ID: 1151881095

View in Genome Browser
Species Human (GRCh38)
Location 17:76895008-76895030
Sequence CTGGCTGCACAGCAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 2, 2: 10, 3: 61, 4: 465}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151881089_1151881095 0 Left 1151881089 17:76894985-76895007 CCGCTCCATGGTCTGTTAGGAAC 0: 1
1: 14
2: 216
3: 491
4: 749
Right 1151881095 17:76895008-76895030 CTGGCTGCACAGCAGGAAGTGGG 0: 1
1: 2
2: 10
3: 61
4: 465
1151881081_1151881095 24 Left 1151881081 17:76894961-76894983 CCAACCCCCTGGCATGGACCGGT 0: 1
1: 0
2: 1
3: 28
4: 365
Right 1151881095 17:76895008-76895030 CTGGCTGCACAGCAGGAAGTGGG 0: 1
1: 2
2: 10
3: 61
4: 465
1151881078_1151881095 26 Left 1151881078 17:76894959-76894981 CCCCAACCCCCTGGCATGGACCG 0: 1
1: 0
2: 0
3: 12
4: 185
Right 1151881095 17:76895008-76895030 CTGGCTGCACAGCAGGAAGTGGG 0: 1
1: 2
2: 10
3: 61
4: 465
1151881087_1151881095 6 Left 1151881087 17:76894979-76895001 CCGGTACCGCTCCATGGTCTGTT 0: 1
1: 2
2: 19
3: 207
4: 493
Right 1151881095 17:76895008-76895030 CTGGCTGCACAGCAGGAAGTGGG 0: 1
1: 2
2: 10
3: 61
4: 465
1151881091_1151881095 -5 Left 1151881091 17:76894990-76895012 CCATGGTCTGTTAGGAACCTGGC 0: 1
1: 47
2: 409
3: 810
4: 843
Right 1151881095 17:76895008-76895030 CTGGCTGCACAGCAGGAAGTGGG 0: 1
1: 2
2: 10
3: 61
4: 465
1151881083_1151881095 19 Left 1151881083 17:76894966-76894988 CCCCTGGCATGGACCGGTACCGC 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1151881095 17:76895008-76895030 CTGGCTGCACAGCAGGAAGTGGG 0: 1
1: 2
2: 10
3: 61
4: 465
1151881082_1151881095 20 Left 1151881082 17:76894965-76894987 CCCCCTGGCATGGACCGGTACCG 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1151881095 17:76895008-76895030 CTGGCTGCACAGCAGGAAGTGGG 0: 1
1: 2
2: 10
3: 61
4: 465
1151881079_1151881095 25 Left 1151881079 17:76894960-76894982 CCCAACCCCCTGGCATGGACCGG 0: 1
1: 0
2: 0
3: 17
4: 195
Right 1151881095 17:76895008-76895030 CTGGCTGCACAGCAGGAAGTGGG 0: 1
1: 2
2: 10
3: 61
4: 465
1151881084_1151881095 18 Left 1151881084 17:76894967-76894989 CCCTGGCATGGACCGGTACCGCT 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1151881095 17:76895008-76895030 CTGGCTGCACAGCAGGAAGTGGG 0: 1
1: 2
2: 10
3: 61
4: 465
1151881085_1151881095 17 Left 1151881085 17:76894968-76894990 CCTGGCATGGACCGGTACCGCTC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1151881095 17:76895008-76895030 CTGGCTGCACAGCAGGAAGTGGG 0: 1
1: 2
2: 10
3: 61
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151881095 Original CRISPR CTGGCTGCACAGCAGGAAGT GGG Intronic
900089930 1:915781-915803 AAGGCTGCACAGCCAGAAGTGGG + Intergenic
900241797 1:1620797-1620819 CTGGTGGCAGAGCAGGCAGTGGG + Intronic
901033465 1:6322090-6322112 CTGGCTGCAATGCAGGATGTCGG + Intronic
901505203 1:9680761-9680783 CTGGCCCCACAGCAGGAACGCGG + Intronic
901612566 1:10510502-10510524 CTGGCAGCCTAGCAGGAAATGGG - Intronic
902805074 1:18855928-18855950 GTGGCTGGACAGGAGGGAGTGGG - Intronic
903457478 1:23497710-23497732 AAGGCTGCACAGCAGGCAGAAGG - Intergenic
903684399 1:25120228-25120250 CTGGCAGCCCAGCAAGAAGTGGG - Intergenic
903701972 1:25255933-25255955 CAGGCCGCACAGCAGGAGGCAGG - Intronic
903703469 1:25267849-25267871 CTGGGTTCACAGCTGGACGTCGG - Intronic
903712736 1:25338178-25338200 CTGGGTTCACAGCTGGACGTCGG - Exonic
903909111 1:26709336-26709358 GTGGATGCACAGGAGGAAGGTGG - Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906119889 1:43382377-43382399 GTGGCAGCACAACAGGAGGTGGG + Intergenic
906796786 1:48702636-48702658 CATGCAGCACAACAGGAAGTAGG + Intronic
907147751 1:52251699-52251721 CTGGCTTCACAGAAGGAGTTAGG + Intronic
907271928 1:53296367-53296389 CTGGGTGCACAGAAGGGACTTGG + Intronic
907328896 1:53658750-53658772 CATGGTGCACAGCAGGAGGTAGG + Intronic
907814855 1:57908473-57908495 CTGGCTGCCCATCAGGATGCGGG - Intronic
907926053 1:58956145-58956167 CAGGCCACACAGCAGGAGGTAGG + Intergenic
907977321 1:59444589-59444611 CTGGCTGCACAGCATGAGGTGGG + Intronic
911357786 1:96843428-96843450 CTGTCTGCAAGCCAGGAAGTGGG - Intergenic
911422114 1:97656194-97656216 CTGGCAGCCCAGCAAGAAGAAGG + Intronic
912532431 1:110335935-110335957 CTGGCTGCACAGCAGGTGAGGGG + Intergenic
913186196 1:116372975-116372997 CTGGCTGAACAGCGGGGACTCGG - Intronic
914346945 1:146808073-146808095 CTGGGTGTCCAGCAGGGAGTTGG - Intergenic
914521151 1:148417584-148417606 CTGCCTGCAGAGCAGGAGGCAGG - Intergenic
915342834 1:155185618-155185640 CTGGCAGCACAAGAGGAAGGAGG - Intronic
915768241 1:158388987-158389009 CTGGCTGAACAGAAGAAAGTTGG + Intergenic
916752962 1:167740321-167740343 ATGGCTGGACAGAAGAAAGTGGG - Intronic
918200993 1:182266754-182266776 CCATCTGCACAGCAGGAAGCAGG + Intergenic
918623059 1:186627104-186627126 CATGCTGCACAGCTGAAAGTGGG - Intergenic
918873772 1:190011524-190011546 CTGGCTTCACAGAATGAATTAGG - Intergenic
920394083 1:205631527-205631549 CGCGCGGCACAACAGGAAGTGGG - Intronic
920788933 1:209070361-209070383 CTGTCTGCAAACCAGGAAGAGGG - Intergenic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
922658225 1:227404704-227404726 CTGGCTGCATAGAATGAATTAGG - Intergenic
