ID: 1151887146

View in Genome Browser
Species Human (GRCh38)
Location 17:76929800-76929822
Sequence CATTAAGCCAAGAGCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151887146_1151887153 28 Left 1151887146 17:76929800-76929822 CCCCAGGAGCTCTTGGCTTAATG 0: 1
1: 0
2: 1
3: 8
4: 142
Right 1151887153 17:76929851-76929873 CTTCCCTGTCCCTCTCTGACTGG 0: 1
1: 0
2: 2
3: 44
4: 397
1151887146_1151887150 -3 Left 1151887146 17:76929800-76929822 CCCCAGGAGCTCTTGGCTTAATG 0: 1
1: 0
2: 1
3: 8
4: 142
Right 1151887150 17:76929820-76929842 ATGGTCCCTGTTATTTTAATTGG 0: 1
1: 0
2: 0
3: 16
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151887146 Original CRISPR CATTAAGCCAAGAGCTCCTG GGG (reversed) Intronic
900830383 1:4961100-4961122 CCAGCAGCCAAGAGCTCCTGAGG + Intergenic
901203454 1:7479833-7479855 CACATAGCCAAGTGCTCCTGTGG + Intronic
901736529 1:11316104-11316126 CACTAAGCCTAGAGCTCCTGGGG + Intergenic
904862617 1:33550141-33550163 CATTGAGGAAAGAGCTCCAGTGG - Intronic
905812223 1:40921102-40921124 CATTCAGACAAGAGGTCCAGTGG - Intergenic
905847740 1:41246829-41246851 CATTGAGCCCAGAGATACTGGGG + Intergenic
908010247 1:59769055-59769077 CATGAAGCCCTGAGCACCTGGGG + Intergenic
910441354 1:87255710-87255732 GATGAAGCCAAGAGCTCAGGGGG + Intergenic
911697259 1:100904714-100904736 CATGAAGAAAAGAGCTTCTGTGG - Intronic
913503625 1:119495687-119495709 CATTCAACCAAGAGTTCCAGAGG - Intergenic
914003647 1:143714148-143714170 GTTAAAGCCAAGAGCTCCTATGG + Intergenic
914005217 1:143727099-143727121 GTTAAAGCCAAGAGCTCCTATGG + Intergenic
914094876 1:144536566-144536588 GTTAAAGCCAAGAGCTCCTATGG + Intergenic
914097696 1:144558320-144558342 GTTAAAGCCAAGAGCTCCTATGG + Intergenic
914301297 1:146379297-146379319 GTTAAAGCCAAGAGCTCCTATGG - Intergenic
914303647 1:146397332-146397354 GTTAAAGCCAAGAGCTCCTATGG - Intergenic
914516094 1:148375844-148375866 GTTAAAGCCAAGAGCTCCTATGG + Intergenic
922416008 1:225423895-225423917 TATTAAGGTAAGAGCTCCTTTGG - Exonic
923109025 1:230876371-230876393 CATTGAGCCCACTGCTCCTGTGG + Intergenic
923755721 1:236789483-236789505 CATGTCGACAAGAGCTCCTGAGG - Intergenic
1063567102 10:7180562-7180584 CTTTAACCCCAGAGCTGCTGCGG + Intronic
1070713893 10:78703455-78703477 CATGAAGCCAAGAGCAAATGTGG - Intergenic
1073446196 10:103582067-103582089 CAATCAGTCCAGAGCTCCTGGGG - Intronic
1076729542 10:132431491-132431513 CATTCTGCCATCAGCTCCTGTGG + Intergenic
1079157224 11:17959318-17959340 CATTAAAGCATGAGCTCCTTAGG + Intronic
1079195393 11:18322374-18322396 CATTTGGCCTAGAGCTCCTCCGG - Intronic
1079968787 11:27010276-27010298 CATTTAGCTAAGAGCTCTTTTGG - Intergenic
1080253088 11:30257905-30257927 CATGAAGCCAAGAACCCATGTGG + Intergenic
1083200951 11:61120771-61120793 CATCAGGCCAAGAGCCCCTTGGG - Intronic
1083471306 11:62885947-62885969 CACTAAACTATGAGCTCCTGAGG - Intronic
