGCCAGGCGCAGTGG - Intronic
1061499899 9:130995798-130995820 AAGCTGCAGGGTGGGGGCAGGGG + Intergenic
1061589372 9:131588769-131588791 AAGAGGCAGGGCTGGAGAGGTGG + Intronic
1061624059 9:131830619-131830641 AAGATGTAGGCCGGGCGCAGTGG + Intergenic
1061634533 9:131898870-131898892 AAAATCCAGGCCGGGCGCAGTGG - Intronic
1061812548 9:133170881-133170903 AAAATCCAGGCCAGGCGCAGTGG - Intergenic
1062363007 9:136196460-136196482 AGGAGGCAGGGCAGGCTCAGAGG + Exonic
1062491103 9:136805307-136805329 AGCATGCAGGGATGGCTCAGGGG - Intronic
1062605188 9:137344176-137344198 AGGATACAGGCCGGGCGCAGTGG - Intronic
1062669583 9:137699696-137699718 AAGATGTTGGCCTGGCACAGTGG + Intronic
1185598571 X:1323725-1323747 AAAATGCAGGCTGGGCGCAGTGG + Intergenic
1185651207 X:1649307-1649329 CAGAGGCTGGCCTGGCGCAGTGG + Intergenic
1185710667 X:2301124-2301146 AAAAAGCAGGCCGGGCGCAGTGG + Intronic
1186453102 X:9689601-9689623 AAGATGCAGGGTTTGAGAAGGGG - Intronic
1186765250 X:12763954-12763976 AAGATGTCGGCCAGGCGCAGTGG + Intergenic
1186894354 X:13991017-13991039 AAAGTGCAGGCCAGGCGCAGTGG - Intergenic
1187030638 X:15484600-15484622 AAGATTGAGGCCGGGCGCAGTGG - Intronic
1187567900 X:20470690-20470712 GTGATCCAGGGCTGGGGCAGAGG + Intergenic
1187861080 X:23683755-23683777 AAAATGCTGGCCGGGCGCAGTGG + Intronic
1187992118 X:24885809-24885831 AAGATACTGGCCGGGCGCAGTGG - Intronic
1188406231 X:29813735-29813757 CAGATGCAGGGCGGGGGAAGGGG - Intronic
1189118437 X:38368072-38368094 AAAATGAAGGCCAGGCGCAGTGG + Intronic
1189123050 X:38415563-38415585 AAGATTCAGGCCAGGCGCACTGG + Intronic
1189164810 X:38850272-38850294 AAGATGTAGGCCAGGCGCAGTGG + Intergenic
1189485831 X:41430991-41431013 AAGATGCAGGCCAGACGCAGTGG + Intergenic
1189805110 X:44727718-44727740 AAGAAGAAGGCCGGGCGCAGTGG + Intergenic
1190020324 X:46868495-46868517 ATGATGTAGGCCGGGCGCAGTGG + Intronic
1190073073 X:47294710-47294732 TAGCTGCAGGCCGGGCGCAGTGG + Intergenic
1190078169 X:47334110-47334132 AAAAAACAGGCCTGGCGCAGTGG - Intergenic
1190085225 X:47389611-47389633 AGGATGAAGGGCGGGCACAGTGG + Intronic
1190805953 X:53836872-53836894 AAGATACAGGCCGGGCGCAGTGG - Intergenic
1190951873 X:55153646-55153668 AAGATACAGGACGGGCGCGGTGG - Intronic
1191249720 X:58254578-58254600 ACCCTGCAGGCCTGGCGCAGGGG + Intergenic
1191250637 X:58258544-58258566 ATGCCGCAGGCCTGGCGCAGGGG - Intergenic
1192400035 X:70826014-70826036 GAGATGTTGGCCTGGCGCAGTGG + Intronic
1192573189 X:72222881-72222903 AGGATTCAGGCCGGGCGCAGTGG - Intronic
1193251508 X:79296550-79296572 AAGTTCCAGGCCGGGCGCAGTGG - Intergenic
1193326660 X:80185879-80185901 AAGAAGTAGGCCTGGCTCAGTGG - Intergenic
1193358598 X:80553228-80553250 AATATGCAGGTCTGGCACTGAGG + Intergenic
1193603750 X:83540872-83540894 AATATGCCGGCCAGGCGCAGGGG - Intergenic
1193730356 X:85095537-85095559 AAGATGGAGGCCGGGCGCGGTGG + Intronic
1194511314 X:94798981-94799003 AAGTTTCAGGCCAGGCGCAGTGG + Intergenic
1194715338 X:97281455-97281477 AAGAAGGAGGCCGGGCGCAGTGG + Intronic
1194852664 X:98888573-98888595 AAAATACAGGCCTGGCACAGTGG - Intergenic
1194959733 X:100221653-100221675 AATATGCTGGACGGGCGCAGTGG + Intergenic
1195471568 X:105236022-105236044 AAGATGCCATGCTGGTGCAGTGG + Intronic
1195642266 X:107189486-107189508 AACATGCAGGCCAGGCACAGTGG + Intronic
1196058434 X:111381949-111381971 AAGGTACAGGGATGGTGCAGTGG - Intronic
1196290874 X:113939458-113939480 AAGAAAGAGGGCTGGGGCAGTGG + Intergenic
1196983397 X:121240400-121240422 ATGAGGCAGGCCAGGCGCAGTGG - Intergenic
1197222436 X:123926751-123926773 ATGATACAGGCCGGGCGCAGTGG - Intergenic
1197343063 X:125297401-125297423 AAGATACAGGCCGGGTGCAGTGG - Intergenic
1197543617 X:127796332-127796354 AAGATCCTGGACAGGCGCAGTGG + Intergenic
1197789259 X:130235224-130235246 AAAATGCAGGCCAGGCGCAGTGG + Intronic
1197871306 X:131065194-131065216 AAGATGCAGTCCTGGGCCAGGGG - Intronic
1197939392 X:131773850-131773872 AAGATGCCGGCCGGGCGCGGTGG - Intergenic
1198104879 X:133452850-133452872 AGGATGGAGGCCAGGCGCAGTGG + Intergenic
1198243808 X:134809450-134809472 AAGATTTAGGCCAGGCGCAGTGG - Intronic
1198545470 X:137687571-137687593 AAAATGCAGGCCGGGCACAGTGG + Intergenic
1199017656 X:142837466-142837488 AAGATTCAGGCCAGGCGCGGTGG - Intergenic
1199720676 X:150541042-150541064 CAGATGTAGGGCTGGGGGAGGGG - Intergenic
1200091800 X:153639475-153639497 GAGTTGGAGGGTTGGCGCAGGGG + Intergenic
1200111169 X:153741652-153741674 AAGAGGCAGGGCCGGGCCAGGGG - Intronic
1200145060 X:153922104-153922126 AAGGTGCCTGGCTGGCGCTGGGG - Intronic
1200174899 X:154107260-154107282 AAGAAGCAGGCCGGGCACAGTGG + Intergenic
1201226816 Y:11826679-11826701 ATGCTGCAGGCCAGGCGCAGTGG + Intergenic
1201240991 Y:11956000-11956022 AAGACCCAGGCCTGGCGCGGTGG - Intergenic