922729494 1:227942341-227942363 CTGGGTGCAGAGCAGGAAGGAGG + Intronic
922890526 1:229058414-229058436 CTCCTTGCACAGCAGGGAGTGGG - Intergenic
923033670 1:230269005-230269027 ATGGCTGCACAACAGCAAGAAGG - Intronic
923200618 1:231707356-231707378 CTGCCTGCACACCAGGACTTTGG + Intronic
923344090 1:233034367-233034389 CTGTCTGCAGACCAGGAAATGGG + Intronic
923346141 1:233054517-233054539 CTGGATACACAGCAAGGAGTAGG - Intronic
923798560 1:237184212-237184234 GTGGCTGCAAAGAAGGATGTTGG + Intronic
924030742 1:239882842-239882864 CTGGCTGCCCAGCACGCAGTGGG + Intronic
924221702 1:241883365-241883387 CTGTCTGCAAACCAGGAAGTGGG - Intronic
1063463690 10:6229942-6229964 CGGGCCACACAGCAGGAGGTGGG - Intronic
1064096368 10:12427335-12427357 GTGGCTGCCCAGAGGGAAGTGGG + Intronic
1064119922 10:12609720-12609742 CAGGCTGCACAGCAAGAGGGGGG - Intronic
1065156324 10:22873687-22873709 GTGTCTGGACAGCAGAAAGTGGG - Intergenic
1065300346 10:24315411-24315433 CTGTCTGCAAGGAAGGAAGTAGG + Intronic
1065355563 10:24837407-24837429 CTGGCTTCACAGAATGAATTAGG - Intergenic
1065847891 10:29761284-29761306 AGGGCTGGACAGGAGGAAGTAGG + Intergenic
1066053385 10:31658589-31658611 CTGGCTGCCCAACAGGAAAGGGG + Intergenic
1066232842 10:33454521-33454543 CTGGCTGCACAGAACAAAATGGG - Intergenic
1066340371 10:34526696-34526718 CTGGTGGCACAGCAGGAGGAGGG - Intronic
1067052149 10:43027837-43027859 CTGCCAGCACAGCAGGAAAGTGG + Intergenic
1067235622 10:44446177-44446199 CAGGCTGCACGGCAGGAGGTGGG - Intergenic
1067381628 10:45779109-45779131 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1067657598 10:48208503-48208525 CTGGCTCCAAAGCAGGAACTTGG - Intronic
1067693831 10:48521291-48521313 CTGGCTGCAAAGCTGTAGGTGGG - Intronic
1067889327 10:50119743-50119765 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1068253579 10:54476977-54476999 CTGGAGGCAAAGAAGGAAGTTGG - Intronic
1068481062 10:57588913-57588935 CTGGCTTCACAGAATGAATTAGG - Intergenic
1069568430 10:69479330-69479352 CTCCCTGCACAGGAGGAAGCAGG + Intronic
1069813773 10:71180651-71180673 CTGGCTGGACAGATGGATGTAGG - Intergenic
1071573004 10:86708244-86708266 CTGGCTGCCCAGCGGGGAGTGGG + Intronic
1071771049 10:88728961-88728983 CTGCCTCCCCAGCAGGATGTGGG - Intronic
1072766458 10:98098492-98098514 CTGACCGCACAGCAGGAGCTGGG - Intergenic
1073503667 10:103966001-103966023 CTGGAGGCAGATCAGGAAGTGGG + Intergenic
1074735246 10:116424586-116424608 TGGGCTGCACAGCAGGAGGTGGG + Intergenic
1074985520 10:118655569-118655591 CTGGCTTCACAGAATGAATTAGG + Intergenic
1076298208 10:129403653-129403675 CTGGCAGCGCAGCATGAAGTCGG - Intergenic
1076755751 10:132570805-132570827 CTGCCAGGACAGCAGGAGGTGGG + Intronic
1076815612 10:132913346-132913368 CAGGCTGCAGGGCAAGAAGTGGG + Intronic
1077344081 11:2038433-2038455 AAGGCTGCACGGCAGGAGGTGGG + Intergenic
1078572416 11:12470844-12470866 CTCGCTGCACTGTGGGAAGTAGG + Intronic
1079165277 11:18035090-18035112 CAGGCTGCACAGCAGCAGGTGGG - Intronic
1079369306 11:19836850-19836872 CTGTCTGCAAATGAGGAAGTGGG - Intronic
1079414034 11:20216207-20216229 GAGGCAGCAGAGCAGGAAGTTGG - Intergenic
1080684147 11:34501707-34501729 TTGGCTGCACTGCAGGCAGGAGG - Intronic
1080914408 11:36641171-36641193 CTGGCTGAACAGAAGAAAGTTGG - Intronic
1081720388 11:45284826-45284848 CCGGCTGCACAGCAGAATGTGGG - Intronic
1081786245 11:45749882-45749904 CTGGCTGCATAGGATGGAGTGGG + Intergenic
1083690425 11:64404943-64404965 CTGGCTGAACTGGAGGAAGAGGG - Intergenic
1083830988 11:65233385-65233407 CTTGCTGCACACCAAGAACTGGG + Intergenic
1084049864 11:66592641-66592663 CTCGCTGCTCAGCAGCACGTAGG + Exonic
1084328590 11:68416334-68416356 CTGGCTGAACAGCAAGAAGGTGG - Exonic
1084618199 11:70250684-70250706 CTGGCTGCTCAGTAGGATGGAGG + Intergenic
1084770563 11:71340411-71340433 GGGGCTGCACAGCAGGCAGTGGG + Intergenic
1084795585 11:71502529-71502551 CTGTCTGGATAGCAGAAAGTGGG + Intronic
1085525549 11:77161549-77161571 CTGACTTTCCAGCAGGAAGTGGG - Intronic
1085873529 11:80379477-80379499 CTGTCTACAAACCAGGAAGTGGG - Intergenic
1088206733 11:107400701-107400723 CTGGCTTCACAGAATGAATTAGG - Intronic
1088651199 11:111959108-111959130 CTGGATGCAGGGCAGGAACTTGG + Intronic
1088875863 11:113935797-113935819 CAGGCTGCCCAGCGGGAGGTTGG + Intronic
1089181569 11:116586796-116586818 CTAGCTGCTCATCAGGAAGGTGG + Intergenic
1090183580 11:124721458-124721480 AAGGCTGCACAGCAGGAAACTGG - Intergenic
1090261315 11:125322659-125322681 TTGGCTGCAGAGCTGGAAGGGGG + Intronic
1090277354 11:125429474-125429496 CTAGCTGCAAAGCTGGGAGTGGG + Intronic
1090397330 11:126427663-126427685 CTGATGGCACACCAGGAAGTTGG + Intronic
1090757600 11:129806945-129806967 CTGGCTTCACAGAATGAATTAGG - Intergenic
1090868969 11:130726236-130726258 CTGGCTGCAGGGCAGGATGGGGG - Intergenic
1091048755 11:132349244-132349266 CTGGGTGCAGAGCAGGATGGAGG - Intergenic
1202827067 11_KI270721v1_random:93622-93644 AAGGCTGCACGGCAGGAGGTGGG + Intergenic
1091602702 12:1927743-1927765 CTGGCTGCCCAGCAGTCAGGAGG + Intergenic
1092725933 12:11485655-11485677 CAGGCTGCATAGCGGGAGGTGGG - Intronic