1083847796 11:65346096-65346118 CAGCAAGCCAAGAGCCCCTTGGG - Intronic
1084446856 11:69208847-69208869 CATTCAACCAGCAGCTCCTGAGG - Intergenic
1085688803 11:78649336-78649358 CATGAAGCCAAAATTTCCTGGGG - Intergenic
1087668471 11:101077921-101077943 CTTTAAGGCAAGATCTACTGTGG - Intronic
1090305161 11:125685015-125685037 CCTGAAGCCAACAGTTCCTGTGG - Intergenic
1091189429 11:133678388-133678410 CTTTAATCCTAGAACTCCTGTGG - Intergenic
1094252747 12:28384017-28384039 AATTAAGCCAAGAGCCATTGGGG + Intronic
1095971706 12:47905818-47905840 CTTTAAGCCAAAATTTCCTGTGG - Intronic
1096194136 12:49637996-49638018 TATTAGACCATGAGCTCCTGTGG - Exonic
1098702227 12:73644198-73644220 CATTCAACCTAGAGCTCCTCAGG + Intergenic
1100878071 12:98984166-98984188 CCTTAAGCCCAGAGGTCCTCTGG + Intronic
1101284069 12:103291384-103291406 CATGAAGCCAACAACTGCTGTGG - Intronic
1102426430 12:112847861-112847883 CATTCACCCCAGAGCTGCTGTGG + Intronic
1106212507 13:27663323-27663345 CAGTAAACCAAGATCTCCTCAGG + Intronic
1108441328 13:50456273-50456295 CATAAAGCCAAGAGCCACAGTGG - Intronic
1112838137 13:103542286-103542308 TATTAAACCATGAGCTCCAGTGG - Intergenic
1119704866 14:76777172-76777194 CCCTAGGCCAAGATCTCCTGGGG + Intronic
1120000181 14:79294034-79294056 TCTTCAGCCAAGAGCTCCTTGGG - Intronic
1121423584 14:93832699-93832721 TATTAAGCCAGCAGGTCCTGTGG - Intergenic
1128781679 15:70362607-70362629 CCTGAAGCCAGGAGATCCTGAGG + Intergenic
1129453999 15:75666902-75666924 CATTTAGCCATCAGCTGCTGTGG - Intergenic
1132671730 16:1104732-1104754 CATTCAGCCCTGAGCTCCCGGGG - Intergenic
1132743136 16:1425942-1425964 CTTGATGCCAAGAGTTCCTGGGG - Intergenic
1132995057 16:2818421-2818443 CATTGAGCCAAGGCCTCCAGGGG - Intronic
1133282854 16:4676984-4677006 CCTGCAGCCAAGAGCTCCTCTGG + Intronic
1133797206 16:9055840-9055862 CACTCAGCCAACATCTCCTGTGG + Intergenic
1133851468 16:9508279-9508301 CAATAAGTCATGAGGTCCTGGGG - Intergenic
1137003278 16:35250502-35250524 CATGAAGGCCATAGCTCCTGAGG + Intergenic
1137501602 16:49015452-49015474 CATCAAGCGAAGGGCTGCTGAGG - Intergenic
1137512181 16:49111096-49111118 CATCAAACCAACAGCTCCTTAGG + Intergenic
1139119574 16:63999032-63999054 CATGTAGCCAGGACCTCCTGAGG + Intergenic
1146473680 17:33144734-33144756 CACTGAGCCCAGAGCTCATGAGG + Intronic
1151887146 17:76929800-76929822 CATTAAGCCAAGAGCTCCTGGGG - Intronic
1152558856 17:81067935-81067957 CCTCAAGCCAGGAGCTGCTGAGG + Intronic
1153773213 18:8431990-8432012 CTGGTAGCCAAGAGCTCCTGGGG - Intergenic
1160792466 19:929005-929027 CAATAATCCAAGATCTCCTGGGG + Intronic
1164501769 19:28826518-28826540 TAATTAGCCAAGAGCTCCTTGGG + Intergenic
926662109 2:15478901-15478923 CACTAAGCCAAGAGGTCGTCAGG - Intronic
927788843 2:25993881-25993903 CATTAAGCAAATATCTCCTGGGG - Intergenic
928341223 2:30444818-30444840 CATTAAGTCAATGGCTCATGAGG + Intergenic
928401897 2:30985028-30985050 CACTAGGCCATGAGCTCCTAGGG + Intronic
