ID: 1151881230

View in Genome Browser
Species Human (GRCh38)
Location 17:76896014-76896036
Sequence GGGCCTTGGTGTTGTCACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151881230_1151881239 7 Left 1151881230 17:76896014-76896036 CCACGGTGACAACACCAAGGCCC 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1151881239 17:76896044-76896066 CCCACACGGTGACAACACCAAGG 0: 1
1: 0
2: 1
3: 7
4: 93
1151881230_1151881234 -7 Left 1151881230 17:76896014-76896036 CCACGGTGACAACACCAAGGCCC 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1151881234 17:76896030-76896052 AAGGCCCTGGGTTCCCCACACGG 0: 1
1: 0
2: 0
3: 25
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151881230 Original CRISPR GGGCCTTGGTGTTGTCACCG TGG (reversed) Intronic
900192800 1:1358592-1358614 AGGCCTCCGTGATGTCACCGCGG - Intronic
901443926 1:9295480-9295502 GGGCCCTGGTGATGTCACTTTGG + Intronic
903239318 1:21972133-21972155 GAGCCTTGCTGTTGTCACCCAGG - Intergenic
903623937 1:24717919-24717941 AGCCCTTGCTGTTGGCACCGCGG + Intergenic
905973324 1:42156930-42156952 GGGTCTTGTTCTTGTCACCCAGG - Intergenic
906084726 1:43121752-43121774 GGGTCTTGCTGTTGTCACCCAGG + Intergenic
907571742 1:55490209-55490231 GAGCCTTGCTGTTGTCACCCAGG - Intergenic
908295110 1:62705639-62705661 GAGTCTTGGTCTTGTCACCCAGG + Intergenic
908331343 1:63074035-63074057 GGGTCTTGGGCTTGGCACCGCGG + Intergenic
910200324 1:84691578-84691600 GGGCCCTGAAGTTGTCACCGTGG - Intergenic
910453728 1:87373266-87373288 GGGTCTTGATCTTGTCACCCAGG + Intergenic
910932582 1:92457430-92457452 GAGTCTTGGTCTTGTCACCCAGG + Intergenic
911002012 1:93176557-93176579 GGGTCTCGCTCTTGTCACCGAGG + Intronic
911055778 1:93707147-93707169 GAGTCTTGCTGTTGTCACCTAGG - Intronic
911296700 1:96126032-96126054 GAGTCTTGGTCTTGTCACCCAGG - Intergenic
912107581 1:106299188-106299210 GGGAATTGGTGTTGTCAAAGAGG + Intergenic
917312702 1:173693266-173693288 GAGTCTTGCTGTTGTCACCTGGG - Intergenic
919281617 1:195496405-195496427 GGGGCTTGCTGTGGTCACTGTGG + Intergenic
920136908 1:203777202-203777224 GAGCTTTGGTCTTGTCACCCAGG + Intergenic
1062817706 10:512891-512913 GGGTCTCGCTGTTGTCACCCAGG - Intronic
1062998006 10:1885509-1885531 GAGTCTTGGTCTTGTCACCCAGG - Intergenic
1063959837 10:11297954-11297976 GAGCCTTGCTCTTGTCACCTGGG - Intronic
1064959174 10:20944372-20944394 GGGTCTTGGTCTTGTCGCCCAGG - Intronic
1066133089 10:32413638-32413660 TGGCCTTGCTGTTGTCTGCGTGG + Intergenic
1066552895 10:36578814-36578836 GAGTCTTGCTGTTGTCACCCGGG - Intergenic
1067774112 10:49149528-49149550 GGGGCTTGATGTTGTCATAGTGG - Intergenic
1068633451 10:59322228-59322250 GTCCCTTGGTGATGTCACCATGG + Intronic
1068804142 10:61175633-61175655 AGGCCTTGGTGTTCTCACAAGGG + Intergenic
1069852544 10:71419399-71419421 GGGCCTGGGTGTTGCCTCCAGGG - Intronic
1071727542 10:88215014-88215036 AGGCCTTGGTGTTCTCAGCCTGG - Intergenic
1072527238 10:96283566-96283588 GGGCCTTGGTTTTCTCCTCGTGG - Intergenic