1093010325 12:14100777-14100799 CTGTCTGCAAACCAGGAAGAGGG - Intergenic
1093049024 12:14485732-14485754 ATGGCTGCACACCAGGTACTAGG + Intronic
1093049771 12:14491741-14491763 ATGGCTGCACACCAGGTACTAGG + Intronic
1093558055 12:20501884-20501906 CAGGATGCACTGCATGAAGTGGG - Intronic
1093957321 12:25236012-25236034 TGGGCTGCACAGCCGGAAGGAGG - Intronic
1095048322 12:37534368-37534390 CTGGCTGCACACCAGGTTGTGGG + Intergenic
1095621800 12:44265206-44265228 AAGGCTGCACAGCAGAAAGGAGG + Intronic
1095921793 12:47539342-47539364 CTGGCTGCAGTGTAGAAAGTGGG + Intergenic
1096589142 12:52645695-52645717 CTGGCAGCATAGAAGAAAGTGGG - Intronic
1097867555 12:64571460-64571482 CTGGCAGCAAAGGAGAAAGTGGG + Intergenic
1097982444 12:65748277-65748299 CTGTCTGCAAACCAGGAAGAAGG + Intergenic
1098055583 12:66501863-66501885 ATGGCTTCACAGCAGCATGTTGG + Intronic
1098584012 12:72134784-72134806 CTGGGTGCAGAGGAGGAGGTGGG + Intronic
1099670147 12:85680949-85680971 CTTGCTGAACTGCAGGCAGTGGG + Intergenic
1100881583 12:99024424-99024446 TTGTTTGCACAGCAGGAAGTTGG - Intronic
1101210063 12:102526507-102526529 CTGACTGCACAGCTGGAAGGTGG - Intergenic
1101338929 12:103823943-103823965 CTGACTGGGCAGAAGGAAGTTGG - Intronic
1101398999 12:104372276-104372298 TGGGCCCCACAGCAGGAAGTGGG - Intergenic
1102114991 12:110396141-110396163 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1102305222 12:111799700-111799722 CGGGGCGCACAGGAGGAAGTTGG + Intronic
1102409791 12:112707813-112707835 CTTGCTGCACATCAGGCAATGGG - Intronic
1102440892 12:112963290-112963312 CTGGGGGCACAGCAGGAAGGTGG - Intronic
1103226336 12:119291126-119291148 AGGGCCACACAGCAGGAAGTGGG + Intergenic
1103731688 12:123032087-123032109 CTGGCTGCACAGCTGCAGGAAGG + Intronic
1104239601 12:126975078-126975100 CAGGGTGCAGAGCAGGAAGTAGG + Intergenic
1104381513 12:128311983-128312005 CTTTCAGCACAGCTGGAAGTTGG - Intronic
1104613455 12:130249514-130249536 CTGGCTGAAAAACAGGAAGGAGG + Intergenic
1104684573 12:130776366-130776388 CTGGCTTCCCAGCTGGAAGGAGG + Intergenic
1105328382 13:19391148-19391170 CTGGCTGCACAACAGAAGGTGGG + Intergenic
1105669833 13:22600806-22600828 CAGGCCGCACAGCAGGAGGTGGG - Intergenic
1106218537 13:27724777-27724799 CTGGCTACACAGCAGAGAATAGG + Intergenic
1106875395 13:34066559-34066581 CTGGCTTCAAAGCAGGCAGGGGG - Intergenic
1106957246 13:34953801-34953823 TGGGCCGCACAGCAGAAAGTGGG + Intronic
1107332128 13:39312286-39312308 CTGTCTGCAGAACAGGAAGGGGG + Intergenic
1107755684 13:43619756-43619778 CTGGCTTCACAGAATGAATTAGG + Intronic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1108369985 13:49759785-49759807 TGGGCTGCACAGTAGGAGGTAGG - Intronic
1108825857 13:54411431-54411453 CTGGCTTCACAGAATGAATTAGG - Intergenic
1109436685 13:62312684-62312706 CTGGCTGCACAACTAGAAATTGG + Intergenic
1109508083 13:63333405-63333427 CTGGCTTCACAGAATGAATTAGG + Intergenic
1112022489 13:95383776-95383798 TGGGCTGCACAGCAGGAGGTGGG + Intergenic
1114629709 14:24151254-24151276 CTGGCTGGACAGCAGGACCCTGG + Exonic
1114762339 14:25330199-25330221 CTGGCAGCAGGGCAGGATGTAGG - Intergenic
1116048750 14:39777975-39777997 CTGGCTTCATAGCATGAATTAGG + Intergenic
1116403099 14:44533172-44533194 CTGCCTGCAAAGCAGAAAGGTGG + Intergenic
1117746746 14:58877288-58877310 CTGGCTGCAAAGAAAGAACTAGG + Intergenic
1118893581 14:69928205-69928227 CAGGCTGGAAAGCAGGAGGTTGG + Intronic
1119121599 14:72084332-72084354 TGGGCTGCATAGCAGGAGGTGGG - Intronic
1119520384 14:75280231-75280253 CTGGCTGCACATCCGTAACTGGG + Intronic
1119790034 14:77341804-77341826 CTTGTTGCGCAGCAGGGAGTAGG + Exonic
1119878956 14:78085006-78085028 CAGGCTGCCCAGCAGGTGGTTGG + Intergenic
1121242304 14:92439658-92439680 CTGGGTCCACAGCAGGCTGTTGG + Intronic
1122128408 14:99591483-99591505 CTGGCTGGACTACAGGATGTGGG - Intronic
1122155704 14:99749163-99749185 CTGGGTGCACACCGGGAAGCGGG + Intronic
1122218686 14:100221485-100221507 CTGAATTTACAGCAGGAAGTTGG + Intergenic
1122264553 14:100540526-100540548 CTGGCTGCACTGCAGCAGCTGGG + Exonic
1122446757 14:101775464-101775486 CTGGCTGCACGGAAGGTTGTGGG + Intronic
1122660027 14:103288932-103288954 CAGGCTGCACAGCAAGAGGTGGG + Intergenic
1122782539 14:104149742-104149764 AGGGCTGCACAGCAGGAGGCAGG - Intronic
1122786817 14:104167797-104167819 CTGGCTGCAGAGCAGGCCGAGGG - Intronic
1122794684 14:104200229-104200251 CAGGCTGCACAGTAGGCAGATGG - Intergenic
1123679158 15:22745244-22745266 TGGGCTGCACAGCAGGAGGTGGG + Intergenic
1124086616 15:26556888-26556910 CTGGCTCCACAGCAGGGACTTGG - Intronic
1124331377 15:28819694-28819716 TGGGCTGCACAGCAGGAGGTGGG + Intergenic
1124386455 15:29211981-29212003 CTGGCTTCACAGAATGAATTAGG + Intronic
1125273161 15:37962543-37962565 CTGGCTTCACAGAATGAATTGGG + Intronic
1125579198 15:40773812-40773834 CTGGCTGTCCAGAATGAAGTTGG - Exonic
1125594007 15:40873029-40873051 ATGGCTGCATAGCAAGTAGTAGG - Exonic
1126661851 15:51040023-51040045 CAGGCCGCACAGCAGGAGGTGGG + Intergenic
1127137500 15:55939854-55939876 CTGGCTGCATACCTAGAAGTGGG - Intronic
1128970861 15:72104529-72104551 GTGCCTACACATCAGGAAGTTGG + Intronic
