ID: 1151886304

View in Genome Browser
Species Human (GRCh38)
Location 17:76925120-76925142
Sequence GGCACGTGGCCCACATGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151886292_1151886304 15 Left 1151886292 17:76925082-76925104 CCTTCAAGAAGTACCGGTGAGAG 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1151886304 17:76925120-76925142 GGCACGTGGCCCACATGCCAGGG 0: 1
1: 0
2: 0
3: 25
4: 161
1151886297_1151886304 2 Left 1151886297 17:76925095-76925117 CCGGTGAGAGGGCGGCCAGAGGG 0: 1
1: 1
2: 3
3: 35
4: 298
Right 1151886304 17:76925120-76925142 GGCACGTGGCCCACATGCCAGGG 0: 1
1: 0
2: 0
3: 25
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151886304 Original CRISPR GGCACGTGGCCCACATGCCA GGG Intronic
900140296 1:1136962-1136984 GGCAGGTGGCCCAGAGGCCCAGG - Intergenic
903311269 1:22458439-22458461 GGCCAGTGGGCCACATTCCAAGG + Intronic
905349978 1:37338790-37338812 GGCATGGGGCCAGCATGCCAGGG + Intergenic
905602919 1:39269475-39269497 GGCACTTGACCCACATGGGAAGG - Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
905951791 1:41958189-41958211 GTCACGTGGCCCAAATGGCAAGG - Intronic
907524289 1:55045172-55045194 GGCACGAGCCCCACAGGCCAGGG + Intronic
910121944 1:83799735-83799757 GGCACGTGGCCCACTTAGAATGG - Intergenic
912933968 1:113986781-113986803 CACATGTGGCCCACAGGCCAGGG + Intergenic
915512551 1:156394308-156394330 GGCTCTTGGCCCAGTTGCCAAGG + Intergenic
919781071 1:201221593-201221615 GGCACGGTGCCCACATGGCACGG - Exonic
920032626 1:203046378-203046400 GGCCCCTGGCCCACTTGCCTTGG - Intronic
920279205 1:204830116-204830138 CGCACTAGGCCCTCATGCCAGGG - Intronic
920612385 1:207454412-207454434 GGCCCGCGGCGCCCATGCCACGG - Exonic
922436000 1:225607318-225607340 CACATGTGGCCCACAGGCCATGG + Intronic
924942206 1:248819804-248819826 TGCATGCGGCCCACAGGCCACGG + Intronic
1063135587 10:3213617-3213639 TGCACGTGGCCTGCATGCCTGGG + Intergenic
1068015889 10:51515987-51516009 GGCAGCTGCCCCACATGACAAGG - Intronic
1070824601 10:79384007-79384029 GGCACCTGGCCTGCATGGCAGGG + Exonic
1070917359 10:80163493-80163515 GGCTCGGGGCCCCCAAGCCATGG - Intronic
1072938645 10:99737721-99737743 TGCCCATAGCCCACATGCCATGG + Intronic
1073639942 10:105241481-105241503 GGCAGCTGCCCCACATGACAAGG - Intronic
1074098923 10:110338078-110338100 GGCACAGGGCCCAGATGCAAGGG - Intergenic
1076109218 10:127848499-127848521 CGCACGTGGCCTCCATGACAAGG + Intergenic
1076387161 10:130065496-130065518 GGCTTGTGGCGCACATGGCAGGG + Intergenic
1076623289 10:131806626-131806648 GGCAATTTGCCCACAGGCCAAGG + Intergenic
1077355302 11:2114131-2114153 GGCAGCTGGCCCACGTCCCATGG + Intergenic
1077401170 11:2358331-2358353 GCCACGTGGGCCACATGACCCGG + Intergenic
1080816139 11:35759315-35759337 GTCACGTAGTTCACATGCCATGG + Intronic