1072702044 10:97649647-97649669 GAGGCTTGGTCTTGTCACCCAGG + Intronic
1072815381 10:98503184-98503206 GAGTCTTGCTGTTGTCACCCAGG - Intronic
1072993791 10:100224873-100224895 GGGTCTTGCTCTTGTCACCCAGG + Intronic
1075720183 10:124580742-124580764 GAGTCTTGCTGTTGTCACCCAGG + Intronic
1076538562 10:131198885-131198907 TGACCTTGGTGTTGTCCACGTGG - Intronic
1076697863 10:132255802-132255824 GGGCCATGGTGCTGGCACCCAGG - Intronic
1076700856 10:132271896-132271918 GAGCAGTGGTGTTGTCACTGAGG - Intronic
1083775273 11:64891537-64891559 GGTCCATGGTCTTTTCACCGAGG + Intergenic
1083843986 11:65320574-65320596 GCACTTTGGTCTTGTCACCGAGG - Exonic
1089546847 11:119234030-119234052 GAGTCTTGCTGTTGTCACCCAGG + Intronic
1089711068 11:120315127-120315149 GGGCCCTGGTGTTGACACCAGGG + Intronic
1090677724 11:129017419-129017441 GGGTCTTGCTCTTGTCACCTAGG - Intronic
1092243220 12:6848324-6848346 GGGTCTTGCTCTTGTCACCCAGG - Intronic
1093317451 12:17668483-17668505 GGGTCTTGCTCTTGTCACCTAGG + Intergenic
1094674291 12:32603726-32603748 GGGTCTTGCTCTTGTCACCCAGG + Intronic
1097335329 12:58376665-58376687 GAGCCTTGCTCTTGTCACCCAGG + Intergenic
1099951867 12:89312638-89312660 GGGTCTTGTTCTTGTCACCCAGG - Intergenic
1100481082 12:94979807-94979829 GGGTCTTGCTCTTGTCACCCAGG - Intronic
1103795624 12:123501080-123501102 GAGTCTTGCTGTTGTCACCCAGG - Intronic
1106740398 13:32635032-32635054 GGGCCTTACTCTTGTCACCTAGG + Intronic
1108208954 13:48119010-48119032 GGGTCTTGTTCTTGTCACCCAGG + Intergenic
1109296631 13:60541191-60541213 GAGCCTTGCTCTTGTCACCCAGG + Intronic
1111320786 13:86625177-86625199 GAGTCTTGCTGTTGTCACCTAGG - Intergenic
1113737851 13:112690614-112690636 GGGCCTCGGAGTTGACACCCTGG + Intronic
1116903972 14:50387495-50387517 GAGTCTTGGTCTTGTCACCCAGG - Intronic
1120882630 14:89426248-89426270 GGGTCTTGCTCTTGTCACCCAGG + Intronic
1121084255 14:91133267-91133289 GAGTCTTGCTGTTGTCACCCAGG - Intronic
1121344051 14:93122146-93122168 GAGTCTTGGTCTTGTCACCCAGG + Intergenic
1122138051 14:99645862-99645884 GCTCCTTTGTGTTGTCCCCGGGG + Intronic
1124249183 15:28096259-28096281 GGGGCTTGGTAGTGTCTCCGGGG + Intronic
1125935026 15:43627731-43627753 GGGTCTCGCTGTTGTCACCCAGG + Intergenic
1126145111 15:45466566-45466588 GAGTCTTGCTGTTGTCACCCAGG - Intergenic
1127555697 15:60085144-60085166 GGGCCTTGGTTTCCTCACCAGGG - Intergenic
1129376941 15:75139502-75139524 GAGCCTTGGTGCTCTCACTGGGG - Intergenic
1129499794 15:76024604-76024626 GGGCCTTGGAGTTGTTACTCTGG - Intronic
1132748854 16:1448132-1448154 GGGTCTTGGGGTTGGCACCCAGG - Intronic
1133810297 16:9156188-9156210 GGGTCTCGCTGTTGTCACCCAGG - Intergenic
1134419186 16:14070750-14070772 GGGCCTGGGGGCTGTCACTGAGG + Intergenic
1135504552 16:23025076-23025098 GGGCCTTGCTCTTGCCACCCCGG - Intergenic
1135518555 16:23156019-23156041 GGGTCTTGCTCTTGTCACCCAGG - Intergenic
1135661512 16:24301015-24301037 GAGCCTTGCTCTTGTCACCCAGG - Intronic