1129679562 15:77650591-77650613 CTTGCAGAACAGGAGGAAGTGGG - Intronic
1132208450 15:100002829-100002851 AGGGCTGGACAGCAGGAAGGAGG - Intronic
1132283146 15:100637857-100637879 CTGGCTTCACAGAAGGCAGCTGG - Intronic
1132738605 16:1399484-1399506 GTAGCTGCCCAGCACGAAGTTGG + Exonic
1134620788 16:15687609-15687631 CTGGGTGCAGAGCAGGGTGTGGG - Intronic
1134689236 16:16180191-16180213 CAGGCAGCACAGCAGGAGGTGGG - Intronic
1134867776 16:17624008-17624030 CTGTCTGCAAACCAGGAAGAGGG + Intergenic
1135270364 16:21064272-21064294 CTGGCTGGACAACAGGTATTTGG - Intronic
1136572692 16:31106083-31106105 CTGGCTGTACTCCAGGACGTTGG + Intergenic
1136966983 16:34924527-34924549 CTGGCTGCACAGAATAAATTGGG - Intergenic
1137672575 16:50287944-50287966 CTGGATGCACAGGAGGATGCTGG + Exonic
1138342686 16:56301016-56301038 GTGGCTGCTCAGCAGGGAATGGG - Intronic
1138708478 16:58942021-58942043 TGGGCTGCACAGCAGGAGGAGGG + Intergenic
1139000489 16:62504556-62504578 CTGTCGGCAAATCAGGAAGTGGG + Intergenic
1139392551 16:66614178-66614200 CAGGCTGCACAGCAGGAGGTGGG - Intergenic
1139484914 16:67249951-67249973 CTGGCTGCTCAGAAGGGAGGAGG - Intronic
1139987037 16:70907197-70907219 CTGGGTGTCCAGCAGGGAGTTGG + Intronic
1140298633 16:73734190-73734212 CGGGCTGCACAGCAGGAAGTGGG - Intergenic
1140341993 16:74173604-74173626 CTGTCTGCAAATCAGGAAGAGGG - Intergenic
1141778229 16:86138657-86138679 CTGCCTGCATACCAGGAAGCAGG - Intergenic
1142464101 17:118450-118472 CTGGCACCTCAGCGGGAAGTTGG + Intergenic
1142661857 17:1435962-1435984 ATGGCTGGCCAGAAGGAAGTGGG + Intronic
1143564196 17:7711785-7711807 GTGGCTGATCAGAAGGAAGTAGG + Intergenic
1143823878 17:9588421-9588443 CTGGCTGCGCAGCTGTATGTGGG + Intronic
1144965560 17:19075325-19075347 CTGCCTGCCCAGGAGAAAGTCGG - Intergenic
1144982407 17:19176858-19176880 CTGCCTGCCCAGGAGAAAGTCGG + Intergenic
1144985816 17:19201381-19201403 CTGCCTGCCCAGGAGAAAGTCGG - Intergenic
1144996047 17:19269672-19269694 CTGGCTGCACTGAAGGGAGCTGG + Intronic
1145411590 17:22670548-22670570 CTGCCTGCACACCAGGTTGTGGG + Intergenic
1145728369 17:27154346-27154368 CTGGCTGCACTCCAGGTTGTAGG - Intergenic
1145728760 17:27156816-27156838 CTGGCTGCACTCCAGGTTGTGGG - Intergenic
1146421969 17:32695348-32695370 CAGGCCGCACAGCAGCAGGTGGG - Intronic
1146945826 17:36872785-36872807 CTGTCTGCAAACCAGGAAATGGG + Intergenic
1146962310 17:36993054-36993076 CTGGCAGCACAGCAAGGAATGGG + Intronic
1147590528 17:41680282-41680304 CAGGCAGCCCAGCAGGAAGAGGG + Intergenic
1147729179 17:42586939-42586961 CTGCCTGCACAGCAAGATGGGGG - Intronic
1147935497 17:44008331-44008353 CTGGGTGCCCAGCATGCAGTAGG + Intronic
1148764158 17:50027719-50027741 CTGGCCTCACAGCCGGAAGCAGG - Intergenic
1148790179 17:50168395-50168417 GTGGCTGCGCACCAGGAACTCGG - Exonic
1150690511 17:67362714-67362736 CTGGCTGCAGAGCCTGTAGTGGG - Intronic
1151290031 17:73143062-73143084 CTATCTGCAAACCAGGAAGTGGG + Intergenic
1151378741 17:73710270-73710292 CCGGCTGCACCGCTGGAAGTGGG + Intergenic
1151772032 17:76170008-76170030 CTGAGTGCACAGCAGGACTTGGG + Intronic
1151881095 17:76895008-76895030 CTGGCTGCACAGCAGGAAGTGGG + Intronic
1152142964 17:78549319-78549341 CCGTCTGCACACCAGGAAGAGGG + Intronic
1152318441 17:79594518-79594540 CGGGCTGCACAGCCGGATTTAGG - Intergenic
1152477786 17:80529347-80529369 ATGGCTGCAGAGGAGGAAGGCGG - Intergenic
1152698188 17:81806551-81806573 CTGGCTGCCCGGCTGGAAGGTGG + Intronic
1203172918 17_GL000205v2_random:167822-167844 CTTGGTGGACACCAGGAAGTAGG - Intergenic
1153471053 18:5445721-5445743 AGGGCTGCACAGCAAGAGGTGGG + Intronic
1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG + Intergenic
1154311019 18:13266220-13266242 CTGGGTCCACAGGAAGAAGTCGG - Intronic
1155538170 18:26839516-26839538 TTTGCTCCACAGCAGGAATTAGG - Intergenic
1157020904 18:43780585-43780607 CAGGTTGCACTGGAGGAAGTAGG + Intergenic
1157409490 18:47451905-47451927 CTGTCTGCACAGAAGGTAGAAGG + Intergenic
1157809369 18:50683795-50683817 CTGGCAACACAGCTGGATGTAGG + Intronic
1157904606 18:51558352-51558374 CAGGCCGCACAGCAGTAGGTGGG + Intergenic
1157946962 18:51991324-51991346 CTGTCTGCAGACCAAGAAGTGGG - Intergenic
1158408110 18:57178533-57178555 CTGGCTTCACAGCAGAAGGCAGG + Intergenic
1158627107 18:59081106-59081128 TTGGGGGCACAGCAGGAAGGTGG - Intergenic
1158720650 18:59921394-59921416 CTGGATGTACAGCATGTAGTAGG - Intergenic
1159051715 18:63426641-63426663 GGGGCTGCACTGCAGGAACTGGG - Intergenic
1160231531 18:77052924-77052946 GTGGCTCCACAGGAGGGAGTAGG - Intronic
1160361857 18:78290142-78290164 CTGTCAGCTCCGCAGGAAGTGGG - Intergenic
1160809873 19:1008764-1008786 CTGGCTGCACACCAGCCAGGTGG + Exonic
1161085702 19:2333989-2334011 CTGGTAGAACAGCAGGAAGCAGG - Intronic
1161086868 19:2339493-2339515 CAGGCGGCTCAGCAGGAAGAGGG - Intronic
1161407356 19:4097995-4098017 CTGGCTGGAGAGGAGGAGGTGGG + Intronic
1162333319 19:10044099-10044121 TTGGCTGCACAGGAGGAAGTGGG + Intergenic
1162665447 19:12206692-12206714 CTGTCTGCACACTAGGTAGTAGG + Intergenic
1163853073 19:19677533-19677555 CTGTCTGCACACCAGGTGGTGGG + Intronic
1164298914 19:23941483-23941505 CTGGCTTCACAGAATGAATTAGG + Intronic