929142419 2:38677760-38677782 CAGTAGGCCAAGGACTCCTGAGG + Intronic
932386787 2:71341761-71341783 CTTTATGACCAGAGCTCCTGGGG + Intronic
937152232 2:119693720-119693742 CCTGAAGCAAAGGGCTCCTGTGG + Intergenic
941604224 2:167576985-167577007 CATTAAGCCTAGCACTCCTGGGG - Intergenic
942634194 2:177984541-177984563 AATTAAATCAAGAGCTCCTTGGG + Intronic
946709960 2:222495505-222495527 TTTTAAGCCAAGAGATCTTGAGG - Intronic
948364484 2:237445950-237445972 GATGAAGAAAAGAGCTCCTGAGG + Intergenic
1169343420 20:4812812-4812834 CATGCAGCCCAGTGCTCCTGTGG + Intronic
1170396284 20:15929228-15929250 CCTTAAGCCAAGAGCTACAGGGG + Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1172873788 20:38152008-38152030 CATGAAGTCAAGAGTGCCTGGGG - Intronic
1173167585 20:40696430-40696452 CATTCAGCCAGGAGCTGCTGTGG + Intergenic
1173973154 20:47167982-47168004 GATTAAGCCGGGAGCTGCTGAGG - Intronic
1175402277 20:58707455-58707477 CATTGAGCCAACCGCTCATGGGG - Intronic
1176955264 21:15095332-15095354 CATTAACCCAAAAGGGCCTGTGG + Intergenic
1180047611 21:45317079-45317101 AATGCAGCCAAAAGCTCCTGTGG + Intergenic
1180132560 21:45835820-45835842 CATAAGGCCCAGACCTCCTGCGG - Intronic
1181595386 22:23911261-23911283 CATTAACTGAACAGCTCCTGGGG - Intergenic
1181766515 22:25096097-25096119 GAAAAAGCCTAGAGCTCCTGAGG + Intronic
1182902066 22:33906808-33906830 CAGGAAACCAAGGGCTCCTGGGG - Intronic
950275897 3:11660407-11660429 GACCAAACCAAGAGCTCCTGAGG + Intronic
951048610 3:18068805-18068827 ATTTGAGCCATGAGCTCCTGGGG + Intronic
956188356 3:66583916-66583938 CATTATGAGAAAAGCTCCTGTGG - Intergenic
956728122 3:72173340-72173362 AATTAAGCCAAGCACTACTGTGG - Intergenic
959349937 3:105249443-105249465 TATAAAGCCAGGAGCTCCTCAGG - Intergenic
962037676 3:131669943-131669965 CATTATGCACAGAACTCCTGTGG + Intronic
968157855 3:196397688-196397710 CCTACAGCCAAGAACTCCTGGGG + Intronic
968376121 4:43046-43068 CATTAAGCTCAAAGGTCCTGAGG + Intergenic
968973674 4:3810195-3810217 ACTCACGCCAAGAGCTCCTGGGG - Intergenic
969974178 4:11081224-11081246 CATCTGGCCAAGAGCTCATGAGG + Intergenic
973642523 4:52917593-52917615 CTTTAAGTCAAGAGCTTCTGTGG + Intronic
974243846 4:59287912-59287934 CATAAAGCTAAGACTTCCTGAGG - Intergenic
975412159 4:74066188-74066210 CATGAAGCCAAGAACTCATGAGG - Intergenic
978167940 4:105631400-105631422 CATTAACCCATGTGCTCCAGTGG - Intronic
978914228 4:114104205-114104227 CATTATGCCAAGAACTCATAAGG - Intergenic
981772650 4:148328043-148328065 AGTTAAACCCAGAGCTCCTGGGG - Intronic
981847103 4:149182071-149182093 CATAAAACCTAGAGCTGCTGGGG + Intergenic
984497744 4:180519265-180519287 CATTAAGACAAGAAATCCTAAGG - Intergenic
986854341 5:11851520-11851542 CATAAAGCCAGCTGCTCCTGTGG - Intronic
990151834 5:52826849-52826871 CAGTCACCCAAGAGCTCCAGTGG + Intronic
992376606 5:76194064-76194086 CAGTAAACCAAGATCTCTTGTGG - Intronic