1136332771 16:29591982-29592004 GGGTCTTGCTGTGGTCACCCAGG - Intergenic
1136475284 16:30509148-30509170 GAGTCTTGCTGTTGTCACCCAGG - Intronic
1137072084 16:35912397-35912419 GGGCTTTGGTGCTGTCCCAGAGG - Intergenic
1137450461 16:48569416-48569438 GGGTCTTGCTCTTGTCACCTAGG + Intronic
1137555707 16:49469064-49469086 AGGCCTGGGTGTTGGCCCCGGGG - Intergenic
1138272344 16:55704273-55704295 GGGCCTTGGTTCTCTCACCTGGG - Intronic
1142263480 16:89053119-89053141 GGAGCTGGGTGTGGTCACCGTGG - Intergenic
1203113439 16_KI270728v1_random:1466922-1466944 GGGCCTTGGTTTTCTCATCCAGG + Intergenic
1142606762 17:1086118-1086140 GGGTCTTGCTCTTGTCACCCAGG - Intronic
1142883891 17:2900992-2901014 AGGCCTGGGTGCTGTCACAGGGG + Intronic
1143016100 17:3892120-3892142 GGGCCTTGGTGGTGTCCGCAGGG - Intronic
1145100770 17:20074926-20074948 GAGCCTTGCTGTTGTCACCCAGG + Intronic
1146305533 17:31727252-31727274 AGGCCTTGGTGATCTCACAGGGG + Intergenic
1146760023 17:35468988-35469010 GGGTCTTGCCCTTGTCACCGAGG - Intronic
1146883858 17:36457994-36458016 GGGCCTTGGGGCTGTCATGGGGG - Intergenic
1147372414 17:40002130-40002152 GAGCCTTGCTTTTGTCACCCAGG - Intergenic
1147998195 17:44372957-44372979 GGGTCTTTCTGTTGTCACCCAGG + Intronic
1148188081 17:45659158-45659180 GAGTCTTGCTGTTGTCACCAAGG + Intergenic
1151808151 17:76419650-76419672 GGGCCTTGTTCTTGTCAGCATGG - Intronic
1151853518 17:76706097-76706119 GGGCCTTTGTGATGGCAGCGTGG - Intronic
1151853537 17:76706202-76706224 GGGCCTTTGTGATGGCAGCGTGG - Intronic
1151881230 17:76896014-76896036 GGGCCTTGGTGTTGTCACCGTGG - Intronic
1152072900 17:78142885-78142907 GGGCCTCGGTGTGCTCACCCAGG + Exonic
1152158093 17:78648079-78648101 GGCCCTTGCTGCTGTCACCGTGG + Intergenic
1152897648 17:82922333-82922355 GGGTCTTGCTCTTGTCACCCAGG - Intronic
1154169206 18:12038617-12038639 GGGCCTTGGAGATGTGACCCAGG - Intergenic
1159692611 18:71508530-71508552 GAGCCTTGCTCTTGTCACCCAGG + Intergenic
1160345882 18:78131472-78131494 GGGCATTTTTGTTCTCACCGTGG - Intergenic
1160893669 19:1392907-1392929 GGGGCTGGGTGTTGGCACTGTGG + Intronic
1161039756 19:2103924-2103946 GTGCCTTGGTGTTGGCATCTGGG - Intronic
1161965227 19:7544135-7544157 GAGTCTTGCTGTTGTCACCCAGG + Intronic
1163512759 19:17745781-17745803 GGGTCTTGCTCTTGTCACCTAGG - Intergenic
1167085732 19:47308578-47308600 GAGTCTTGGTGTTGTCAGCCTGG + Intronic
1167551635 19:50165311-50165333 GGGTCTTGCTCTTGTCACCCAGG + Intergenic
1168280875 19:55304795-55304817 GGGGGGTGGTGTTGTCCCCGGGG - Exonic
1168394613 19:56037665-56037687 GGGTCTTGCTCTTGTCACCCAGG - Intronic
925444909 2:3919319-3919341 GGGCCTGGGTGATGGCACGGTGG + Intergenic
927644704 2:24870293-24870315 GAGTCTTGGTCTTGTCACCCAGG - Intronic
928081365 2:28315272-28315294 GGGCCTTGGCTTTCTCACAGAGG + Intronic
932042433 2:68315699-68315721 GGGTCTTACTCTTGTCACCGAGG + Intronic
935044063 2:99463648-99463670 GGGTCTTGCTGTTGTCGCCCAGG + Intronic