1165068589 19:33242341-33242363 GTGGATGCACAGCAGGAGGGTGG - Intergenic
1165167748 19:33869052-33869074 CCGGCTGCCCTGCAGGAAGCTGG - Intergenic
1165269320 19:34691424-34691446 CAGACTGCAAAGCAGGAAGGGGG - Intergenic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1166102053 19:40576849-40576871 CCGGGTGCACACCCGGAAGTGGG + Exonic
1166770711 19:45280455-45280477 CTTCCTGCCCAGCAGGAGGTAGG - Exonic
1166801962 19:45463347-45463369 CTGCCTGCAGAGCATGGAGTGGG - Intronic
1166862079 19:45816578-45816600 CTGGGTGGAGAGCAGGAAGGGGG + Intronic
1167655166 19:50759029-50759051 CAGGAAGCCCAGCAGGAAGTGGG - Intergenic
925032386 2:660977-660999 GCGGGTGCACAGCAGGGAGTGGG - Intergenic
925032394 2:661013-661035 GTGGGTACACAGCAGGGAGTGGG - Intergenic
927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG + Intergenic
928734009 2:34264629-34264651 CTGGCTTCACAGAATGAATTAGG - Intergenic
928856267 2:35806273-35806295 CTGGCTTCATAGAATGAAGTAGG - Intergenic
929217764 2:39434491-39434513 CTTGTGGCACAGCAGGAATTAGG + Intronic
929534645 2:42773417-42773439 CTGGCTGCACTGGGGGAGGTGGG + Intronic
930372118 2:50515028-50515050 CATGCCGCACAGCAGGAGGTGGG + Intronic
932343716 2:70982347-70982369 CTGGCTCCTCAGCAGGAGGGTGG + Intronic
932345620 2:70993630-70993652 CTGCCTCAAAAGCAGGAAGTGGG - Intronic
933249784 2:80016355-80016377 CAGGCTGCTCAGAAGGAAGGAGG + Intronic
934508322 2:94915232-94915254 CTGGCTTCAAAGCTGGAAGGAGG - Intergenic
934569896 2:95362746-95362768 TGGGCTGCACAGCAGGAGGTGGG - Intronic
934876090 2:97922273-97922295 AGGGCTGCACAGCAGGTGGTGGG - Intronic
935124212 2:100208674-100208696 CATGGTGCACAGCAGAAAGTGGG + Intergenic
935171296 2:100612986-100613008 ATGGCTGCAAGGCAGGCAGTGGG + Intergenic
935211897 2:100945675-100945697 CTGACAGCACTGCAGGAAGGTGG - Intronic
935346505 2:102112984-102113006 CTGTCTGCAAACCAGAAAGTGGG + Intronic
936019636 2:108984900-108984922 CTGCATGCACAGGAGGAAGCAGG - Intronic
936406799 2:112212129-112212151 CTGTCTACAAAGCAGGAAGCAGG - Exonic
937977026 2:127588645-127588667 CTGGGTCCACAGCATGCAGTTGG + Intronic
938576934 2:132613467-132613489 CTGGGTGTACTGCAGGGAGTGGG + Intronic
939101078 2:137895506-137895528 CTGTCTGCAAACCAGGAGGTGGG + Intergenic
940372772 2:152921367-152921389 CTGTCTGTAAACCAGGAAGTAGG - Intergenic
940740395 2:157501233-157501255 CTGTCTGCAAACCAGGAAGAGGG + Intergenic
940759383 2:157720693-157720715 TTGGCTCCACAGGGGGAAGTTGG - Intergenic
941368776 2:164638409-164638431 GTAGATGGACAGCAGGAAGTTGG + Intergenic
942579978 2:177407722-177407744 ATGGAAGCACAGCAAGAAGTAGG + Intronic
943086508 2:183318329-183318351 CTGCCTTCAAGGCAGGAAGTTGG - Intergenic
943890188 2:193276871-193276893 CTGGCTGTCCAGAATGAAGTTGG - Intergenic
944612529 2:201426123-201426145 CAGGCTGCATAGCAGGAGGTGGG + Intronic
945035304 2:205699314-205699336 CTGGCTGGACTGCAGAAGGTTGG + Intronic
945075446 2:206034234-206034256 CTGGCTTCATAGAATGAAGTAGG - Intronic
945460289 2:210100068-210100090 CAGGCTGCACAGCAGGAGGTGGG + Intronic
945580982 2:211594011-211594033 GTGGCTGGGCAGTAGGAAGTAGG - Intronic
946521697 2:220471947-220471969 ATGTCTGTACACCAGGAAGTGGG + Intergenic
947456761 2:230261958-230261980 CTGGCTTCACAGAATGAATTAGG + Intronic
948629776 2:239294667-239294689 CTGGCTCCAGAACAGGGAGTTGG + Intronic
1168934288 20:1649490-1649512 CTGGGTGCACATCAGGAATCAGG + Intronic
1169558256 20:6770681-6770703 CTGGCTGCAAGCCAGGAAGAGGG - Intronic
1172107436 20:32525060-32525082 CAGGCTGGGCAGCGGGAAGTGGG + Intronic
1174128343 20:48325127-48325149 TGGGCTGCACAGCTGGAAGAAGG - Intergenic
1174563993 20:51451600-51451622 CTAGGCGCACAGCAGTAAGTGGG + Intronic
1175277996 20:57784915-57784937 CTGGCTGCCAAGCAAGAAGATGG + Intergenic
1175462613 20:59163985-59164007 CTGCCTGCAGAGTAGGAACTGGG + Intergenic
1175724813 20:61310587-61310609 CAGGCTGGACAGCAGGAAGGGGG - Intronic
1175857926 20:62132766-62132788 CTGGGTGCACAGTTGGATGTGGG + Intronic
1176212062 20:63929494-63929516 CCAGCTGGACAGCACGAAGTAGG - Exonic
1176328902 21:5529465-5529487 CTTGGTGGACACCAGGAAGTAGG - Intergenic
1176398855 21:6291486-6291508 CTTGGTGGACACCAGGAAGTAGG + Intergenic
1176438302 21:6697618-6697640 CTTGGTGGACACCAGGAAGTAGG - Intergenic
1176462564 21:7024688-7024710 CTTGGTGGACACCAGGAAGTAGG - Intergenic
1176486125 21:7406466-7406488 CTTGGTGGACACCAGGAAGTAGG - Intergenic
1177847622 21:26309184-26309206 CTGGCTTCACAGAATGAATTAGG - Intergenic
1179101047 21:38355801-38355823 CTGGCTGTGGAGCTGGAAGTGGG - Intergenic
1179169555 21:38962414-38962436 CAGGATGCCCAGCAGGAAGTGGG - Intergenic
1180854418 22:19037105-19037127 CTGGCTGCAGAGGACGAAGCAGG - Exonic
1181301918 22:21886463-21886485 CTGTCTGCAAGCCAGGAAGTGGG - Intergenic
1181335310 22:22124484-22124506 GGGGCTGCACAGCCGGTAGTGGG + Intergenic
1181786868 22:25233481-25233503 GGGGCTGCACAGCAGGAGGTGGG + Intergenic
1181818918 22:25460438-25460460 GGGGCTCCACAGCAGGAGGTGGG + Intergenic
1182447700 22:30399125-30399147 CAGGTTGCAGGGCAGGAAGTGGG - Intronic
1182467835 22:30528946-30528968 CTGGCAGCCCACCAGGCAGTGGG + Intronic
1182951680 22:34381947-34381969 GGGGCTGCACGGCAGGAAGAAGG - Intergenic