1080983542 11:37434657-37434679 GTCACGTAGTTCACATGCCATGG + Intergenic
1081643514 11:44774406-44774428 GGCAGGTGGCCCACAGGCCTGGG + Intronic
1084576627 11:69992820-69992842 AGCACTGGGCACACATGCCAGGG + Intergenic
1088202797 11:107358433-107358455 CACATGTGGCCCACAAGCCATGG + Intronic
1092409459 12:8242836-8242858 GCCCCGCCGCCCACATGCCAGGG + Intergenic
1094112728 12:26878775-26878797 GCCATCTGGCCCACTTGCCAGGG - Intergenic
1098277674 12:68829981-68830003 GGCATATGGCCCACAGGCCATGG - Intronic
1099031884 12:77536251-77536273 TGCACGTGGCCCACAGACCATGG - Intergenic
1102804946 12:115771414-115771436 GGCACATGTCACAGATGCCATGG - Intergenic
1103338544 12:120208726-120208748 CGCATGTGGCCCACAGGCCATGG - Intergenic
1103705195 12:122867515-122867537 GGAAACTGGCCCACATGCGACGG - Exonic
1104974332 12:132545727-132545749 GGCAGGTGGCCCCCAGGCCACGG + Intronic
1104998399 12:132673486-132673508 GGGATGTGGCTCACATGCCTGGG + Intronic
1108120413 13:47179639-47179661 GTCATATGGCCTACATGCCAGGG + Intergenic
1110236667 13:73223989-73224011 GGCCCGTGGCTCATATTCCATGG + Intergenic
1117804638 14:59478997-59479019 TGCATGTGGCTCACAGGCCACGG + Intronic
1119276628 14:73362667-73362689 GTCAAGTGACCCACATGCCTCGG + Intronic
1121281858 14:92704880-92704902 GGAAAGAGGCACACATGCCAGGG + Intronic
1121855995 14:97270762-97270784 GGGAGGTGGGCCACATGTCAAGG + Intergenic
1128134388 15:65252053-65252075 TGCACCCGGCCCACATGCCTAGG + Intronic
1128234912 15:66060629-66060651 GGCACTTGGCCCCCCCGCCATGG + Intronic
1129461568 15:75702533-75702555 GGCCCATGGCCCTCATGCCCTGG - Intronic
1133034187 16:3025856-3025878 GGCACTTGGCCCTCATGGGACGG + Intronic
1135334050 16:21586065-21586087 CGCATGTGGCCCACAGGCCATGG - Intergenic
1135830020 16:25764779-25764801 TGCAAGTGGCCCATATGGCAGGG - Intronic
1136187370 16:28596208-28596230 GGCGCGGGGCCCAGATGTCAGGG + Exonic
1137897804 16:52233008-52233030 GGCAATGGGCCCAGATGCCAAGG - Intergenic
1139470295 16:67174680-67174702 GGCTCGGGGACCACATGCCCCGG + Exonic
1140912778 16:79468686-79468708 GTAACGTGGCCCCCATGCCTGGG + Intergenic
1141623157 16:85247782-85247804 GGCACATGGGGGACATGCCAGGG + Intergenic
1144469579 17:15525728-15525750 GGCACGAGACCCACATACAAAGG + Intronic
1144790560 17:17856244-17856266 GGCCTCTGGCCCACATGTCAGGG - Intronic
1144926775 17:18817923-18817945 GGCACGAGACCCACATACAAAGG - Intergenic
1145213561 17:21034614-21034636 GGCAGGTGGCCTAGATGGCACGG - Intronic
1145998638 17:29118468-29118490 GGCACTTGGTCCCCATGCCAAGG + Intronic
1146506553 17:33410616-33410638 GGCACGAGGGCCTCATGGCAAGG - Intronic
1151886304 17:76925120-76925142 GGCACGTGGCCCACATGCCAGGG + Intronic
1152475004 17:80512279-80512301 GGGACCTGGACCACCTGCCATGG + Intergenic
1152624922 17:81383774-81383796 GGCAAGTGGCCCCCAGCCCACGG + Intergenic
1154019617 18:10651272-10651294 GTCACGTGGTTCTCATGCCATGG - Intergenic