935169381 2:100599081-100599103 AGGGCTTTGTGTTGTCACAGTGG + Intergenic
936599496 2:113881898-113881920 GGGTCTTGCTCTTGTCACCCAGG + Intergenic
937423631 2:121779004-121779026 GGGCAGTGCTGTTGTCACCCTGG - Intergenic
940879816 2:158935416-158935438 GGCACTGGGTGCTGTCACCGAGG + Intergenic
941089080 2:161153659-161153681 GGGCCTCACTGTTGTCACCCAGG - Intronic
941241662 2:163046352-163046374 GAGTCTTGCTGTTGTCACCCAGG + Intergenic
947909344 2:233791148-233791170 GGGCCTTGGGGACGTCACCTCGG + Intronic
948663502 2:239520816-239520838 GGGCCATGGGGTTGCCACTGAGG + Intergenic
1169454842 20:5743449-5743471 GAGTCTTGCTGTTGTCACCCGGG + Intergenic
1172004051 20:31805208-31805230 GGGTTTTGCTGTTGTCACCCAGG + Intergenic
1172192512 20:33070556-33070578 GGGCCTCAGTGCTGTCACCATGG + Intronic
1172637179 20:36417808-36417830 GGGTTTTGCTGTTGTCACCCAGG + Intronic
1174587609 20:51621119-51621141 GGGCCTTGCTCTTATCACCCAGG - Intronic
1175093670 20:56524706-56524728 GGCCCTTGGTGATGTCACAGAGG - Exonic
1175094861 20:56533239-56533261 GGCCCTTGGTGATGTCACAGAGG - Exonic
1175111477 20:56651300-56651322 GAGTCTTGCTGTTGTCACCCAGG - Intergenic
1176084984 20:63291811-63291833 GAGTCTTGCTGTTGTCACCTGGG - Intergenic
1178424470 21:32468344-32468366 GGGTCTTGCTCTTGTCACCCAGG - Intronic
1179284989 21:39969646-39969668 GGGCCTCGTTGTTGGCACTGTGG + Intergenic
1179923157 21:44518400-44518422 TGGACTTGGTGTTATCACAGGGG + Intronic
1181950556 22:26550716-26550738 GGGAGTTGGTGTGGTCAGCGTGG - Intronic
1182251435 22:29004128-29004150 GGGCCTTGCTGTTGACAGCAGGG - Intronic
1183418221 22:37694991-37695013 GAGTCTTGCTGTTGTCACCCAGG - Intronic
1183550560 22:38480903-38480925 GGGTCTTGCTGTTGTCACCCAGG - Intronic
1183656760 22:39190302-39190324 GTGCTTTGGGGTTGACACCGTGG - Intergenic
1183983790 22:41558067-41558089 CTGCCTTGATGTTGTCACCTGGG - Intergenic
1184627692 22:45750126-45750148 GGGTCTTGCTTTTGTCACCCAGG + Intronic
1184854800 22:47140735-47140757 GGGCCTGGGGGTTGTCCCTGGGG + Intronic
1184921335 22:47607855-47607877 GGGTCTTGTTCTTGTCACCCAGG + Intergenic
1184933816 22:47704022-47704044 GAGTCTTGCTCTTGTCACCGAGG + Intergenic
1185250798 22:49800662-49800684 GGGCCCAGGTGCTGTCAACGGGG - Intronic
949797605 3:7868006-7868028 GGGTCTTGCTCTTGTCACCCAGG + Intergenic
949995067 3:9610189-9610211 GAGCCTTGCTCTTGTCACCCAGG + Intergenic
953461981 3:43088801-43088823 GGGGCTTGGAGATGTCACCAGGG - Intronic
953541000 3:43818084-43818106 GAGCCCTGGTGTTGTCCCCTTGG + Intergenic
954415473 3:50391287-50391309 AGGCCCTGGTGTTGGCACTGAGG + Intronic
961451611 3:127004747-127004769 GGGCCATGGTGGTCTCACAGTGG + Intronic
961644891 3:128387696-128387718 GGGTCTTGGTGGTGCCACAGGGG - Intronic
963199623 3:142572741-142572763 GGGGTCTGGTTTTGTCACCGAGG - Intronic
965160191 3:165123341-165123363 CAGGCTTGGTGATGTCACCGAGG - Intergenic
968549672 4:1215707-1215729 AGCCCTTGCTGTTGTCACAGTGG - Intronic