1182997651 22:34829246-34829268 TTTGCTGATCAGCAGGAAGTAGG - Intergenic
1183048059 22:35237232-35237254 CTGGCTGCATAGAATGAATTAGG + Intergenic
1183188167 22:36304391-36304413 TTGGCTGCAGAGTAGGGAGTTGG - Intronic
1183547302 22:38461378-38461400 TTGGCTGCACTGCACGAACTTGG + Intergenic
1183979861 22:41533095-41533117 TTTGCTGCTCAGCAGGAGGTGGG - Intronic
1184541233 22:45126666-45126688 CTGTCTACAAACCAGGAAGTGGG - Intergenic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1185285769 22:49999455-49999477 CTGGCTGTAGGGCAGGAAGACGG + Exonic
950720103 3:14876621-14876643 CTGGCTGAACAGAAGGTAGCTGG + Intronic
952489683 3:33855958-33855980 TGGGCTGCACAGTAGGAGGTGGG + Intronic
953303860 3:41807808-41807830 CTGGCTGCATTGAAGGAAATGGG - Intronic
953436915 3:42884709-42884731 CAGGCAGCACAGCAGGAAATGGG - Intronic
954129744 3:48554367-48554389 CAGGGTTCACAGCAGGGAGTGGG - Intronic
954317204 3:49807580-49807602 CTGGCTTCATAGCAGGAAGAGGG + Intronic
954371787 3:50172794-50172816 CTGGCTGCCCACCAGGCAGAGGG - Intronic
954482895 3:50818012-50818034 CTGGCTGCCCAGTAGGAACAGGG + Intronic
955047834 3:55376597-55376619 TGGGCTGCACAGCAGGAGATGGG + Intergenic
956277320 3:67516671-67516693 CTGGCAACACAGCAGTGAGTAGG + Intronic
957183784 3:76915889-76915911 CTGACTGCAGACTAGGAAGTGGG - Intronic
957876606 3:86155011-86155033 CTGGATCCTCAGCAGGGAGTAGG - Intergenic
958044976 3:88273077-88273099 CTGGCTTCACAGTAAGAATTGGG + Intergenic
959899408 3:111642957-111642979 CTGGCTTCACAGAATGAATTAGG - Intronic
960467796 3:118018940-118018962 CTGGTCTCACTGCAGGAAGTTGG + Intergenic
960592392 3:119378625-119378647 CTGTGTGCACAGCAGAATGTGGG + Intronic
960828492 3:121817938-121817960 CTGTCTGCAAGCCAGGAAGTGGG + Intronic
961391578 3:126555445-126555467 TGGGCCGCACAGCAGGAGGTGGG + Intronic
961394469 3:126577612-126577634 CTGGCTGGAGAGCAGGGAGCTGG + Intronic
961659170 3:128459260-128459282 CTGGGTGCACAGCAGAAACCTGG - Intergenic
961951446 3:130753617-130753639 CTGGCTGCAGAGGAGGAGGTGGG + Intergenic
962680332 3:137792761-137792783 CTGGCTGCAGAGCCTGAACTAGG - Intergenic
962969590 3:140386550-140386572 CTGGCTGCACAGCTGTGTGTGGG - Intronic
963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG + Intronic
964136535 3:153351300-153351322 CTGGCCGCACAGCAGCATCTAGG + Intergenic
964849639 3:161081323-161081345 CTGCCTGCACAGAAGAAAGCGGG + Intergenic
966020600 3:175204081-175204103 CTGGCTTCACAGAATGAATTAGG - Intronic
968002003 3:195212532-195212554 CCGGCCGCACAGCAGGCGGTGGG + Intronic
968363615 3:198167782-198167804 CTGGCACCTCAGCGGGAAGTTGG - Intergenic
968646536 4:1743962-1743984 CTGGGGGCACTGCAGGAAGAAGG + Intronic
969411799 4:7033452-7033474 CTGTCTCCCCAGCAGGCAGTGGG + Intergenic
969496777 4:7530764-7530786 TTGGCTGCCCAGCAAGAAGAGGG - Intronic
970642317 4:18080782-18080804 CTGTCTGCAAGCCAGGAAGTGGG - Intergenic
971033638 4:22668884-22668906 CTGGCAGAACAGCAGCCAGTAGG - Intergenic
973903227 4:55499619-55499641 CAGGCCGCACAGCAGGAGGTAGG - Intronic
974395467 4:61329113-61329135 CTAGCTGCTCAGAAGGAAGAGGG - Intronic
975616931 4:76256217-76256239 CTCTCTGCACAGCCGGCAGTTGG + Exonic
976325312 4:83764159-83764181 CTGGCTGCTCATCAGCAAATGGG + Intergenic
978537852 4:109781645-109781667 CTGGCTTCACAGAATGAATTGGG - Intronic
979636612 4:122962190-122962212 TGGGCTTCACAGCAGGAGGTGGG - Intronic
980152910 4:129070261-129070283 CTGGCTTCACAGAATGAATTAGG + Intronic
980427596 4:132646602-132646624 CTGTCTGCAATCCAGGAAGTAGG - Intergenic
981081797 4:140644300-140644322 CGGGGTGGACAGCAGGGAGTGGG + Intronic
981490440 4:145333897-145333919 CTGGCTGTACAGCAGAAAAATGG + Intergenic
981784497 4:148462162-148462184 CAGGCCACACAGCAGGAGGTAGG + Intergenic
982064806 4:151644790-151644812 CAGGGTGCACAGCAGGAACAGGG - Intronic
982202518 4:152974356-152974378 TTGGCTGGAAAGCTGGAAGTTGG + Intronic
982630936 4:157828210-157828232 CTGGCTTCACAGAATGAATTAGG - Intergenic
984053453 4:174896065-174896087 CTGTCTGCAAACCAGGAAGAGGG + Intronic
984700198 4:182814174-182814196 CTAGCTGCCCAGATGGAAGTAGG + Intergenic
984823390 4:183904230-183904252 CAGGCAGCACAGCAGGAGGTGGG - Intronic
985379475 4:189377201-189377223 CTGGATGCTCAGCTGGAGGTAGG + Intergenic
986208968 5:5652335-5652357 CCGGCCGCACAGCAGGATGTGGG + Intergenic
986700733 5:10405972-10405994 ATGGCCGCACAGCAGGAGATGGG + Intronic
987017854 5:13838329-13838351 CGGGCCACACAGCAGGAGGTGGG + Intronic
987447421 5:18037529-18037551 TTGGCTGCACCGTAGGAGGTGGG + Intergenic
988335055 5:29896735-29896757 CTGTCTGCAAACCAGGAAGAGGG + Intergenic
988755130 5:34240756-34240778 CTGGCTTCACAGCATGAGTTAGG - Intergenic
988790508 5:34603365-34603387 CTAACTTCAAAGCAGGAAGTTGG - Intergenic
989456499 5:41650146-41650168 CTGGCCGCACAGCTGTATGTGGG + Intergenic
990247119 5:53874201-53874223 CAGGCCTCACAGCAGGAGGTGGG - Intergenic
990519508 5:56565221-56565243 CTGGTTGCATAGCATGGAGTTGG - Intronic
990712536 5:58601349-58601371 CTGGCTTCATAGAATGAAGTAGG + Intronic
991993712 5:72366505-72366527 CTGACAGCAAAGCAGGAAGTTGG - Intergenic
992022588 5:72639003-72639025 CAGGCCGCACAGCAGGCGGTGGG - Intergenic