1155229432 18:23758374-23758396 TGCACTTCGCCCACATGCCCAGG + Exonic
1160321963 18:77905131-77905153 GGGAGGTGGCCCACCAGCCAGGG + Intergenic
1161519440 19:4715543-4715565 GGCACGTGGCAGGCATTCCACGG + Intronic
1162116204 19:8430939-8430961 GCCCCGTGCCCCACAAGCCAGGG - Intronic
1162805933 19:13138102-13138124 GTCACCTGGCCCCCGTGCCAAGG + Intronic
1166095373 19:40535343-40535365 GTCACGTGGGCCAGATACCATGG - Intronic
1167147539 19:47692063-47692085 GGGAGGTGGCCCACATGCAGCGG - Intronic
1168072424 19:53960437-53960459 GGCACTAGGCCCAGTTGCCATGG + Intergenic
926376245 2:12230873-12230895 CGCATGTGGCCCACAGGCCATGG + Intergenic
930027834 2:47040203-47040225 GCCACGTGGCACACAGGCCCTGG - Intronic
935699597 2:105800182-105800204 GGCACGGGGGCCACATGCCCAGG + Intronic
942549324 2:177098151-177098173 TGCATGTGGCCCACAGACCACGG + Intergenic
943356012 2:186856822-186856844 TGCATGTGGCCCATAGGCCATGG + Intergenic
944852834 2:203737303-203737325 GGCAAGTGGCACACGTGCCAGGG - Exonic
944908436 2:204285718-204285740 TGCATGTGGCCCACGGGCCATGG - Intergenic
946441832 2:219703439-219703461 TGCACGAAGCCCAGATGCCAAGG - Intergenic
947533040 2:230924810-230924832 GGCACGTGAGCTACATGCCCCGG + Intronic
948829662 2:240592155-240592177 GGCACGTGGCCAGCATGGGAGGG + Intronic
1170903068 20:20484961-20484983 CGCATGTGGCCCACAGGCCATGG - Intronic
1171066296 20:22018620-22018642 GGGAAGAGGCCCACATCCCATGG + Intergenic
1171186863 20:23129068-23129090 GGCACGTGGACCAGAAGCCGTGG - Intergenic
1172405681 20:34687212-34687234 GGCACTTGGCCCAGAAACCAGGG + Intergenic
1173609245 20:44354856-44354878 GGCAGGTGTCTAACATGCCAGGG + Intergenic
1174230103 20:49039511-49039533 GGAATGTGGCCCAAAGGCCAAGG - Intergenic
1174457475 20:50659874-50659896 GGCACGTGACCCACATGGTCTGG + Intronic
1175442578 20:59002000-59002022 GGGGTGTGGCCCACTTGCCATGG - Intronic
1175955901 20:62609299-62609321 GGCACGTGGCCACCGTGCCTGGG + Intergenic
1176234450 20:64047967-64047989 GGCAGGTGGCCCAGAAGCCCAGG + Exonic
1176314361 21:5228007-5228029 CACACGTTGCCCACAGGCCATGG - Intergenic
1180176744 21:46094221-46094243 GTCACGTGGCCCAGATGGCAGGG + Intergenic
1181169207 22:20998787-20998809 TGCACCTGGCCCACATGGCTGGG - Exonic
1183270506 22:36859721-36859743 GGAACGTGGCCAACAGCCCATGG - Intergenic
1183276732 22:36903002-36903024 TGCAGGTGGCCCACAGGCCAAGG - Intergenic
1183381677 22:37493346-37493368 GGGCCGTGGGGCACATGCCAGGG - Intronic
1185181740 22:49367517-49367539 GGCAGGTGGGCCAGATCCCAGGG - Intergenic
953668298 3:44941850-44941872 TGCAAGTGGCACACAGGCCATGG + Intronic
955604015 3:60680074-60680096 CTCCCATGGCCCACATGCCAAGG - Intronic
957970823 3:87379877-87379899 TGCATGTGGCCCACAGGCCGCGG + Intergenic
959664185 3:108903383-108903405 GACACTTGGCCCACATATCATGG + Intergenic