969290172 4:6233773-6233795 GGCCCTTGGTTTCGTCAGCGCGG - Intergenic
970747755 4:19320064-19320086 GAGTCTTGCTGTTGTCACCCAGG + Intergenic
972283165 4:37622828-37622850 GAGTCTTGCTGTTGTCACCCCGG + Intronic
974525771 4:63048047-63048069 GGGCCTTGGTGGTGTCCACTTGG - Intergenic
976425639 4:84900020-84900042 GGGTCTTGGCTTTGTCACCCAGG - Intronic
978794663 4:112697156-112697178 GAGCCTTGCTCTTGTCACCCAGG - Intergenic
979366059 4:119824884-119824906 GGGCTTGGGTGATGTCACCATGG - Intergenic
982800306 4:159697751-159697773 TGGCCTTGTTGTGGTCACTGTGG + Intergenic
982945371 4:161616110-161616132 GGGTTTTGCTCTTGTCACCGAGG + Intronic
983650418 4:170031425-170031447 GGGCTTTGGTGTGGTCTCAGAGG - Intronic
985487708 5:161162-161184 GAACCTTGGTCTTGTCACCAGGG + Intronic
985701846 5:1378196-1378218 GGGCCCGTGTGTTCTCACCGAGG - Intergenic
989002640 5:36776927-36776949 GGGTCTTGCTCTTGTCACCCAGG - Intergenic
989168372 5:38452060-38452082 GGGTCTTGCTGTTGTCGCCCAGG + Intronic
992708315 5:79421629-79421651 GGGCCTTGCTCTTGTCGCCCAGG + Intronic
992764061 5:79978562-79978584 GAGTCTTGGTCTTGTCACCCAGG - Intronic
993484912 5:88471921-88471943 GAGACTTGGTGTTGTCATCCAGG + Intergenic
996205573 5:120731374-120731396 GGGGATTGCTGTTGTCACAGTGG + Intergenic
997084548 5:130783019-130783041 GAGTCTTGCTCTTGTCACCGAGG - Intergenic
997934861 5:138101487-138101509 GAGCCTTGCTCTTGTCACCTAGG - Intergenic
997956145 5:138280103-138280125 GAGTCTTGCTGTTGTCACCCAGG + Intergenic
1000439617 5:161250052-161250074 GGGCCTTGGGGTTGGGACTGAGG - Intergenic
1001580108 5:172792446-172792468 GGGCCTTGCTCTTGTCACCAAGG + Intergenic
1008092905 6:47309964-47309986 GGCCCTTTGTGATGTCACCCGGG + Intergenic
1008194370 6:48500012-48500034 GGGCCTTGCTGTTATCAGCTGGG - Intergenic
1008803291 6:55396903-55396925 GAGTCTTGGTGTTTTCACCCAGG + Intronic
1010308205 6:74349752-74349774 GAGCCTTGCTCTTGTCACCCAGG + Intergenic
1013506321 6:110803937-110803959 GGGTCTTGCTCTTGTCACCCAGG - Intronic
1014746088 6:125202789-125202811 GAGCCTTGCTCTTGTCACCCAGG + Intronic
1016942542 6:149494978-149495000 GGGTCTTGCTCTTGTCACCCAGG - Intergenic
1017674245 6:156797185-156797207 GGGACTAGGTTTTGTCACTGTGG - Intronic
1018237670 6:161741993-161742015 GAGTCTTGCTCTTGTCACCGAGG + Intronic
1019621738 7:1995811-1995833 GGGGCTTGCTGCTGGCACCGGGG - Intronic
1020286150 7:6682677-6682699 GGGCCATGGTGATGTCCCTGGGG - Intergenic
1023916787 7:44595946-44595968 GGGCCTCGCTTTTGTCACCCAGG - Intergenic
1024095605 7:45980202-45980224 GGGCCTTGGGGATGTGCCCGAGG - Intergenic
1025724625 7:64045529-64045551 GGGCTATGGTGGAGTCACCGAGG - Intronic
1027550267 7:79584469-79584491 GAGTCTTGCTGTTGTCACCCAGG + Intergenic
1029271838 7:99381731-99381753 GGGGCTTTGTGTTGTGACCTCGG + Intronic
1029491736 7:100874469-100874491 GGGCCTTGGTGTTACTCCCGGGG + Intergenic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1030943185 7:115681263-115681285 GGGCCTTGGTTTTGTCTCCCTGG - Intergenic