993457639 5:88143884-88143906 CTGGCTGCAGAGTAGGGCGTTGG - Intergenic
993687340 5:90955100-90955122 CCGTCTGCAAACCAGGAAGTGGG + Intronic
994581494 5:101648438-101648460 CAGGCTGCACAATAGGAGGTGGG - Intergenic
994716458 5:103327649-103327671 CTGTCTGCAAAACAGGAAGAGGG + Intergenic
994841733 5:104932632-104932654 CAGGCCGCACAGCAGGAGGTGGG - Intergenic
996003832 5:118396738-118396760 CTGATTGCACAGCAGGCATTAGG + Intergenic
996713732 5:126569049-126569071 CAGGCTGCACAGCAGGAGGTAGG + Intronic
997680895 5:135749955-135749977 CTGCTTGCCCAGGAGGAAGTGGG - Intergenic
997830736 5:137147507-137147529 CTGGCTGCAAGCCAGGAAGAGGG - Intronic
998133968 5:139665127-139665149 CTGCCCGCCCAGCAGGCAGTTGG - Intronic
999377279 5:151095616-151095638 CTGGCAGCACAACAGGCAGATGG + Intergenic
999755404 5:154660562-154660584 CTGGCTGCGTAGCAGGCAGCTGG - Intergenic
999824484 5:155260936-155260958 CTGCTTGCACAGCAGGAACTGGG + Intergenic
1000025572 5:157356201-157356223 CCATCTGCACACCAGGAAGTGGG - Intronic
1000137034 5:158362982-158363004 GTGGCTCCAGAGCAGGAAGCTGG - Intergenic
1001350917 5:170963734-170963756 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1001415952 5:171545002-171545024 CAGGCTGCCCGCCAGGAAGTGGG + Intergenic
1001562473 5:172678481-172678503 CTGGCTGAGGAGCAGGAGGTGGG - Intronic
1001986414 5:176077076-176077098 CTGAATCCACAGCAGGAGGTTGG - Intronic
1002167400 5:177356915-177356937 CTGTCTGCAAACCAGGAAGAGGG + Intergenic
1002230453 5:177761049-177761071 CTGAATCCACAGCAGGAGGTTGG + Intronic
1002264883 5:178022698-178022720 CTGAATCCACAGCAGGAGGTTGG - Intronic
1003141755 6:3477698-3477720 CAGGCCACACAGCAGGAGGTGGG - Intergenic
1003165174 6:3671222-3671244 CTGGCTGCATGGGAGGGAGTGGG + Intergenic
1004546024 6:16599044-16599066 CTGGCTGGGCACCAGCAAGTTGG - Intronic
1005083452 6:21980577-21980599 CAGGCTGCAGAACAGGAAGAAGG - Intergenic
1005083482 6:21980747-21980769 CTGGTTCCAGAGCAGGAAGGAGG - Intergenic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1007099103 6:39232219-39232241 CTCTCTGCACAGCAGCCAGTGGG + Intergenic
1008315437 6:50033817-50033839 CTGGCTTCACAGAATGAGGTAGG - Intergenic
1010076072 6:71800201-71800223 CTGGCTGCACAGAATGAATTAGG + Intergenic
1013148473 6:107419132-107419154 CTGGCTGCACATTAGTATGTGGG - Intronic
1013437718 6:110128767-110128789 CAGGCTGTACAGCAGGAGGTGGG + Intronic
1014330480 6:120057753-120057775 CTGGCTTCACAGAATGAATTTGG - Intergenic
1016558982 6:145373143-145373165 CTTGCTGCACAGCTGGAATAAGG + Intergenic
1017743520 6:157427168-157427190 CTGGGAGCACAGGAGGAAGGAGG + Intronic
1019316609 7:389941-389963 CTCGCCACGCAGCAGGAAGTGGG + Intergenic
1019984951 7:4648748-4648770 CTGTCTGCAAACCAGGAAGTGGG + Intergenic
1019993723 7:4709787-4709809 CTGGCTGAACAGCGAGAAGACGG - Intronic
1020016724 7:4835747-4835769 CTGGCTGCACAGGAGGGCGGGGG + Intronic
1022759841 7:33336017-33336039 CTGGCTGAAGACCAGGAAGGAGG - Intronic
1023701571 7:42896726-42896748 CTGGCTTCACAGAATGAATTAGG - Intergenic
1023875050 7:44282346-44282368 GTGACTGCACAGCTGGAAGTGGG - Intronic
1024153907 7:46600742-46600764 TTGTCTGTACAGCAGGAAGATGG - Intergenic
1024723258 7:52162564-52162586 CTGGCTGATCAGCCGGAAGATGG - Intergenic
1024758700 7:52568168-52568190 CGGGCTGCACAGCAGAAGGTGGG - Intergenic
1025294241 7:57762953-57762975 CTGGTTGCACACCAGGTTGTGGG + Intergenic
1027594983 7:80162167-80162189 CTGGCTGTAAACCAGGAAGAGGG + Intronic
1029109094 7:98203152-98203174 CTGGCTTCGGAGCAGGAAGGGGG - Intronic
1032072811 7:128819282-128819304 CTGGCTGCACAGGTGCATGTTGG - Intronic
1032192641 7:129773435-129773457 TTGACTGCACAGCAGGAACATGG - Intergenic
1032871756 7:135993456-135993478 CTGGCTGCAGAGCATTGAGTAGG - Intergenic
1033286794 7:140048283-140048305 CTGGCTGCCCAGGAGGAACATGG - Intronic
1033288030 7:140059256-140059278 GTTGCTGCACAGCAGTCAGTCGG + Intronic
1034137874 7:148788037-148788059 CTGCCTACAAAGCAGGAAGAGGG - Intronic
1034336164 7:150324848-150324870 TGGGCGGTACAGCAGGAAGTGGG - Intronic
1034932499 7:155173695-155173717 GGGTCTGCACAGCAGGAAGAAGG + Intergenic
1035419166 7:158712544-158712566 CGGGGTTCACACCAGGAAGTTGG + Intergenic
1035455948 7:159008660-159008682 CTGGCTGCACAGCAGACTGATGG - Intergenic
1035754501 8:2021736-2021758 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754507 8:2021776-2021798 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754513 8:2021816-2021838 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1036428108 8:8665031-8665053 TTGACAGCAGAGCAGGAAGTAGG + Intergenic
1036619865 8:10417514-10417536 GTGGCTGAACCGCAGGAGGTGGG + Intronic
1036620400 8:10421449-10421471 CTGGCAGCACAGGTGGCAGTGGG - Intronic
1036966287 8:13301711-13301733 CAGGCTGCACAGCAGGAGATGGG + Intronic
1037333232 8:17765257-17765279 AGGGCTGCACAGCAGGAGGTAGG - Intronic
1037690374 8:21176836-21176858 TGGGCTGCACAGCAGGAGGTGGG - Intergenic
1037690385 8:21176884-21176906 TGGGCTCCACAGCAGGAGGTGGG - Intergenic
1037718249 8:21418320-21418342 CAGGTTGCAGAGCAGAAAGTTGG - Intergenic
1037742490 8:21618574-21618596 CAGGCTGCACAGCAGGAGGTGGG + Intergenic