992462107 5:76970839-76970861 CAGTAAGACAGGTGCTCCTGTGG + Intronic
994182070 5:96778529-96778551 GAGTAAGCCAGGAGCGCCTGTGG + Intronic
1000445391 5:161312888-161312910 CATAAAGCCAGGAGCTGCTCTGG - Intronic
1001586660 5:172837456-172837478 CATTAGTACATGAGCTCCTGAGG + Intronic
1002986527 6:2194118-2194140 GATTAAGCCAGGATTTCCTGAGG - Intronic
1004251039 6:14023371-14023393 TCTGAAGCCAGGAGCTCCTGGGG - Intergenic
1004910581 6:20278933-20278955 CATCTAGTCAAGACCTCCTGAGG + Intergenic
1004910734 6:20280387-20280409 CACTAAGATAAGAGCTTCTGAGG - Intergenic
1006404076 6:33833988-33834010 CATCAGGCCAGGATCTCCTGGGG + Intergenic
1009686380 6:66962934-66962956 CATTAAGACAATAGCACCAGTGG + Intergenic
1012714379 6:102649620-102649642 AATTAACACAAGAACTCCTGTGG - Intergenic
1015691737 6:135932054-135932076 TATTAAGCCACGAGGTCCTTAGG - Intronic
1015742845 6:136476056-136476078 CATTAAGCAGAAAGCTCGTGGGG + Intronic
1018193387 6:161331623-161331645 TATTAAGGAAACAGCTCCTGGGG - Intergenic
1019815034 7:3193388-3193410 CATGAAGCCAAGAACCCATGTGG - Intergenic
1022242992 7:28530871-28530893 TATTAAGACAAGATCTTCTGCGG + Intronic
1025617785 7:63138655-63138677 CTTTAAGCCAAAATCTCCAGAGG - Intergenic
1027194329 7:76019163-76019185 CCTTAAACCAAGATATCCTGAGG + Intronic
1027454259 7:78368120-78368142 AGTTAAGACAAGTGCTCCTGAGG + Intronic
1031562499 7:123255464-123255486 CATTAAGCCCAGAGGTCTAGGGG + Intergenic
1034717215 7:153254748-153254770 GAATAAGCCAAGAGCTCATCTGG + Intergenic
1037650657 8:20835507-20835529 CCTTAAGCAAAGGGCTACTGGGG - Intergenic
1038545825 8:28424984-28425006 GAATAAGCCAAGATCCCCTGGGG - Intronic
1042192322 8:66199697-66199719 CATGAATCCCAGAACTCCTGGGG - Intergenic
1044759952 8:95507391-95507413 CCTGAAGAGAAGAGCTCCTGGGG + Intergenic
1045340560 8:101250843-101250865 CAAGAAGACAACAGCTCCTGTGG - Intergenic
1048413709 8:134202981-134203003 TATTAGACCAAGAGCTCCTGTGG - Intergenic
1049318331 8:141981526-141981548 CGGGAAGCCAGGAGCTCCTGAGG + Intergenic
1051583794 9:18705946-18705968 CATGAAGCCAAGAACCCATGAGG - Intronic
1051720679 9:20033953-20033975 CAAGAAGCCAAGAACTCATGTGG + Intergenic
1053319310 9:37080804-37080826 CACAAAGTCAAGAGCTTCTGAGG - Intergenic
1053323624 9:37121445-37121467 CACAAAGTCAAGAGCTTCTGAGG - Intronic
1203573104 Un_KI270744v1:151104-151126 CATTAAGCTCAAAGGTCCTGAGG - Intergenic
1186339465 X:8628471-8628493 CATGAAGCCAAGAACCCATGTGG + Intronic
1189847078 X:45147972-45147994 CATTAAGCCATCAGGTCCTTCGG - Intergenic
1195792660 X:108605976-108605998 CCTTCAGCAAAGAGCTGCTGTGG + Intronic
1199573290 X:149289430-149289452 CACTGAGCAAAGAGCTGCTGGGG - Intergenic
1199604711 X:149568055-149568077 CATTCAGCCATGAGCTCCCAGGG + Intergenic
1200965051 Y:9028028-9028050 CATACAGCCAGCAGCTCCTGAGG + Intergenic
1202148060 Y:21820745-21820767 CATACAGCCAGCAGCTCCTGAGG - Intergenic