959924186 3:111903442-111903464 GGCAGGTGGACCACAGGGCAGGG + Intronic
962463086 3:135632366-135632388 GCCACGTGGAGCACATGCCTGGG - Intergenic
962950424 3:140213529-140213551 AGCACATGGCCCACAGGCCTGGG + Intronic
963534884 3:146514775-146514797 GGCAGCTGTCCCACATGACAAGG + Intergenic
969608515 4:8214230-8214252 CTCACGTGGCCCCCATGCCCTGG - Intronic
969621637 4:8281684-8281706 GGCACGGGGCCCACAGCCCTCGG - Intronic
969748207 4:9090489-9090511 GGCCAGTGGCACACATGCCATGG + Intergenic
969787897 4:9473602-9473624 GGCACCCGGCCCCCCTGCCATGG - Intergenic
969787924 4:9473686-9473708 GGCGCCCGGCCCCCATGCCACGG - Intergenic
975025899 4:69548942-69548964 GGCAGCTGCCCCACATGACAAGG + Intergenic
979533441 4:121793440-121793462 GTCAGGGGGCCCACATGACAAGG - Intergenic
981342054 4:143632892-143632914 TGCATGTAGCCCACAGGCCATGG + Intronic
983849974 4:172568817-172568839 TGCATGTGGCCCACAGGTCATGG - Intronic
983930039 4:173443434-173443456 GGCAGGTGAGCAACATGCCAAGG - Intergenic
985281024 4:188285390-188285412 GGCATGCGGCCCACGGGCCATGG - Intergenic
985501637 5:251435-251457 GTCACGGGGCGCGCATGCCAGGG + Exonic
986190985 5:5495667-5495689 GGCACCTCTCCCACCTGCCAAGG + Intergenic
986191221 5:5497840-5497862 GGCACCTCTCCCACCTGCCAAGG + Intergenic
989217271 5:38918271-38918293 GGCTGGTGGTACACATGCCAGGG + Intronic
990781630 5:59370957-59370979 GCCATGTAGCCCACAAGCCACGG - Intronic
994509358 5:100684307-100684329 GCCACATGGGTCACATGCCAGGG + Intergenic
995633686 5:114161817-114161839 GTCACGTGGTTCTCATGCCATGG + Intergenic
997214373 5:132098154-132098176 CGCATGTGGCCCACAGGCCGTGG + Intergenic
1002065152 5:176648042-176648064 GGCACGCATCCCACATCCCAGGG - Intronic
1006797910 6:36742813-36742835 GGCACGTGCCCCAGAAGTCAGGG - Intronic
1007317415 6:41000409-41000431 GTCACGTGGCCCAGATGAGAGGG - Intergenic
1007715022 6:43850889-43850911 GACACGAGGCCCCCATGCCCAGG - Intergenic
1007734761 6:43973594-43973616 AGCATGTGGCCCACAGGCCTAGG - Intergenic
1008827535 6:55715656-55715678 TGCATGTGGCCCACGGGCCATGG - Intergenic
1010629186 6:78176537-78176559 TGCATGTGGCCCACAGGCCATGG + Intergenic
1013739886 6:113270105-113270127 TGCATGTGGCCCACAGGCCATGG - Intergenic
1017508263 6:155088710-155088732 CGCAGGTGGCCCACAGGCCATGG - Intronic
1018496163 6:164347612-164347634 TTCACGTGGCCAACAGGCCAGGG + Intergenic
1020324799 7:6966158-6966180 AGCCAGTGGCACACATGCCATGG - Intergenic
1023721151 7:43096117-43096139 TGCATGGGGCCCACAGGCCATGG + Intergenic
1023865162 7:44234961-44234983 TGCATGTGGCCCAGAAGCCAAGG - Intronic
1024248621 7:47489557-47489579 GGCCCATGGCCCACAAGGCAGGG + Intronic
1030647615 7:112081034-112081056 GCCAAGTAGCCCACAGGCCACGG + Intronic
1032804375 7:135340200-135340222 GGCAAGATGCCCACATGCCTGGG + Intergenic
1033156067 7:138958166-138958188 GGCATGTGACCCACATGCGCGGG + Intronic