1031413433 7:121467336-121467358 GGGTCTTGCTCTTGTCACCCAGG - Intergenic
1031922897 7:127614457-127614479 GGGTCTTGGAGTTGTCCCCAGGG - Intronic
1032026898 7:128450050-128450072 GAGTCTTGGTCTTGTCACCCAGG - Intergenic
1034637418 7:152578293-152578315 GAGTTTTGGTGTTGTCACCCAGG + Intergenic
1035191294 7:157171149-157171171 GAGCCTTGCTCTTGTCACCTAGG + Intronic
1041109758 8:54473152-54473174 GAGCCTTGATATTGTCACCTGGG - Intergenic
1041948978 8:63478862-63478884 GGAGCTGGGTGTTGTCACTGGGG + Intergenic
1042392208 8:68248977-68248999 GAGCCTTGCTCTTGTCACCCAGG + Intergenic
1042407372 8:68421642-68421664 AGGCCTTGCTGTTGCCACTGTGG - Intronic
1044691929 8:94889120-94889142 GAGCCTCGCTGTTGTCACCCAGG - Intronic
1045003919 8:97901023-97901045 GGGACTTGGTGGGGTCACCGGGG + Intronic
1045441752 8:102220463-102220485 GGGTCTTGCTCTTGTCACCCAGG + Intronic
1047604983 8:126465827-126465849 GAGTCTTGCTGTTGTCACCCAGG - Intergenic
1047954809 8:129965875-129965897 GAGTCTTGCTCTTGTCACCGAGG + Intronic
1048203895 8:132400526-132400548 AGGCCCTGGTGATGCCACCGCGG + Intronic
1048339563 8:133528245-133528267 GGGGCTTGGTGTGGTCTCTGGGG - Intronic
1048474397 8:134730230-134730252 GGGCCTTTGCCTTGTCACTGGGG - Intergenic
1050558620 9:6810843-6810865 GGGTCTTGCTCTTGTCACCCAGG - Intronic
1051642309 9:19234985-19235007 GAGTCTTGCTCTTGTCACCGAGG + Intronic
1051654929 9:19370426-19370448 GGGTTTTGCTGTTGTCACCCAGG - Intronic
1055606165 9:77972925-77972947 GAGTCTTGCTGTTGTCACCCAGG - Intronic
1056685563 9:88756237-88756259 GGGTCTTGGTTCTGTCACCCAGG + Intergenic
1056709265 9:88977463-88977485 GGGCAGTGGTGTAGGCACCGAGG + Intergenic
1057026704 9:91739478-91739500 GGGTCTTGCTCTTGTCACCCAGG - Intronic
1057196173 9:93116539-93116561 GGGGCATGCTGTTGTCACCACGG + Intergenic
1058464667 9:105215547-105215569 GAGTCTTGGTCTTGTCACCCAGG - Intergenic
1058627410 9:106949523-106949545 GGGCTATGGTGTTGCCACTGGGG - Intronic
1060509936 9:124224416-124224438 GGGCCTTGCTCTTGTCACCCAGG + Intergenic
1060706321 9:125804919-125804941 GAGCCTTGCTCTTGTCACCCAGG - Intronic
1060981016 9:127791947-127791969 GAGTCTTGCTGTTGTCACCCAGG - Intergenic
1061322642 9:129840794-129840816 GGGTCTTGCTCTTGTCACCCAGG + Intronic
1061350702 9:130062385-130062407 GGGTCTTGCTCTTGTCACCCAGG - Intronic
1061454785 9:130689544-130689566 GAGACTTGGTCTTGTCACCCAGG - Intergenic
1062237257 9:135516155-135516177 TGCCCTTGGTGTTGGCCCCGGGG + Intergenic
1062613955 9:137387703-137387725 GGGGCTTGGAGCTGACACCGAGG + Intronic
1192153176 X:68724437-68724459 GGGCCTGGGTGGTGCCACCCTGG - Exonic
1198388243 X:136148025-136148047 GGGCCCTGGTTTTGTCACCAAGG + Intronic
1198422599 X:136482432-136482454 GGGTCTTGCTGTTGTTACCCAGG + Intergenic
1201382762 Y:13401843-13401865 GAGTCTTGGTTTTGTCACCCTGG - Intronic
1201510590 Y:14756717-14756739 GAGTCTTGCTGTTGTCACCTGGG - Intronic
1202115260 Y:21465656-21465678 GGGCCTCGGTGGTGTCTCAGTGG - Intergenic