1037953992 8:23039231-23039253 CAGGCCACACAGCAGGAGGTGGG - Intronic
1038012071 8:23483223-23483245 CCGGCTGGACAGCACGAGGTAGG + Intergenic
1038366946 8:26946121-26946143 CTGGCTTCATAGAAGGAATTAGG + Intergenic
1039880818 8:41624508-41624530 CGGGATGCACAGCAGGCAGGTGG - Exonic
1040946767 8:52893043-52893065 CGGGTTGCCCAGCAGGAAGACGG + Intergenic
1040988941 8:53328302-53328324 CTCCCTGCACTGCAGGAAGGAGG - Intergenic
1041731968 8:61071447-61071469 CTGACTGCATAGGAGGAAGTAGG - Intronic
1042200529 8:66276160-66276182 CTGGCCCCACAGCAGGCACTTGG + Intergenic
1043121374 8:76329439-76329461 CTGGCTTCACAGAATGAATTAGG + Intergenic
1044416460 8:91945581-91945603 CAGGCTGCAAAGCAGGAGGTAGG - Intergenic
1047301613 8:123618319-123618341 TGGGCGGCACAGCAGGAGGTGGG + Intergenic
1047488677 8:125356147-125356169 CTGGCTTCATAGCAGCCAGTTGG - Intronic
1048575815 8:135689225-135689247 CTGGATGTACACCAGGAAGCTGG + Intergenic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1049676371 8:143891085-143891107 CTGGCTGCACAGCTGGGGGTCGG - Intergenic
1050891247 9:10827295-10827317 CTGGCTTCACAGAAGGATTTGGG + Intergenic
1051689578 9:19696012-19696034 CAGGCTGCACAGCAGGAGGTGGG + Intronic
1051713434 9:19956911-19956933 CTGTCTATACACCAGGAAGTAGG + Intergenic
1051881444 9:21844365-21844387 CTGGCTTCACAGAATGAATTAGG - Intronic
1051900439 9:22032958-22032980 CAGGCTGCACAGCAGAAGGTGGG + Exonic
1052902524 9:33805893-33805915 CTGGCTGCGAAACAGGAACTTGG - Intergenic
1054162181 9:61681352-61681374 CTGGCCGCACACCAGGTTGTGGG - Intergenic
1055416619 9:76091095-76091117 CCGGCCACACAGCAGGAGGTGGG - Intronic
1056322430 9:85448895-85448917 CTGGCTTCACAGAATGAATTAGG + Intergenic
1057164634 9:92916087-92916109 CTGGCTACACAGAATGATGTTGG - Intergenic
1057170852 9:92962237-92962259 CTGGCAGCACAGCAGCAGGCTGG - Intronic
1057180391 9:93026708-93026730 CTGGGTGCACAGCAAGAGCTTGG - Intronic
1057269000 9:93636628-93636650 CTTGCTGGAAAGCAGGAAGCAGG + Intronic
1057517484 9:95734361-95734383 CTGTCTGCAGTGCAGGAATTGGG + Intergenic
1057673534 9:97117985-97118007 CTGGCTGCAAAACAGGAAGTTGG + Intergenic
1058581222 9:106460017-106460039 CTTGCTTCAAAGCAGGAAGAAGG + Intergenic
1060453490 9:123766197-123766219 CTGCCAGGACAGCAAGAAGTGGG - Intronic
1060746063 9:126131667-126131689 TGGGCTGCAGGGCAGGAAGTGGG + Intergenic
1060925451 9:127452245-127452267 AGGGCTGCACATCAGGAAGGGGG + Intronic
1061372922 9:130207901-130207923 CTGGCTGCAGACCCGGAAGCTGG - Intronic
1061619282 9:131800930-131800952 CAGGGTGCACAGCAGGCAGTGGG - Intergenic
1061927299 9:133812213-133812235 CTCGCTGCACAGGAGGAGGCGGG + Exonic
1062074959 9:134582706-134582728 CTGTCTGCAGAGGAGGACGTAGG - Intergenic
1062191735 9:135251396-135251418 CAGCCTGCACAGCAAGAAGTGGG + Intergenic
1203433197 Un_GL000195v1:110857-110879 CTTGGTGGACACCAGGAAGTAGG + Intergenic
1186203785 X:7180487-7180509 CTGGCTGCACAGCAGGAGGTGGG - Intergenic
1186787543 X:12967847-12967869 CTAACTGCACAGCAGGGGGTTGG - Intergenic
1187697540 X:21937172-21937194 CTGTCTGCTCAGAAGCAAGTGGG + Intergenic
1188057686 X:25560683-25560705 CTGCCTGCAAACCAGGAAGTAGG - Intergenic
1188824525 X:34814709-34814731 CTGTCTGCTCCGCAGAAAGTTGG - Intergenic
1189202238 X:39206438-39206460 TTGGCTGCTGAGCAGTAAGTAGG + Intergenic
1189267327 X:39726938-39726960 CTGGCAGCGAAGCAGGATGTTGG - Intergenic
1189878854 X:45467987-45468009 CTGGCTTCACAGAATGAATTAGG + Intergenic
1190879338 X:54481846-54481868 AAGGCTCCACAGCAGGAAGAAGG + Intronic
1193278504 X:79620460-79620482 TGGGCTGCAGAGCAGGAGGTAGG + Intergenic
1194557178 X:95374559-95374581 CTGGCTTCACAGAATGAATTAGG - Intergenic
1196882242 X:120208868-120208890 CTGGCTGCACAGCTGTGTGTGGG + Intergenic
1197182605 X:123552385-123552407 CCATCTGCAAAGCAGGAAGTAGG - Intergenic
1197925604 X:131644085-131644107 TTGTCTGCAAACCAGGAAGTGGG - Intergenic
1198332407 X:135633745-135633767 CTGGCTGCATAGCAGACATTGGG + Intergenic
1198364707 X:135928812-135928834 CTGGCTGCATAGCAGACACTAGG + Intergenic
1199481719 X:148305364-148305386 CGGGCTGCAAAGCTTGAAGTGGG - Intergenic
1200910374 Y:8526527-8526549 CTGGCTGCACTTCAGGGTGTTGG + Intergenic
1200923305 Y:8632113-8632135 CTGGCTGCACACCAGGTTGTGGG + Intergenic
1200926074 Y:8656042-8656064 CTGGCTGCACTCCAGGTTGTGGG + Intergenic
1200963913 Y:9019336-9019358 CTGGCTGCACTCCAGGGTGTGGG - Intergenic
1200980408 Y:9258737-9258759 CTGGCTGCACTCCAGGTTGTGGG + Intergenic
1200980736 Y:9261200-9261222 CTGGCTGCACTCCAGGTTGTGGG + Intergenic
1201163082 Y:11181681-11181703 TGGGCTGCACAGGATGAAGTAGG + Intergenic
1202125703 Y:21567182-21567204 CTGGCTGCACTCCAGGGTGTGGG + Intergenic
1202130682 Y:21605923-21605945 CTGGCTGCACTTCAGGTTGTGGG - Intergenic
1202149198 Y:21829443-21829465 CTGGCTGCACTCCAGGTTGTGGG + Intergenic
1202153305 Y:21862210-21862232 CTGGCTGCACTCCAGGGTGTGGG - Intergenic
1202182094 Y:22148346-22148368 CTGGCTGCACTTCAGGTTGTGGG - Intergenic
1202183326 Y:22157947-22157969 CTGGCTGCTCTGCAGGTTGTGGG - Intergenic
1202208033 Y:22428454-22428476 CTGGCTGCTCTGCAGGTTGTGGG + Intergenic
1202209266 Y:22438056-22438078 CTGGCTGCACTTCAGGTTGTGGG + Intergenic