1036038084 8:5042152-5042174 TGCAGGTGTGCCACATGCCACGG - Intergenic
1037630679 8:20652972-20652994 GTCAAGTGGCCACCATGCCATGG - Intergenic
1039473869 8:37829220-37829242 GCCACGTGGCCAACATGCTGAGG + Intronic
1039479059 8:37858354-37858376 TGCACGTGGTCCACACTCCAAGG - Intergenic
1039555419 8:38471761-38471783 AGCAAGTGGCCAACTTGCCAGGG + Intergenic
1041644731 8:60239576-60239598 TGCATGTGGCCCACAGGCCATGG + Intronic
1044367415 8:91365396-91365418 GGCATGTGGCTCACAGGCCATGG + Intronic
1044915310 8:97107343-97107365 GGCCTGAGGCCCACATGCCTTGG + Intronic
1045050234 8:98317948-98317970 TGCATGTGGCCCGCAGGCCACGG + Intergenic
1045164844 8:99592129-99592151 GTCACGTAGCTCTCATGCCATGG + Intronic
1045367026 8:101485717-101485739 CACATGTGGCCCACAGGCCAAGG - Intergenic
1045733236 8:105266155-105266177 CACATGTGGCCCACAGGCCATGG - Intronic
1046006414 8:108491556-108491578 GGCACGAGCCCCCCATGCCTAGG - Intergenic
1049172365 8:141169500-141169522 GGGACGTGGGACAAATGCCAGGG + Intronic
1049345032 8:142134180-142134202 GGAAGGTGGCCCTCATGGCAAGG + Intergenic
1049754549 8:144304022-144304044 TGCACGTGGCCAAGAAGCCAGGG - Intronic
1051699260 9:19802129-19802151 GGCAGGTGGCCCATATATCAGGG - Intergenic
1054761350 9:69006978-69007000 GGGACGTTGCCCACATTCCCAGG - Intronic
1055316228 9:75037221-75037243 GGCCCGTGGCCCACATGGGAAGG - Intergenic
1058647012 9:107140170-107140192 GGCACGTGGCCACCCTGCCATGG - Intergenic
1060186516 9:121567170-121567192 GGCTGGGGGCCCACACGCCATGG + Exonic
1060297838 9:122355254-122355276 GGCTCCTGGCCCCCAGGCCAAGG - Intergenic
1061677632 9:132227432-132227454 GGCAGGTGGCCCCCATGGGATGG + Intronic
1062101934 9:134733025-134733047 GGCACTTGGACAACATGGCAGGG - Intronic
1062384490 9:136303790-136303812 GGCACGCCGCCCACCTGCCTGGG - Exonic
1062506098 9:136877429-136877451 TGCAGGTGACCCACATGCCTTGG + Intronic
1062609599 9:137368122-137368144 GCCACGTGGCCCTCAGGCCGAGG + Intronic
1062700582 9:137899808-137899830 GGCACCTGACCCACCTGCCCCGG + Intronic
1203453221 Un_GL000219v1:140391-140413 CACATGTGGCCCACAGGCCATGG - Intergenic
1186487916 X:9947858-9947880 GGCATGAGGGCCACATTCCATGG + Exonic
1190393295 X:49954257-49954279 TGCACGTGACCCACAGGCCGCGG - Intronic
1192245706 X:69369885-69369907 TGCATGTGGCCCACAGGCCACGG - Intergenic
1193534852 X:82701336-82701358 GGCACGTGCACAACATACCACGG + Intergenic
1197493957 X:127154163-127154185 GGGACGTGGCCTAAAAGCCATGG - Intergenic
1197869808 X:131054135-131054157 TGCATGTGGCCCACGGGCCATGG + Intergenic
1198093073 X:133351042-133351064 GGCATGTGGCCCAGGTGCTAGGG - Intronic
1198687995 X:139248332-139248354 CGCATGTGGCCCACAGGCCGTGG - Intergenic
1200133177 X:153862442-153862464 GGCAGATCTCCCACATGCCAGGG - Exonic
1201149064 Y:11085475-11085497 GGCAAATGGCCCAGATGCCTAGG + Intergenic